ID: 1010982288

View in Genome Browser
Species Human (GRCh38)
Location 6:82381907-82381929
Sequence TATACTATCCAGAAGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010982288_1010982292 -3 Left 1010982288 6:82381907-82381929 CCATCCTCCTTCTGGATAGTATA No data
Right 1010982292 6:82381927-82381949 ATAGAGGCTATTCATTTTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010982288 Original CRISPR TATACTATCCAGAAGGAGGA TGG (reversed) Intergenic
No off target data available for this crispr