ID: 1011008626

View in Genome Browser
Species Human (GRCh38)
Location 6:82677946-82677968
Sequence AGGTGCTGCAGCTGAAGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011008623_1011008626 11 Left 1011008623 6:82677912-82677934 CCAACAAGTATTTTTAGGGAAGA No data
Right 1011008626 6:82677946-82677968 AGGTGCTGCAGCTGAAGAGATGG No data
1011008620_1011008626 23 Left 1011008620 6:82677900-82677922 CCAATCACTGAGCCAACAAGTAT No data
Right 1011008626 6:82677946-82677968 AGGTGCTGCAGCTGAAGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011008626 Original CRISPR AGGTGCTGCAGCTGAAGAGA TGG Intergenic
No off target data available for this crispr