ID: 1010994835

View in Genome Browser
Species Human (GRCh38)
Location 6:82521142-82521164
Sequence CTGGCTCCTGAATCCTTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010994835_1010994838 -10 Left 1010994835 6:82521142-82521164 CCAACAAAGGATTCAGGAGCCAG No data
Right 1010994838 6:82521155-82521177 CAGGAGCCAGGAGAGAGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010994835 Original CRISPR CTGGCTCCTGAATCCTTTGT TGG (reversed) Intergenic
No off target data available for this crispr