ID: 1011020784

View in Genome Browser
Species Human (GRCh38)
Location 6:82809787-82809809
Sequence GAGGGCAAACAGAAGCAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2287
Summary {0: 6, 1: 75, 2: 308, 3: 635, 4: 1263}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011020784_1011020793 24 Left 1011020784 6:82809787-82809809 CCACCCTGCTTCTGTTTGCCCTC 0: 6
1: 75
2: 308
3: 635
4: 1263
Right 1011020793 6:82809834-82809856 CAGTCCCATTGAGATGAACCAGG 0: 28
1: 736
2: 962
3: 1196
4: 778

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011020784 Original CRISPR GAGGGCAAACAGAAGCAGGG TGG (reversed) Intergenic
Too many off-targets to display for this crispr