ID: 1011002600

View in Genome Browser
Species Human (GRCh38)
Location 6:82607733-82607755
Sequence TTTAGGAAACAGACTCAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011002594_1011002600 17 Left 1011002594 6:82607693-82607715 CCAAAAACACTGTGAGAAAGTGT No data
Right 1011002600 6:82607733-82607755 TTTAGGAAACAGACTCAGGGAGG No data
1011002592_1011002600 21 Left 1011002592 6:82607689-82607711 CCCTCCAAAAACACTGTGAGAAA No data
Right 1011002600 6:82607733-82607755 TTTAGGAAACAGACTCAGGGAGG No data
1011002590_1011002600 23 Left 1011002590 6:82607687-82607709 CCCCCTCCAAAAACACTGTGAGA No data
Right 1011002600 6:82607733-82607755 TTTAGGAAACAGACTCAGGGAGG No data
1011002591_1011002600 22 Left 1011002591 6:82607688-82607710 CCCCTCCAAAAACACTGTGAGAA No data
Right 1011002600 6:82607733-82607755 TTTAGGAAACAGACTCAGGGAGG No data
1011002593_1011002600 20 Left 1011002593 6:82607690-82607712 CCTCCAAAAACACTGTGAGAAAG No data
Right 1011002600 6:82607733-82607755 TTTAGGAAACAGACTCAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011002600 Original CRISPR TTTAGGAAACAGACTCAGGG AGG Intergenic
No off target data available for this crispr