ID: 1010993208

View in Genome Browser
Species Human (GRCh38)
Location 6:82502848-82502870
Sequence TGTTTTGTGAAGGATATAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010993208_1010993212 12 Left 1010993208 6:82502848-82502870 CCCTCTATATCCTTCACAAAACA No data
Right 1010993212 6:82502883-82502905 ATAAAAATCAGCCTTTATTTCGG No data
1010993208_1010993213 13 Left 1010993208 6:82502848-82502870 CCCTCTATATCCTTCACAAAACA No data
Right 1010993213 6:82502884-82502906 TAAAAATCAGCCTTTATTTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010993208 Original CRISPR TGTTTTGTGAAGGATATAGA GGG (reversed) Intergenic
No off target data available for this crispr