ID: 1010980624

View in Genome Browser
Species Human (GRCh38)
Location 6:82365136-82365158
Sequence CACAGCGCGGGGCACTGGTC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 111}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010980624_1010980629 -9 Left 1010980624 6:82365136-82365158 CCGGACCAGTGCCCCGCGCTGTG 0: 1
1: 0
2: 0
3: 17
4: 111
Right 1010980629 6:82365150-82365172 CGCGCTGTGCGAGTGCTCCGAGG 0: 1
1: 0
2: 0
3: 1
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010980624 Original CRISPR CACAGCGCGGGGCACTGGTC CGG (reversed) Exonic
903141010 1:21339129-21339151 CTCAGGGCGGGGGACTGGGCTGG + Intronic
904811444 1:33165626-33165648 CCCAGCGCCTGGCAGTGGTCAGG - Intronic
922727414 1:227928981-227929003 CACAGCGCCGGCCCCTGGTCTGG - Intronic
1067103821 10:43351617-43351639 CCCAGCGCTGGGCAGGGGTCTGG - Intergenic
1070642827 10:78181558-78181580 CACAGGGCTGGGCACTGCCCAGG - Intergenic
1070814190 10:79312845-79312867 CACAGCCCGTGGCTCTGGTGCGG - Exonic
1076031093 10:127159287-127159309 CACAGCGTGGAGCTCTAGTCAGG + Intronic
1076110492 10:127855866-127855888 CACAGACCTGGGCACTTGTCTGG + Intergenic
1077219270 11:1408230-1408252 CACAGGGAGGGGAACTGGTCAGG - Intronic
1077232057 11:1462200-1462222 CACGGCGGCGGGCACTGGGCAGG - Intronic
1078317085 11:10303241-10303263 TGCAGCGCGGCGCACTGGTCTGG - Intergenic
1080873063 11:36253614-36253636 GACAGCATGGGGCTCTGGTCTGG + Intergenic
1082083712 11:48032047-48032069 CAGAGCACTGGGCACTGGGCTGG - Intronic
1084179188 11:67438120-67438142 CAGAGGGCTGGGCAGTGGTCGGG + Exonic
1085570880 11:77556850-77556872 CCCAGCCCGAGGCTCTGGTCTGG - Intronic
1089050502 11:115540957-115540979 CACAGTGCAGGGCACAGGACAGG - Intergenic
1091131185 11:133148489-133148511 CACAGCCCTGGGCACTGGTTTGG + Intronic
1091347905 11:134867491-134867513 CACAGCGCTGGGCCCAGGGCCGG + Intergenic
1096801913 12:54116033-54116055 CACAGCCCTGGGCCCTGGTCAGG + Intergenic
1103218786 12:119225753-119225775 CAGAGAGCCGGGGACTGGTCAGG + Intergenic
1103556132 12:121767689-121767711 CACACCCCGGGGCTCTGGGCTGG - Intronic
1105725536 13:23159709-23159731 CAGCGCGCGGGGCACTGGGCAGG - Intergenic
1109040829 13:57334116-57334138 CACAGCAGGGGGCCCAGGTCAGG - Intergenic
1109613785 13:64803247-64803269 CACAGAGTGGGTCATTGGTCAGG - Intergenic
1113693318 13:112327203-112327225 CACAGGGCGGGGCAGAGGGCAGG - Intergenic
1113770103 13:112902811-112902833 CCCAGGCAGGGGCACTGGTCTGG - Intronic
1118328946 14:64801142-64801164 CACAGTGAGGGGCAGTGGCCAGG - Intronic
1118919695 14:70138930-70138952 CACAGCGCCTGGCACTGGGCAGG - Intronic
1119434125 14:74586867-74586889 CACAGAGCGGGGCACTTACCTGG - Intronic
1121673012 14:95727518-95727540 CACAGCGTGGTGCACTGAACAGG + Intergenic
1122842051 14:104470774-104470796 CACAGCTCGGGGGAATGGCCTGG - Intergenic
1123758738 15:23416782-23416804 CACAGGGCGGGGCGCAGGTCAGG - Intergenic
1132815797 16:1826161-1826183 CGCAGCGCAGGGCACTGGGCGGG - Intronic
1133130193 16:3671961-3671983 CACAGCCCAGGTCACTGTTCTGG - Intronic
1133136595 16:3716906-3716928 CACGGCGCCGGGCACTGAGCGGG + Intronic
1133933608 16:10251805-10251827 CACAGCGCTGGGCACAGAGCAGG + Intergenic
1134457597 16:14406079-14406101 CACAAGGCGGGGCGCAGGTCAGG + Intergenic
1137454666 16:48609469-48609491 CACAGCGTGTGGCACGGATCGGG - Intronic
1140514911 16:75534880-75534902 CACTGCGCAGGGCAGGGGTCGGG - Intronic
1141181629 16:81756879-81756901 CACAGCCTGGGGCACAGGCCTGG + Intronic
1142072807 16:88100510-88100532 CTCAGCAAGGGGCACTGGTTGGG - Intronic
1144737639 17:17563947-17563969 CACAGGGCGGGGCTGTGGCCTGG + Intronic
1144762774 17:17716817-17716839 CTTAGCGTGGGGCACTGGTGGGG + Intronic
1147337882 17:39738185-39738207 CACAGCCTGGGGCCCTGGTGCGG - Intronic
1151969720 17:77451382-77451404 CAGAGCGCGGGGCAGAGGTAGGG - Intronic
1152553175 17:81039933-81039955 CACAGGTCTGGGCCCTGGTCAGG + Intronic
1153116714 18:1666013-1666035 CACAGTGCTAGGCACTGGTGAGG - Intergenic
1153153339 18:2120871-2120893 CACATCCCTGGTCACTGGTCTGG - Intergenic
1153822450 18:8843972-8843994 CACAGGGCGGGGCCTTGGTGGGG - Intergenic
1156149443 18:34224604-34224626 CCAGGCGCCGGGCACTGGTCGGG - Intronic
1156382394 18:36576031-36576053 CACAGACTGGGGCACTGGACAGG + Intronic
1158197946 18:54909694-54909716 CACAGCGCCGGGTACTGGCATGG + Intronic
1159770820 18:72543728-72543750 CACAGCGCGGGGCGCTGAGCCGG - Intronic
1161293728 19:3508933-3508955 CACAGCCCAGGGCACTGAGCAGG - Intronic
1161966087 19:7549995-7550017 CGCAGCCCGGGGAACTGGTGGGG + Exonic
1163686753 19:18716113-18716135 CCCAGGGCGGGGCACTGGGCAGG - Intronic
1165113297 19:33514317-33514339 CACAGCACGGTGAAGTGGTCTGG + Intronic
925327512 2:3035120-3035142 CACAGCGCAGGGCAGGGGTTGGG - Intergenic
925345904 2:3171643-3171665 CCCAGCGCTGGGCACAGGCCAGG + Intergenic
931190488 2:59995597-59995619 CACAGAGCAGGGGACTGGACAGG - Intergenic
932338158 2:70942831-70942853 CTCAGAGAAGGGCACTGGTCAGG + Intronic
934567155 2:95347196-95347218 CACGCCGGGGTGCACTGGTCTGG + Intronic
935237567 2:101151361-101151383 CAGAGCGCTGGGCACCGGCCGGG - Intronic
945097283 2:206231605-206231627 CACCGCGCCCGGCCCTGGTCAGG + Intergenic
946298824 2:218809642-218809664 CCAAGAGCGGGGCACTGGCCAGG - Exonic
946727103 2:222671684-222671706 CCCAGCGCGGGGCCCGGATCCGG + Intergenic
947398977 2:229714107-229714129 CGCGGTGCGGGGCGCTGGTCCGG - Intronic
1171354652 20:24534511-24534533 CAGACCGAGGGGCACTGTTCCGG - Intronic
1171794798 20:29558433-29558455 CACAGCCCTGGGCCCTGGTCAGG - Intergenic
1171853658 20:30325832-30325854 CACAGCCCTGGGCCCTGGTCAGG + Intergenic
1172293237 20:33790920-33790942 CCCAGCGCAGGGCACTGTTGCGG + Intronic
1175275976 20:57771099-57771121 CACAGCGCTGGGCACGTGCCTGG + Intergenic
1175976614 20:62713526-62713548 CACAGCCTGGGGCACGGGACAGG - Intronic
1176124782 20:63470630-63470652 CGCAGAGCGGGGCGCTGGCCAGG + Intronic
1176159663 20:63641851-63641873 CAGGGGGCGGGGCACTGGGCGGG - Intronic
1176159718 20:63641976-63641998 CAGGGGGCGGGGCACTGGGCGGG - Intronic
1178419689 21:32433685-32433707 CACAGAGCAGGGCACTGTTGTGG + Intronic
950407934 3:12816209-12816231 CTCAGCCCTGGCCACTGGTCAGG + Intronic
950543537 3:13626045-13626067 TACAGCGGGGGGCGCTGGGCGGG - Intronic
958887627 3:99745039-99745061 CAGAGGGCAGGGCAGTGGTCTGG + Intronic
961884271 3:130085706-130085728 CACAGAGCAGGGCACTGTTGTGG - Intronic
962814158 3:138983553-138983575 CACAGCGCCTGGCACAGGTGAGG + Intergenic
966550563 3:181199920-181199942 CACAGCTCAGGCCACTGCTCTGG - Intergenic
968356472 3:198111506-198111528 CACAGCCAGTGGCACAGGTCTGG + Intergenic
984973272 4:185209468-185209490 CACAGCGCGGGGGCGGGGTCCGG - Intronic
985490074 5:174139-174161 CACAGCTAGGGGCAGGGGTCGGG + Intronic
986290693 5:6396860-6396882 CACAGGGCAGGCCACTGGGCTGG + Intergenic
986290718 5:6396955-6396977 CACAGGGCTGGCCACTGGGCAGG + Intergenic
986290735 5:6397027-6397049 CACAGGGCTGGCCACTGGGCAGG + Intergenic
986290753 5:6397099-6397121 CACAGGGCTGGCCACTGGGCAGG + Intergenic
994412169 5:99420352-99420374 CACAGCCCGAAGCACTGGTATGG - Intergenic
994481652 5:100344901-100344923 CACAGCCCGAAGCACTGGTATGG + Intergenic
995010765 5:107255139-107255161 CACAGGGCAGGGCACTGACCGGG + Intergenic
996790037 5:127282525-127282547 CACAGCGCTGCGAATTGGTCAGG - Intergenic
997370191 5:133354639-133354661 CAAAGGGCGGGGCACTGGGCAGG + Intronic
997441226 5:133909833-133909855 CACAGTGCTGAGCCCTGGTCAGG + Intergenic
998068848 5:139180756-139180778 CACAGCTCTGGGCACTAGTATGG + Intronic
1001452253 5:171835847-171835869 CAGAGCGCTGGGCCCTGCTCTGG - Intergenic
1004255554 6:14060190-14060212 CACAGCACAGAGCACTGGGCTGG + Intergenic
1007451302 6:41941715-41941737 GAGAGCGCGGGGCGCGGGTCTGG + Exonic
1010980624 6:82365136-82365158 CACAGCGCGGGGCACTGGTCCGG - Exonic
1014802259 6:125790656-125790678 CGCAGCGCGCGCCACTGGCCGGG + Intronic
1016328161 6:142926774-142926796 CCCAGCGCCGGGAGCTGGTCCGG - Intronic
1018396277 6:163380217-163380239 CAAAGAGCAGGGCACTGGTGGGG - Intergenic
1018430559 6:163718401-163718423 CACAACTCGAGGCACTGGTCAGG - Intergenic
1019928827 7:4210197-4210219 CAGAGGGCTGGGCACTGGTGTGG - Intronic
1020105612 7:5421041-5421063 CACGGCGCGGGGCACTTACCCGG + Exonic
1023120817 7:36906601-36906623 CTCAGCGGTGGACACTGGTCTGG - Intronic
1026289581 7:68994284-68994306 AGCTGCGAGGGGCACTGGTCTGG - Intergenic
1033236446 7:139641595-139641617 CACAGCCCGGGGAACAGGTTTGG + Intronic
1034556238 7:151852150-151852172 CTCAGACCGAGGCACTGGTCGGG + Intronic
1036148329 8:6275253-6275275 GACAGCGCTGGGCATTGGGCAGG - Intergenic
1037897598 8:22668645-22668667 CACAGCGAGGGCCACAGCTCTGG + Intronic
1038147705 8:24913692-24913714 CACGGGGCGGGGCCCTGGCCCGG + Exonic
1049470668 8:142773837-142773859 CAGAGCTGGGAGCACTGGTCAGG + Intronic
1049682508 8:143925974-143925996 GACAGCGCGGAGCAGGGGTCGGG + Intronic
1053791462 9:41689129-41689151 CACAGCCCTGGGACCTGGTCAGG + Intergenic
1054153698 9:61625642-61625664 CACAGCCCTGGGACCTGGTCAGG - Intergenic
1054179809 9:61900822-61900844 CACAGCCCTGGGCCCTGGTCAGG + Intergenic
1054473479 9:65556761-65556783 CACAGCCCTGGGACCTGGTCAGG - Intergenic
1054657730 9:67679998-67680020 CACAGCCCTGGGCCCTGGTCAGG - Intergenic
1062636065 9:137492527-137492549 CACAGGGCGGGGCCATGGGCGGG + Intronic
1191862686 X:65678696-65678718 TACAGCTTGGGGCACTTGTCTGG + Intronic
1193320366 X:80114726-80114748 CACAGCAGGGGGCCCTGGGCTGG - Intergenic
1193796906 X:85888179-85888201 CACAGCAGGGGGCCCTGGCCTGG - Intronic
1197700513 X:129596068-129596090 TACAGCGGGGGGCCTTGGTCAGG + Intergenic
1199679743 X:150216338-150216360 CACAGTGCTGGGCATTGGACAGG - Intergenic
1199695488 X:150340711-150340733 CACAGTGCTGGGCATTGGACAGG + Intergenic
1200310388 X:155071436-155071458 CACAGCGCTGGGCGCTGGGGAGG + Intronic