ID: 1011003265

View in Genome Browser
Species Human (GRCh38)
Location 6:82615397-82615419
Sequence GTTTCATGGTTGCTTGCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011003262_1011003265 29 Left 1011003262 6:82615345-82615367 CCTGGGATGGAGACAAAAGACTT No data
Right 1011003265 6:82615397-82615419 GTTTCATGGTTGCTTGCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011003265 Original CRISPR GTTTCATGGTTGCTTGCTTC AGG Intergenic
No off target data available for this crispr