ID: 1010981521

View in Genome Browser
Species Human (GRCh38)
Location 6:82375260-82375282
Sequence CTCTACAGTGAGGGAATCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010981512_1010981521 16 Left 1010981512 6:82375221-82375243 CCAGAGACCCCAGGAGGCATGAG No data
Right 1010981521 6:82375260-82375282 CTCTACAGTGAGGGAATCTCTGG No data
1010981517_1010981521 7 Left 1010981517 6:82375230-82375252 CCAGGAGGCATGAGAGGAGGTTG No data
Right 1010981521 6:82375260-82375282 CTCTACAGTGAGGGAATCTCTGG No data
1010981516_1010981521 8 Left 1010981516 6:82375229-82375251 CCCAGGAGGCATGAGAGGAGGTT No data
Right 1010981521 6:82375260-82375282 CTCTACAGTGAGGGAATCTCTGG No data
1010981515_1010981521 9 Left 1010981515 6:82375228-82375250 CCCCAGGAGGCATGAGAGGAGGT No data
Right 1010981521 6:82375260-82375282 CTCTACAGTGAGGGAATCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010981521 Original CRISPR CTCTACAGTGAGGGAATCTC TGG Intergenic
No off target data available for this crispr