ID: 1010987527

View in Genome Browser
Species Human (GRCh38)
Location 6:82442000-82442022
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010987520_1010987527 6 Left 1010987520 6:82441971-82441993 CCTATCTGATTTACTCTCACATT No data
Right 1010987527 6:82442000-82442022 ACTTCTCTGGAGAAGATGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010987527 Original CRISPR ACTTCTCTGGAGAAGATGGG GGG Intergenic
No off target data available for this crispr