ID: 1011022851

View in Genome Browser
Species Human (GRCh38)
Location 6:82833598-82833620
Sequence GTGTAGGCCAAGCTAACTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1421
Summary {0: 12, 1: 72, 2: 183, 3: 479, 4: 675}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011022851_1011022859 25 Left 1011022851 6:82833598-82833620 CCCAAAGTTAGCTTGGCCTACAC 0: 12
1: 72
2: 183
3: 479
4: 675
Right 1011022859 6:82833646-82833668 CTGTGAGACTAGCAGCAAGATGG No data
1011022851_1011022855 -7 Left 1011022851 6:82833598-82833620 CCCAAAGTTAGCTTGGCCTACAC 0: 12
1: 72
2: 183
3: 479
4: 675
Right 1011022855 6:82833614-82833636 CCTACACCTAGGAATGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011022851 Original CRISPR GTGTAGGCCAAGCTAACTTT GGG (reversed) Intergenic
900662722 1:3793420-3793442 GCTTGGGCCAAGCTAACTTTGGG + Intronic
900848888 1:5126378-5126400 GTGTAGGCTGAACTAACTTTGGG + Intergenic
901291003 1:8124311-8124333 GCATAGGCCAAACTAACTTTGGG - Intergenic
901412796 1:9096370-9096392 GTATGGGCCAAGCTAACTTTGGG - Intergenic
901479092 1:9511828-9511850 GTGTAGGCTGAACTAACTTTGGG + Intergenic
901495911 1:9621743-9621765 GCATGGGCCAAGCTAATTTTGGG + Intergenic
902593365 1:17490915-17490937 CCGTGGGCCAAGCTAACTTTGGG + Intergenic
902970902 1:20048629-20048651 GCATAGGCCAAACTAACTTTTGG - Intronic
904111914 1:28132784-28132806 ACTTGGGCCAAGCTAACTTTGGG + Intergenic
904303386 1:29570800-29570822 GCGTAGGCAGAACTAACTTTGGG - Intergenic
904531279 1:31171274-31171296 GTGTAGGCCAAAGTAACCTTGGG + Intergenic
904709361 1:32416950-32416972 GCGTAGACCAAACCAACTTTGGG - Intergenic
905053980 1:35077346-35077368 GCATAGGCTAAACTAACTTTGGG + Intronic
905551993 1:38849318-38849340 CTGTAGTCCTAGCTAAATTTGGG - Intronic
905710178 1:40095536-40095558 CTGTAGGACAAGCTGACTTAGGG - Intronic
905830375 1:41061125-41061147 GCTTGGGACAAGCTAACTTTGGG + Intronic
906019827 1:42617954-42617976 GTGTAGGCCCAACTAACTTTGGG - Intronic
906378273 1:45314536-45314558 GCGTAGGCTGAACTAACTTTGGG + Intergenic
906390449 1:45410920-45410942 GCATAGGCCAAGCTAACTTTGGG + Intronic
906394008 1:45444793-45444815 GCATAAGCCAAGCTAACTATGGG + Intronic
906740100 1:48174293-48174315 GCATAGGCTGAGCTAACTTTGGG + Intergenic
906742856 1:48199306-48199328 GCTTGGGCCAAGCTAACTTTGGG - Intergenic
907081945 1:51631759-51631781 GCTTAAGCCAAGCTAACTTTGGG - Intronic
907133640 1:52119172-52119194 GCGTAGGCCGAACTAACCTTGGG + Intergenic
907147728 1:52251272-52251294 ATGTTGGCCAGGCTAGCTTTCGG + Intronic
907510132 1:54951740-54951762 GCGTAGGCCGAACTAACTTTGGG - Intergenic
907795408 1:57711232-57711254 GCTTAGGCCAAGCTAACTTTGGG - Intronic
908068902 1:60436813-60436835 GTGTAGGCTGAACTAACTTTGGG + Intergenic
908271356 1:62425522-62425544 GGGTAGGCCAAGCTAACCATGGG - Intergenic
908546169 1:65164219-65164241 GTGTAGGCCAAACTAACTTTGGG - Intronic
908667128 1:66505885-66505907 GTGTAGGCCAAGCTAACCATGGG + Intergenic
909687597 1:78368244-78368266 GCATAGGCCAAGCTCACTTTGGG + Intronic
910195619 1:84636823-84636845 GCTTGGGCCAAGCTAACTTTGGG - Intergenic
910218220 1:84863772-84863794 GTTTTGGACAAGCTAAATTTAGG - Intronic
910309692 1:85809402-85809424 GCAAAGGCCAAGCTAACTTTGGG - Intronic
910377890 1:86593472-86593494 GTGTAGCCCGAACTAACTTTGGG + Intergenic
910461712 1:87454526-87454548 GCTTAGGCCAAGTTAACTTTGGG + Intergenic
910645462 1:89509358-89509380 GCATAGGCCAAGCTAACTATGGG - Intergenic
911022090 1:93399277-93399299 ATGTAGGCCAAGCTAACTTTGGG - Intergenic
911331059 1:96526273-96526295 GCATAGGCCAAACTAACTTTGGG + Intergenic
911485227 1:98497237-98497259 TTGTAGACCAAGTTAACTTTGGG + Intergenic
911592911 1:99768162-99768184 GCATATGCCAAACTAACTTTGGG - Intergenic
911691344 1:100838294-100838316 CTGAAGGCCATGCTAACTATGGG + Intergenic
912014689 1:105018014-105018036 GCGTAGGACAAACTAACTTTGGG - Intergenic
912020787 1:105107213-105107235 GTGTAGGCTGAACTAACTTTGGG + Intergenic
912125066 1:106526355-106526377 ATGCAGGTCAAGCTAACTATGGG + Intergenic
912346607 1:108968861-108968883 GAGTGGGCCAAACTAACTTTGGG + Intergenic
912537246 1:110383884-110383906 GCGTAGGCTGAACTAACTTTGGG - Intronic
912541696 1:110421048-110421070 GCATAGGCCAAGCTAATCTTGGG + Intergenic
912582008 1:110729429-110729451 GTGTAGGCTGAACTAACTATAGG - Intergenic
912583742 1:110742949-110742971 GTGTAGACGGAACTAACTTTGGG - Intergenic
912826066 1:112904487-112904509 GTATAGGCCGAACTAACTTTGGG - Intergenic
912988392 1:114458066-114458088 ATGTGGGCCAACCTAACTATGGG + Intronic
913126860 1:115799111-115799133 GCGTAGGCCAAACTAACTTTGGG + Intergenic
913261343 1:117000613-117000635 TTGTAGGCCAAACTAACTTTGGG - Intergenic
913284814 1:117216569-117216591 GCTTGGGCCAAGCTAATTTTGGG - Intergenic
913289928 1:117262571-117262593 GCATAGACCAAACTAACTTTGGG - Intergenic
914318931 1:146540821-146540843 GCTTACGCCAAGTTAACTTTGGG + Intergenic
914495426 1:148192536-148192558 GCTTATGCCAAGTTAACTTTGGG - Intergenic
916272868 1:162962744-162962766 GCTTTGGCCAAGCTAACTTGGGG + Intergenic
916302454 1:163291348-163291370 GTTTATGGCAAGCTAACTTTGGG + Intronic
916409265 1:164529157-164529179 GCATAGGCCAAGCTAACTATGGG - Intergenic
916624395 1:166538969-166538991 GTGTAGGCTGAACTAACTTTGGG + Intergenic
917071873 1:171160114-171160136 GCATAGGCCAAGCTAACTATGGG - Intronic
917314771 1:173713361-173713383 GCTTAAGCCAAGATAACTTTGGG + Intergenic
917412107 1:174769613-174769635 GCTTAAGCCAAGCTAACTTTGGG - Intronic
917472048 1:175334262-175334284 GCATAGGCCAAGCTAACCATGGG + Intronic
917538733 1:175893435-175893457 ACATAGGCCAAGCTAACTGTGGG + Intergenic
917727316 1:177839979-177840001 TTGCGGACCAAGCTAACTTTGGG + Intergenic
917855694 1:179097587-179097609 GCATAGGCCAAACTAGCTTTGGG + Intronic
918019958 1:180677813-180677835 GCATAGACCAAACTAACTTTGGG - Intronic
918075948 1:181171703-181171725 GCATGGGCCAAGCTACCTTTGGG - Intergenic
918221253 1:182438923-182438945 GCATAGGCCAAGATAACTGTGGG + Intergenic
918307238 1:183258464-183258486 GTGTAGGCTGAACTAACTTCAGG + Intronic
918400309 1:184156362-184156384 GCATAGGCAAAACTAACTTTGGG - Intergenic
918452496 1:184673099-184673121 GCATAGGCCAAACTAACTTTGGG + Intergenic
918621507 1:186611020-186611042 GTGTAGGCCAAGCTAATTGTAGG + Intergenic
918690006 1:187467959-187467981 GCTTAGGCCAAGATAACTTTGGG - Intergenic
919024221 1:192147467-192147489 GCATAGGCCAAGCTTACTTTGGG + Intergenic
919276814 1:195428826-195428848 GCTCAGGCCAAGCTAACTATGGG - Intergenic
919468701 1:197952546-197952568 GCATAGGCCCAACTAACTTTGGG + Intergenic
919482525 1:198107604-198107626 GCATAGGCAAAGCTAACTTTGGG - Intergenic
919772006 1:201167709-201167731 GCTTAGGCCAAACTAACTTTGGG - Intronic
921035845 1:211377296-211377318 GTGTAGGCGGAACTAACTTTGGG - Intergenic
921421031 1:214948371-214948393 GTGAAGGCCAAACTAACTACGGG - Intergenic
922190567 1:223315149-223315171 GTGTAAGCCAAGCTATGTTTGGG + Intronic
922334142 1:224605406-224605428 GGGTGGGCCAAGCTAACTTTGGG + Intronic
922912973 1:229232965-229232987 GCTTGGGCCAAGCTAACTTGGGG + Intergenic
923066256 1:230520001-230520023 GTGTGGGCCAAACTAACCTTGGG + Intergenic
923089430 1:230728425-230728447 GCATGGGTCAAGCTAACTTTAGG - Intergenic
923328672 1:232902527-232902549 GTGTAGACTCAACTAACTTTGGG - Intergenic
923382381 1:233434495-233434517 GCTTGGGCCAAGCTAACTTTGGG - Intergenic
923483666 1:234408348-234408370 GTGTAGGCTCAACTAACTTTGGG + Intronic
923861414 1:237895429-237895451 GAGTAAGCCAAGCTAACTTTGGG - Intergenic
923884478 1:238139594-238139616 GCATAGGCCAAGCTAACCGTGGG + Intergenic
923916785 1:238516028-238516050 ATGTAGGCCAAGCTAACTATGGG + Intergenic
923958878 1:239054802-239054824 GCGTAGGCTGAACTAACTTTGGG + Intergenic
924113720 1:240725518-240725540 GTGTAGGCCAAGCTAACTTTGGG + Intergenic
924807788 1:247374953-247374975 GTGTAGGCTGAACTAACTTTGGG + Intergenic
1063038790 10:2316012-2316034 GTATAGGCTGAACTAACTTTGGG + Intergenic
1063155151 10:3372506-3372528 GCATAGGCCAAGCTAACCATGGG - Intergenic
1063221216 10:3970209-3970231 GCGTAGGCCGAACTAACTTTGGG + Intergenic
1063237023 10:4127538-4127560 GTGTAGGCTGAAGTAACTTTGGG - Intergenic
1063251467 10:4279726-4279748 ATGCAGGCCAAGCTAAGTATGGG + Intergenic
1064174496 10:13062625-13062647 GGGTAGGCTGAACTAACTTTGGG + Intronic
1064328893 10:14375606-14375628 GTGTAGGCTGAACTAACTTTGGG + Intronic
1064422514 10:15202918-15202940 GTTTGGGCCAAGCTAACTTTGGG + Intergenic
1064472962 10:15655959-15655981 GTGTAGTCCCAGCTAACTGTGGG + Intronic
1064858406 10:19797434-19797456 GCATGGGCCAAGCTAACTTTGGG + Intergenic
1064941364 10:20739419-20739441 GTGTAGGCTGAACTAACTTTGGG - Intergenic
1064991887 10:21263633-21263655 ACGTAGGCCAAGCTAACTATGGG - Intergenic
1065007557 10:21393840-21393862 TCGTAGGCCAAACTAACTTTGGG + Intergenic
1065207992 10:23375265-23375287 GGGTAGGCCAAACTAACTTTGGG - Intergenic
1065217010 10:23458948-23458970 GCGTAGGCTGAACTAACTTTGGG + Intergenic
1065427259 10:25618718-25618740 GCATAGGCCAAGCTAACTATGGG - Intergenic
1065737720 10:28769709-28769731 TTGGAGTACAAGCTAACTTTGGG + Intergenic
1065901376 10:30211099-30211121 GTGCAGGCCAAACTAACTTTGGG - Intergenic
1066109125 10:32180897-32180919 TCCTAGGCCAAGCTAACTATGGG + Intergenic
1066207712 10:33205977-33205999 GCATAGGCCAAACTAACTTTAGG - Intronic
1066249013 10:33615007-33615029 GCCTGGGCCAGGCTAACTTTGGG + Intergenic
1066267992 10:33794990-33795012 GCATAGGCCAAGCTAACTTTGGG - Intergenic
1066330533 10:34416927-34416949 CCATAGGCCAAGCTAACTTTGGG + Intronic
1067823481 10:49551097-49551119 GTGTACACCAAACTAATTTTGGG - Intergenic
1067823727 10:49553660-49553682 GTGTAGGCCAAGCTAACTTTGGG - Intergenic
1068089887 10:52420649-52420671 GAGTGGGCCAAGATAACTTTGGG + Intergenic
1068111390 10:52684666-52684688 GTGTAGGCCGAACTAACCTTGGG - Intergenic
1068187221 10:53600533-53600555 GTGTGGGCCAAGCTAATTTTGGG - Intergenic
1068288959 10:54976893-54976915 GTGTAGACCAAACTAACTAAGGG - Intronic
1068302498 10:55162556-55162578 GCATGGGCCAAGCTAACTTTGGG + Intronic
1068311502 10:55282917-55282939 GTTTAGGCCTAAGTAACTTTTGG + Intronic
1068496652 10:57791579-57791601 TTGTAGGCCAAACCAACTTTGGG - Intergenic
1068505450 10:57894349-57894371 GCTTAGGCCATGCTAACTTTGGG + Intergenic
1068527180 10:58143671-58143693 GTGTAGGACAAGCTAACTATGGG + Intergenic
1068985573 10:63104931-63104953 GTGTAGGGTGAACTAACTTTGGG - Intergenic
1069136416 10:64772330-64772352 GCATAGGCCAAGCTAACCATGGG - Intergenic
1069265464 10:66452477-66452499 GTGTGGGCCTAGCTAACTACGGG + Intronic
1069323720 10:67205160-67205182 GCCAGGGCCAAGCTAACTTTGGG - Intronic
1069558159 10:69411350-69411372 GTGTAGGCCGAGCTATCTTTGGG + Intronic
1069685213 10:70313579-70313601 GCATAAGCCAAGCTAACTATGGG + Intronic
1069696410 10:70388886-70388908 GCGTAGGCTGAACTAACTTTGGG + Intergenic
1069727400 10:70589663-70589685 GCTTGGGCCAAGCTAACTTTGGG - Intergenic
1069806460 10:71128209-71128231 GTGTGGGCCAAGCTAACTTTGGG + Intergenic
1069935059 10:71909754-71909776 GCATAGGCCAAGCTGACTTTGGG - Intergenic
1070141759 10:73743449-73743471 GTGTAGGTGGAACTAACTTTGGG - Intergenic
1070510486 10:77156487-77156509 GCATAGGCCAAGCTAACTTTGGG + Intronic
1070848190 10:79540977-79540999 GCGTAGGCTGAACTAACTTTGGG - Intergenic
1070899534 10:80016075-80016097 GCCTGGGCGAAGCTAACTTTGGG + Intergenic
1070925588 10:80219192-80219214 GCGTAGGCTGAACTAACTTTGGG + Intergenic
1071217607 10:83426125-83426147 GGGTAGGCCAAGCTAACTTTGGG - Intergenic
1071357610 10:84813451-84813473 GCGTAGGCTGAACTAACTTTGGG - Intergenic
1071858572 10:89649879-89649901 GCTTGAGCCAAGCTAACTTTGGG - Intergenic
1071898314 10:90089048-90089070 GTGCGGGCCGAACTAACTTTGGG - Intergenic
1071936144 10:90532246-90532268 GTGTAGGCTGAATTAACTTTGGG - Intergenic
1072248058 10:93560446-93560468 GCGTAGGCCGAACTAACTATGGG - Intergenic
1072584796 10:96772103-96772125 ATATAGGTCAAGCTAACTTTGGG + Intergenic
1072972236 10:100027354-100027376 GCATAGGCCAAACTAACTTCGGG + Intergenic
1072973347 10:100036759-100036781 ATGTAGGCCGAACTAACTTTGGG + Intergenic
1073354611 10:102843899-102843921 GTATTGTCCAGGCTAACTTTGGG - Intergenic
1073664127 10:105510490-105510512 GCATAGGCAAAGCTAACTTTGGG - Intergenic
1073748482 10:106497025-106497047 GTGTAGAACAAGCTAACTTTGGG + Intergenic
1074011716 10:109489101-109489123 GCATAGACCAAGCTAACTTTGGG + Intergenic
1074025846 10:109633450-109633472 GCATAGGCCAAACTAACTTTGGG - Intergenic
1074262549 10:111868989-111869011 GTGTAGGCCTAACTAGCCTTGGG - Intergenic
1075243529 10:120799699-120799721 GCATGGGCCAAGCTAACTTTGGG + Intergenic
1075377068 10:121987297-121987319 GCATAGGCCAAGCTAACTTTGGG + Intergenic
1075379013 10:122003586-122003608 ATGTGGGCCAAGATAACTTTGGG + Intronic
1076099746 10:127766616-127766638 TCATAGGCCAAACTAACTTTGGG - Intergenic
1076653331 10:132004910-132004932 GCGTAGGCTGAACTAACTTTGGG + Intergenic
1076710129 10:132328623-132328645 GCATAGGCCAAACTAACCTTGGG - Intronic
1076902174 10:133345137-133345159 GTGTAGGTCACACCAACTTTGGG - Intronic
1077313047 11:1900954-1900976 GAGTAGGCTGAACTAACTTTGGG - Intergenic
1077534347 11:3113828-3113850 GCATAGGTCAAACTAACTTTGGG - Intronic
1077720599 11:4624883-4624905 GCATAGGCCAAACCAACTTTTGG + Intergenic
1078303531 11:10159200-10159222 GCGTAGGCTGAACTAACTTTGGG + Intronic
1078409916 11:11106046-11106068 GTGTAGGCCGAAGTAACTTTGGG + Intergenic
1078551673 11:12285499-12285521 GCGTAGGCTGAACTAACTTTGGG - Intronic
1078557804 11:12344651-12344673 CACTATGCCAAGCTAACTTTTGG + Intronic
1078708605 11:13768705-13768727 GCTTAGGCTAAGCTAACTTTGGG - Intergenic
1078751190 11:14165156-14165178 GTGTAGGCTGAACTAACTTTGGG - Intronic
1078752474 11:14177783-14177805 GTGTAGGCTGAACTAACTTTGGG - Intronic
1079563771 11:21854915-21854937 GTGTAGACAAAGCTGACTTTCGG - Intergenic
1079657611 11:23002190-23002212 GTTTGGGCCAACCTAACTTTGGG + Intergenic
1080075435 11:28141947-28141969 GTGTAGGCCAAGCTAACCATAGG - Intronic
1080250452 11:30227646-30227668 GTGTAGGCCAAGCTAACCATGGG - Intergenic
1080948211 11:36998708-36998730 ATGTAGGGAAAGCTATCTTTCGG + Intergenic
1080949139 11:37008588-37008610 GCATGGGCCAAGCTAACTTTGGG - Intergenic
1080990911 11:37533596-37533618 GTGAAGGCCAAACTAACTTTGGG - Intergenic
1081151941 11:39643779-39643801 GTGTAGGCCAAGCTAATTTGGGG + Intergenic
1081185121 11:40032897-40032919 GTATAGGCCAAGCTAATTATGGG - Intergenic
1081316688 11:41638671-41638693 GCATAGGCTAAACTAACTTTGGG + Intergenic
1081321824 11:41700742-41700764 GTGTGGGCCAAGTTAACCATGGG - Intergenic
1081395860 11:42585485-42585507 GCGTAACCCAAACTAACTTTGGG - Intergenic
1081488503 11:43549062-43549084 GCGTAGGCTGAACTAACTTTGGG + Intergenic
1081530551 11:43955891-43955913 GCCGAGGCCAAGCTAATTTTGGG - Intergenic
1081724635 11:45319640-45319662 GTGTAGGCCAACCTAACTTTGGG - Intergenic
1081893700 11:46566784-46566806 GCGTAGGACAAGCTAACTTTGGG + Intronic
1081972463 11:47209147-47209169 GCGTAGGCTGAACTAACTTTGGG + Intergenic
1082051749 11:47776123-47776145 GCATAGGCCAAACTACCTTTGGG + Intergenic
1082096407 11:48134290-48134312 ATGAAGGCCATGCTAACTATAGG - Intronic
1082228754 11:49739824-49739846 GTGTAGGCTGAACCAACTTTGGG + Intergenic
1082942348 11:58720520-58720542 ACGTAGGCCTAACTAACTTTGGG + Intronic
1083084403 11:60127736-60127758 GTGTAGGCCAAGCTAACCATGGG - Intergenic
1083106848 11:60366385-60366407 GAGTAGGCTGAACTAACTTTGGG - Intronic
1083107170 11:60369435-60369457 GCCTAGGCCAAACTAACTTTGGG + Intronic
1083351369 11:62031423-62031445 GTGTAGGCTGAACTAACTTTGGG - Intergenic
1083505976 11:63157595-63157617 ATGTAGGCTGAACTAACTTTGGG + Intronic
1083539111 11:63499541-63499563 GTTTAGGCCAAGCTAACTTTGGG + Intergenic
1084046335 11:66570036-66570058 GCATGGGCCAAGGTAACTTTTGG + Intergenic
1084405910 11:68973155-68973177 GCATAGGCCCAACTAACTTTGGG - Intergenic
1084800996 11:71543897-71543919 GTGTTGGCTGAACTAACTTTGGG - Intronic
1085363692 11:75917144-75917166 GCATAGGCCAAGCTAACTACGGG - Intronic
1085489933 11:76906084-76906106 GTGTAGGTAAAGCTAACCATGGG + Intronic
1085621643 11:78042173-78042195 GCATATGCCAAGCTAACTTTGGG + Intronic
1085683942 11:78604573-78604595 GCTTGGGTCAAGCTAACTTTGGG - Intergenic
1085879447 11:80448584-80448606 GTGCAGGCCAAACTAACTTTGGG + Intergenic
1086312770 11:85554523-85554545 ATACAGGCCAAGCTAACTATGGG + Intronic
1086350418 11:85938275-85938297 GCATAGGCCAAGCTAACAATGGG - Intergenic
1086431153 11:86738418-86738440 GCATAGGCCAAGATAACCTTGGG + Intergenic
1086621311 11:88889302-88889324 GTGTAGGCTGAACCAACTTTGGG - Intronic
1086832861 11:91586983-91587005 GAGTAGGCTGAACTAACTTTGGG + Intergenic
1086845868 11:91748986-91749008 GCATAGGCCAAGCTAACTGTAGG + Intergenic
1086881991 11:92160260-92160282 GTGTGGGCCAAGCTAACTTTGGG - Intergenic
1087050483 11:93881879-93881901 GAGTAGGCTAAACTAACTTCGGG + Intergenic
1087431814 11:98065298-98065320 GTGTAGGCCAAACTAACTTTGGG + Intergenic
1087797679 11:102471852-102471874 GCTTAGGCCAAGATAACTTTGGG + Intronic
1087806934 11:102565500-102565522 GCATAGGCCAACTTAACTTTGGG + Intergenic
1087886923 11:103492698-103492720 GTGTAGGCTGAACTAACTTTGGG + Intergenic
1087887004 11:103493327-103493349 GCATAGGCCGAACTAACTTTGGG - Intergenic
1087931795 11:103986642-103986664 GTGTAGGCCAAACTAACTTTGGG + Intronic
1088122794 11:106389613-106389635 GTGTAGGCCAAGCTAACTGTGGG - Intergenic
1088312171 11:108471523-108471545 GCATAGGCCAAACTAACCTTGGG - Intergenic
1088801768 11:113313454-113313476 GCATAGGCCAAACTAACTTTGGG + Intergenic
1088862547 11:113815419-113815441 ATTTAGGCCAAGGTATCTTTTGG - Intronic
1089389754 11:118092728-118092750 GGGTAGGCAGAACTAACTTTGGG - Intronic
1089595863 11:119579680-119579702 GCATAGGCCAAGCTAACCATGGG + Intergenic
1089956638 11:122577267-122577289 GTGTGGTTCAAGCTAACTTTGGG - Intergenic
1089986436 11:122818554-122818576 GTGTAGGCCAAACTAACTTGGGG + Intergenic
1090100542 11:123791863-123791885 ATGTAGGCCTAACTAACTTTGGG + Intergenic
1090291715 11:125551839-125551861 GCATAGGCCAAACCAACTTTGGG + Intergenic
1091160875 11:133418593-133418615 GTGTGGGCCAAGCTTACTCTGGG + Intronic
1091537186 12:1422200-1422222 GCATAGGCCAAGCTAACTATGGG - Intronic
1092275564 12:7058419-7058441 GCATAGGCCAAGCTAACCATGGG + Intronic
1092477633 12:8832493-8832515 GTGTAAGCCAGACTAACTTTGGG - Intronic
1092485298 12:8897772-8897794 GTGTAGGTTGAGCTAACTTTGGG - Intergenic
1092499604 12:9032460-9032482 GTGTAGGCCAAACTAACTTCAGG + Intergenic
1092623746 12:10303036-10303058 GTGTAGGCCAAGCTAACTTTGGG - Intergenic
1092879248 12:12875261-12875283 GTGTAGGCCGAACTAACTTTGGG + Intergenic
1092938151 12:13383214-13383236 GTGTAGACCAAGCCAACCATGGG + Intronic
1093101868 12:15037825-15037847 GCATAGGCCAAACTAACTTTGGG - Intergenic
1093197348 12:16144807-16144829 GCGTAGACCAAGCTAACTATGGG + Intergenic
1093346798 12:18047194-18047216 GTCTAGTCCAAGTTGACTTTTGG - Intergenic
1093800240 12:23363868-23363890 GCATAGACCAAGTTAACTTTGGG + Intergenic
1093811524 12:23498300-23498322 GTGTAGGCCAAGCTAACTCTGGG + Intergenic
1094212191 12:27904430-27904452 GCATAGGCCAAACTAACTTTGGG - Intergenic
1094234589 12:28148991-28149013 GTGTAGGCCAAGGTAACTTCAGG - Intronic
1094366718 12:29690966-29690988 GTGTCAGCCCAACTAACTTTGGG + Intronic
1094431001 12:30369046-30369068 GTGTAGACTGAACTAACTTTGGG - Intergenic
1094741130 12:33290527-33290549 GCATAGGCCAACCTAACTTTGGG + Intergenic
1094770472 12:33652515-33652537 GTATAGGCCAAACTAACTTTGGG - Intergenic
1095215674 12:39544513-39544535 GTGTAGGCTGAAATAACTTTGGG - Intergenic
1095266501 12:40164835-40164857 GTGTGGGCCAAACTAACTTTGGG + Intergenic
1095268771 12:40191570-40191592 GTGTAGACTGAACTAACTTTGGG + Intergenic
1095360856 12:41337132-41337154 GTGTAGGCTGAACTAACTTTGGG - Intronic
1095422481 12:42039715-42039737 GTGTAGGCCAAGCTAACCATGGG - Intergenic
1095795990 12:46219187-46219209 GCATAGGCCGAACTAACTTTGGG - Intronic
1095979461 12:47963098-47963120 GTATAGGCCAAACTAACTTTGGG - Intergenic
1096012835 12:48235935-48235957 GCATAGGCCAAACTAACTTTGGG + Intergenic
1096048303 12:48584164-48584186 GTGTAGGCCAAGCTAACTATGGG + Intergenic
1097588662 12:61545900-61545922 ACATAGGCCAAACTAACTTTGGG - Intergenic
1097931761 12:65194953-65194975 GCTTGGGCCAAGCTAACTTTGGG - Intronic
1097978909 12:65717152-65717174 GCATTGGCCAAGCTAACTTTGGG + Intergenic
1098173091 12:67766192-67766214 GTGTAGGCTGAACTAACTTTGGG + Intergenic
1098295398 12:68999135-68999157 GCGTAGGCTGAACTAACTTTGGG + Intergenic
1098315528 12:69188652-69188674 GTGTAGGCCGGGCTAACTTTAGG - Intergenic
1098711554 12:73769244-73769266 GTATAGGCTGAGTTAACTTTAGG + Intergenic
1098864660 12:75748060-75748082 GTGCAGGCCAAACTAACTTTGGG + Intergenic
1098938221 12:76504645-76504667 GCATGGGCCAAGATAACTTTGGG + Intronic
1098978414 12:76929270-76929292 GTGTAAGCCAAGATAAGTCTAGG - Intergenic
1099112154 12:78574998-78575020 GCGTAGGTTAAACTAACTTTGGG + Intergenic
1099834774 12:87895533-87895555 GCTTCAGCCAAGCTAACTTTGGG + Intergenic
1100033063 12:90216731-90216753 GCATGGGCCAAGCTAACTTTTGG + Intergenic
1100262213 12:92943028-92943050 GTGCAGGCCAAACTAACTTTGGG + Intergenic
1100265808 12:92974842-92974864 GTGTGGGTCAAGCTAACCATGGG - Intergenic
1100284245 12:93149769-93149791 GTGTAGGCCAAGCTGTCCATGGG - Intergenic
1100293534 12:93238982-93239004 GCGTAGGCTGAACTAACTTTGGG - Intergenic
1100881060 12:99017217-99017239 GTGTAGGCCAAGCTCACTTTGGG + Intronic
1101149588 12:101872352-101872374 GCATAGGCCGAACTAACTTTGGG + Intergenic
1101329160 12:103743559-103743581 GAGCAGGCCAATCAAACTTTCGG + Intronic
1101383622 12:104236186-104236208 GTTTAGGCCGAACCAACTTTGGG - Intronic
1101912564 12:108871365-108871387 GTGTAGGCCAAACTAACTTTGGG + Intronic
1102192277 12:110997742-110997764 GTGTAGGCAGAACTAACTTTGGG + Intergenic
1102511329 12:113417598-113417620 GTATAGGCCAAGCCAACCATGGG - Intronic
1103215795 12:119200406-119200428 GTGTAGGCCGAACTAACTTTGGG - Intronic
1103305096 12:119957853-119957875 GATTGGGTCAAGCTAACTTTGGG - Intergenic
1103681481 12:122697446-122697468 GCATAGGCCAAACTAACTTTGGG - Intergenic
1103711485 12:122916009-122916031 GCATAGGCCAAGCTAACTTTGGG - Intergenic
1103868211 12:124070835-124070857 GCGTAGGCTGAACTAACTTTGGG - Intronic
1104237509 12:126953338-126953360 GCATGGGCCAAGCTAATTTTGGG - Intergenic
1104355578 12:128082305-128082327 GCGTAGGCTGAACTAACTTTGGG + Intergenic
1104563676 12:129861313-129861335 GCTTGGACCAAGCTAACTTTGGG + Intronic
1104689482 12:130814528-130814550 GTGCAGGCCCAGCTGAGTTTGGG + Intronic
1104764882 12:131322775-131322797 GCATAGGCCGAACTAACTTTGGG + Intergenic
1104852781 12:131885572-131885594 GCGTAGGCTGAACTAACTTTGGG - Intergenic
1105250678 13:18696842-18696864 GTGTAGGGTGAACTAACTTTGGG - Intergenic
1106123182 13:26878840-26878862 GTGTAGGCTGAACTAACTTTGGG - Intergenic
1106756232 13:32825752-32825774 GCGTAGGCTGAACTAACTTTGGG + Intergenic
1107121780 13:36803970-36803992 TTGTGGGCCAAGCCAATTTTTGG - Intergenic
1107167560 13:37300015-37300037 GCATAGGCCAAACTAACTATAGG - Intergenic
1107251997 13:38374998-38375020 ATGTAGGTCAAGGTAACTTTGGG + Intergenic
1107299544 13:38950514-38950536 GCATAGGCCAAACTAGCTTTGGG - Intergenic
1107426319 13:40296675-40296697 GTGTAGGGCAAACTGACTTTAGG - Intergenic
1107427377 13:40307394-40307416 GTGTCGACAAAGCTAACTTTTGG - Intergenic
1107481109 13:40787072-40787094 GTGTAGGCCCAACTAACTCTGGG + Intergenic
1107529585 13:41269883-41269905 GCGTAGGCCAAACTAACTTTGGG + Intergenic
1107698281 13:43022063-43022085 CCGTAGGCCAAACTAACTTTGGG - Intergenic
1108134350 13:47339241-47339263 GCATAGGCCAAACTAACTTTGGG + Intergenic
1108253285 13:48587969-48587991 GCACGGGCCAAGCTAACTTTTGG + Intergenic
1108352915 13:49603459-49603481 ATGTGGGCCAAGGTAACTTTGGG - Intergenic
1108423890 13:50278413-50278435 GTGTAGGCTGAACTAACTTTGGG - Intronic
1108584398 13:51856525-51856547 GTGTAAGCCTGGGTAACTTTGGG - Intergenic
1108871983 13:54999197-54999219 GCATATGCCAAGCTTACTTTGGG - Intergenic
1109163037 13:59000242-59000264 GTGTAGGACGAACTAACTTTTGG - Intergenic
1109300878 13:60588901-60588923 GTGTAGGCCGAACTAGCCTTGGG + Intergenic
1109359746 13:61280713-61280735 GCTTAAGCCAAGCTAACTTGAGG - Intergenic
1109470056 13:62792101-62792123 GTGTAGGCCAACCCAGCCTTGGG - Intergenic
1109470156 13:62793290-62793312 GCATAGGCCAAGCTAACTATGGG + Intergenic
1109713210 13:66185361-66185383 GTATAGGCTGAACTAACTTTGGG - Intergenic
1109912599 13:68934628-68934650 GTGGAGGCCAAACTAACCTTGGG - Intergenic
1110376139 13:74796022-74796044 GAATAGGTCAATCTAACTTTGGG + Intergenic
1110911911 13:80976266-80976288 GCACAGGCCAAACTAACTTTGGG + Intergenic
1110938218 13:81318691-81318713 CTGTAGGCAAGGCTATCTTTGGG - Intergenic
1110977945 13:81864165-81864187 GCTTAGGCCAAACTAACTTTGGG + Intergenic
1111239027 13:85450769-85450791 GGGTGGGCAAAGCTATCTTTGGG + Intergenic
1111243084 13:85501484-85501506 GCTTAGGCCAAGCTAACTTTAGG + Intergenic
1111303893 13:86381850-86381872 GCATAGGCCAAACTAACTTTGGG + Intergenic
1111438190 13:88240051-88240073 GTATAGGCCAAACTAACTTTGGG + Intergenic
1111456177 13:88487141-88487163 GTGTAGAGCAAGCTAACCATGGG + Intergenic
1112019774 13:95361541-95361563 ATGTAGGCCAAACTAACTTTAGG + Intergenic
1112022737 13:95385639-95385661 GTGTAGGCTAAGCCAACTTTGGG + Intergenic
1112413516 13:99185058-99185080 GCGTAGGCCGAACTAACTTTGGG + Intergenic
1112447478 13:99478209-99478231 GCATAGGCCAAACTAACTTTGGG - Intergenic
1112959685 13:105108062-105108084 AATTAGGCTAAGCTAACTTTGGG - Intergenic
1113225289 13:108152892-108152914 GGGTAGGCCAAGCTAACTTTGGG + Intergenic
1113669364 13:112164997-112165019 GTGTAGGCTAACCTGACTTCAGG - Intergenic
1113918427 13:113888923-113888945 GTGTAGGCCAAGCTAACTTCAGG + Intergenic
1113925068 13:113937080-113937102 GCTTGGGCCAAGCTAACTCTGGG - Intergenic
1114052932 14:18937323-18937345 GTGTAAGCTCAACTAACTTTGGG - Intergenic
1114109625 14:19464602-19464624 GTGTAAGCTCAACTAACTTTGGG + Intergenic
1114139298 14:19893336-19893358 GCATAGGCAGAGCTAACTTTTGG - Intergenic
1114235754 14:20822221-20822243 GGGTAGGCTGAACTAACTTTGGG - Intergenic
1114281611 14:21197649-21197671 CAGTAGGCCAAACTAAGTTTGGG + Intergenic
1114343605 14:21771557-21771579 GTGTAGGCCAAGCTGACTTTGGG + Intergenic
1114810457 14:25892890-25892912 GTGTAAGCCAAGCTAACTTTCGG - Intergenic
1114810603 14:25894601-25894623 GCCTGGGTCAAGCTAACTTTAGG + Intergenic
1115169922 14:30492868-30492890 GTGTAGACCTAGCTACCTGTGGG + Intergenic
1115243776 14:31274386-31274408 GTATAGGCCAAACTAACTTTGGG - Intergenic
1115262873 14:31471419-31471441 GTGTAGGCCAAGCTGACTATGGG + Intergenic
1115290867 14:31770732-31770754 GCATGGGCCAAGCTAACTTTAGG - Intronic
1115534304 14:34358177-34358199 GCATAGGCCAAACTAACTTTGGG - Intronic
1115646335 14:35370638-35370660 GTGTGAGCCAAGCTAACGCTGGG + Intergenic
1115816233 14:37167468-37167490 GTATAGGCCAAACTAACTTTGGG + Intronic
1115820830 14:37210979-37211001 GTGTAGGCCAAGATAATCATAGG - Intronic
1115992751 14:39166493-39166515 ATGCAGCCCAAGCTAACTTTGGG + Intronic
1116119149 14:40699745-40699767 GTGTAAGCTAAAATAACTTTAGG + Intergenic
1116201633 14:41804636-41804658 GCTTGGGTCAAGCTAACTTTAGG - Intronic
1116468052 14:45255672-45255694 GTGTAGGTTGAACTAACTTTCGG - Intergenic
1116789833 14:49328815-49328837 CTGGAAGCCAAGCTAACTCTTGG - Intergenic
1116848025 14:49882665-49882687 GCATAGGCCAAAGTAACTTTGGG + Intergenic
1117077696 14:52121292-52121314 GCATAGGTCAAGCTAACTTTGGG + Intergenic
1117181149 14:53193218-53193240 GTGTAGGCTGAACTAACTTTGGG + Intergenic
1117305901 14:54472819-54472841 GCATAGGCCGAACTAACTTTGGG + Intergenic
1117445532 14:55800522-55800544 GTGTGGGCCAAGCTGACTTTGGG + Intergenic
1117632425 14:57707888-57707910 GTGTAGGCCGAACTAACTTTAGG + Intronic
1118089092 14:62452344-62452366 GCGTAGGCCGAACTAACTTTGGG - Intergenic
1118198369 14:63649124-63649146 GCGTAGGCCAAGCTAACTTTGGG - Intergenic
1118273484 14:64364770-64364792 GTGTAGGCTGAACTAACTTTGGG + Intergenic
1118510616 14:66468358-66468380 GCATAGGCCAAACTAACTTTGGG - Intergenic
1118643821 14:67818385-67818407 GCGTAGGCTGAACTAACTTTGGG + Intergenic
1118886159 14:69867819-69867841 GCATAGGCCAAGCTAACTTTGGG + Intronic
1118937768 14:70303390-70303412 GCATAGGCCAAACTAGCTTTGGG + Intergenic
1118947972 14:70406376-70406398 GTGTAGGCCAAACTAACTTTGGG + Intronic
1119127917 14:72145366-72145388 GCGTAGGCTGAACTAACTTTGGG - Intronic
1119139864 14:72256694-72256716 ATATAGGCCAACCTAACTATGGG - Intronic
1119305546 14:73605381-73605403 GTGTAGGCTGAACTAACTTTGGG + Intergenic
1119752850 14:77092644-77092666 GTGTAGGCCAAGCTAACCATGGG - Intergenic
1119842847 14:77806336-77806358 GTATAGACCAAGCTAACTTTGGG - Intronic
1120016718 14:79482219-79482241 GCATGGGCCAAGCTAACTTTGGG - Intronic
1120111670 14:80564623-80564645 GTGTAGGCTGAACTAACTTTGGG + Intronic
1120209061 14:81616486-81616508 GCATAGGCCAAGCTAACTTTGGG + Intergenic
1120556712 14:85937281-85937303 GTGTAGGCTGAACTAACTTTGGG + Intergenic
1120838535 14:89062649-89062671 CTGTGGACCAAGCTAACTTTGGG + Intergenic
1121042596 14:90761095-90761117 GCTTAGGTCAAGCTAACTTTAGG + Intronic
1121137992 14:91515810-91515832 GCATAGGCCAAGCTAGCTTTGGG + Intergenic
1121421069 14:93814718-93814740 GTGTGAGTCAAGGTAACTTTAGG - Intergenic
1121496894 14:94398555-94398577 GCATAGGCCGAACTAACTTTGGG - Intergenic
1121658294 14:95614849-95614871 GCAAAGGCCAAACTAACTTTGGG - Intergenic
1121702469 14:95965115-95965137 GCATAAGCCAAGCTAACTGTAGG + Intergenic
1121705757 14:95992337-95992359 GTGTTGGCCAAGCTAAGGTTGGG - Intergenic
1122186798 14:100005171-100005193 GCATAGGCCAAACTAACTTTGGG + Intronic
1122434214 14:101682017-101682039 GCATAGGCCGAACTAACTTTGGG + Intergenic
1122646806 14:103200050-103200072 GTGTAGGCTGAACTAACTTTGGG - Intergenic
1122659663 14:103286905-103286927 GCGTAGACCAAGCTAACTATGGG - Intergenic
1123138586 14:106053709-106053731 GTGTAGGCTTACCTAACATTGGG + Intergenic
1123817113 15:23991382-23991404 GAAAAGGCCAAACTAACTTTGGG - Intergenic
1124025159 15:25959097-25959119 CCATAGGCCAAACTAACTTTGGG - Intergenic
1124039891 15:26091681-26091703 GTGTAGGCTGAACTATCTTTGGG - Intergenic
1124600655 15:31130376-31130398 GTGTAGGCTGAACTAACTTTGGG + Intronic
1124641035 15:31396905-31396927 GTGTAAGCTGAACTAACTTTGGG - Intronic
1125052830 15:35321241-35321263 GCATAGGCCAAGCTAACCATGGG - Intronic
1125052949 15:35322386-35322408 GCGAAGGCCAAGCTAACCTTGGG - Intronic
1125108681 15:36005004-36005026 CTGTATGCCAAGATAACTTCTGG - Intergenic
1126128715 15:45320031-45320053 ACATAGGCCAAGCTAACTATGGG + Intergenic
1127145255 15:56016668-56016690 GTGTGGGCCAAGCTAACCATGGG - Intergenic
1127388948 15:58489864-58489886 GTGTAGGCCAAGCTAACTTTGGG - Intronic
1127506169 15:59599940-59599962 GTGGAGGCCAAACTAACTGTAGG - Intronic
1128802647 15:70506531-70506553 GCTTGGGCCAAGCTAACTCTGGG + Intergenic
1129339624 15:74876814-74876836 GTGTAGGCTGAACTAACCTTGGG + Intergenic
1129378522 15:75150851-75150873 GTATAGGCTGAACTAACTTTGGG + Intergenic
1129381240 15:75168707-75168729 GTGTAGGCTAAGCTAACTTTGGG + Intergenic
1129441084 15:75581158-75581180 GCATAGGCCGAACTAACTTTGGG + Intergenic
1129885090 15:79031947-79031969 GTGCAGGGCAAGCTGACTGTGGG - Intronic
1130036937 15:80369484-80369506 GTGTAGGGCAAACCAACTCTGGG - Intronic
1130103980 15:80915323-80915345 GCGTAGGCCAGACTGACTTTGGG - Intronic
1130195861 15:81779801-81779823 GCGTAGGCTGAACTAACTTTGGG + Intergenic
1130998640 15:88920439-88920461 GCGTAGGCGGAACTAACTTTGGG + Intergenic
1131162217 15:90114011-90114033 GCATAGGCCAAGCTAAGTATGGG + Intergenic
1131338034 15:91569202-91569224 ATGTAGGCTGAGCTAACTATGGG - Intergenic
1132030018 15:98431544-98431566 GGGAAGGCCAAGCTGACTTGAGG - Intergenic
1132288357 15:100682231-100682253 TTGTGGGCCAACCTAACTTTAGG - Intergenic
1132354893 15:101163905-101163927 GCATAGGCTGAGCTAACTTTGGG + Intergenic
1132742397 16:1421383-1421405 GCGTGGGCAGAGCTAACTTTGGG + Intergenic
1132955756 16:2592519-2592541 CAGTAGGCCCAGCTAATTTTTGG - Intronic
1132991066 16:2794401-2794423 GCATAGGCCAAACTAACTTCGGG + Intergenic
1132991330 16:2796647-2796669 GTGTAGACCAAGCTAACCATGGG - Intergenic
1133000207 16:2846758-2846780 GTGTAGGCTGAACTAACTGTGGG + Intergenic
1133090170 16:3398007-3398029 GTGTGGGCCAAGCTAGCTTTGGG + Intronic
1133455936 16:5942683-5942705 GTATAGGCCAAGCTAACTTTGGG - Intergenic
1133694118 16:8244497-8244519 GCGTAGGCTCAACTAACTTTGGG - Intergenic
1133841186 16:9411158-9411180 GCATAGGCCGAACTAACTTTGGG + Intergenic
1134392618 16:13833400-13833422 GTGTAGGCTGAACTAACTTTGGG + Intergenic
1134504699 16:14795428-14795450 GTGTAGGCTGACCTAACTTTGGG - Intronic
1134575874 16:15333481-15333503 GTGTAGGCTGACCTAACTTTGGG + Intergenic
1134605754 16:15569975-15569997 GTTTAGGCCATGCTAGCTTTGGG - Intronic
1134726570 16:16423020-16423042 GTGTAGGCTGACCTAACTTTGGG - Intergenic
1134940862 16:18288839-18288861 GTGTAGGCTGACCTAACTTTGGG + Intergenic
1135203594 16:20462419-20462441 GCATAGACCAAGCTAACTATAGG - Intronic
1135495921 16:22951065-22951087 ACATAGGCCAAGCTAACTATGGG - Intergenic
1135602441 16:23794856-23794878 GCATAGGCCAAGCTAACCATGGG + Intergenic
1135638754 16:24101598-24101620 GCCTAGGCCAAGCTAACTATGGG - Intronic
1135910598 16:26557416-26557438 GTGTTGCCCAGGCTAACTTCTGG + Intergenic
1135959346 16:26982865-26982887 GCCTAGGCCAAGCTAACTTTAGG + Intergenic
1135959606 16:26984766-26984788 CCATAGGCCAAGCTAACTATGGG + Intergenic
1135963744 16:27019062-27019084 GTGGAGGTCAAGCTAACTCTAGG + Intergenic
1135965698 16:27033151-27033173 GCGTAGGCCGAACTAACTTTGGG + Intergenic
1136356513 16:29747775-29747797 GCGTAGGCTGAACTAACTTTGGG + Intergenic
1136598689 16:31269465-31269487 GTGTAGGCTGAGCTAACTTTGGG - Intronic
1136924349 16:34358151-34358173 GCAGAGGCCAAACTAACTTTAGG + Intergenic
1136980224 16:35053655-35053677 GCAGAGGCCAAACTAACTTTAGG - Intergenic
1137042396 16:35625208-35625230 GTGTAGGCTGAACTAATTTTGGG + Intergenic
1137263871 16:46852845-46852867 GTGTAGGCCGAACTAACCTTGGG + Intergenic
1138299788 16:55916421-55916443 GCTTAGTCCAAGCTAACTTTGGG - Intronic
1138459464 16:57139576-57139598 GTGTAGGCCAAACTAACTTTGGG - Intronic
1138544945 16:57712119-57712141 GTGAAGGCTGAACTAACTTTGGG - Intronic
1138605220 16:58084278-58084300 GCGTAGGCTGAACTAACTTTGGG + Intergenic
1138705204 16:58908568-58908590 GCTTAGGCCAAGCTAACTTTGGG + Intergenic
1138744975 16:59352859-59352881 TCATAGGCCAAACTAACTTTGGG - Intergenic
1138926198 16:61594114-61594136 GCATAAGTCAAGCTAACTTTGGG + Intergenic
1139014877 16:62677801-62677823 GCTTAGGCCAAACTAACTTTGGG + Intergenic
1139066662 16:63324176-63324198 GCATAGGCCAAGCTAATTATGGG + Intergenic
1139105527 16:63822693-63822715 GTTTGGGCCAAGCTAACAATGGG + Intergenic
1139146051 16:64327015-64327037 GCATAGGCCAAACTAACTTTGGG + Intergenic
1139647518 16:68342321-68342343 GTCCGGGCCAAGCTAACTTTGGG - Intronic
1139830593 16:69794561-69794583 GCATGGGCCAAGCTAATTTTGGG - Intronic
1140134144 16:72190301-72190323 GTATAGGCCAAGTTAACCATGGG - Intergenic
1140458909 16:75122780-75122802 GCATAGGCCAAACTAACTTTGGG - Intergenic
1140703599 16:77605443-77605465 GTGTAGGCTGAACTAACTTTGGG + Intergenic
1140793597 16:78414815-78414837 GCATGGGCCAAGCTAACTTTGGG - Intronic
1140847909 16:78907540-78907562 GCTTGGGCCAAGCTAACTTTGGG - Intronic
1140928852 16:79608680-79608702 GTGTAGGCAAAGCTCTCTGTTGG + Intergenic
1141175716 16:81717623-81717645 GTGTAGGCCGAACTAACTTTAGG - Intergenic
1141248835 16:82336484-82336506 GTGTGGGCCAAGCTAACTTTGGG + Intergenic
1141262786 16:82468906-82468928 GTGTAGGCCAAACTAACTTTGGG - Intergenic
1142027314 16:87821465-87821487 GCGTGCGCCAAGCTAGCTTTGGG - Intergenic
1142507202 17:372006-372028 GCGTAGGCTGAACTAACTTTAGG + Intronic
1143274267 17:5698473-5698495 GCGTAGGCTGAACTAACTTTGGG + Intergenic
1143535925 17:7539463-7539485 GCCTAGGCCAAGCTAACTATGGG - Intergenic
1143543871 17:7585149-7585171 GTGGAGGTCAAGCCAAGTTTGGG + Intronic
1143657283 17:8302818-8302840 GCGTAGGCTGAACTAACTTTGGG - Intergenic
1143668603 17:8380807-8380829 GCATAGACCAAACTAACTTTGGG + Intronic
1143985766 17:10912456-10912478 GAGTAGGACAAGCTAACTATGGG - Intergenic
1143999692 17:11041440-11041462 GCTTAGGCTAAGCTAACTTTGGG + Intergenic
1145724730 17:27108087-27108109 GCATGGGCCAAGCTAACTTTGGG - Intergenic
1145748819 17:27340789-27340811 GCTTAAGCTAAGCTAACTTTGGG - Intergenic
1145833238 17:27934492-27934514 GCGTAGGCTGAACTAACTTTGGG - Intergenic
1145976997 17:28989689-28989711 GTATGGGCCAAGCTAACTTTGGG + Intronic
1146133826 17:30300856-30300878 GCTTGGGCCAAGCTAACTTTGGG - Intergenic
1146146887 17:30426828-30426850 GCATCGGCCAAGCTAACTTTGGG - Intronic
1146441720 17:32902355-32902377 GTGTGGGCTGAACTAACTTTGGG + Intergenic
1146596409 17:34172972-34172994 GCATAGGCCAAGCTAACCATAGG - Intronic
1146602442 17:34229645-34229667 CCTTAGGCCAAGCTAACTTTAGG + Intergenic
1146663360 17:34680107-34680129 GCTTGGGCCAAGCTATCTTTGGG + Intergenic
1147230468 17:39014275-39014297 GAGTAGGCCAAACTAAATTTGGG + Intergenic
1148627217 17:49078822-49078844 GCGCGGGCCATGCTAACTTTGGG + Intergenic
1148950965 17:51312065-51312087 GCATAGGCAAAACTAACTTTGGG - Intergenic
1148965795 17:51434986-51435008 GTGTAGGCTGAACTAACTTAGGG + Intergenic
1149040686 17:52184921-52184943 GTGTAGGTCAATCTGACATTTGG - Intergenic
1149215535 17:54349618-54349640 GCATAAGCCAAACTAACTTTGGG + Intergenic
1149477455 17:56975044-56975066 TTCTGGGCCAAGCTAACTTTGGG + Intergenic
1149701348 17:58657723-58657745 GTGTAGGCTGAACTAACTTTGGG + Intronic
1149893354 17:60409692-60409714 GCATAGGCCAAACTAACTATGGG + Intronic
1150973210 17:70053976-70053998 GTGTAGGCCAAACTAGCCTTGGG - Intronic
1151241948 17:72764983-72765005 GCTTGGGCCAAGGTAACTTTGGG + Intronic
1151741302 17:75984110-75984132 ATTTGGGCCAAGCTAACTTTGGG - Intronic
1152114074 17:78374098-78374120 GTGTAGGCCGAACTAACTTTGGG + Intergenic
1152776797 17:82206907-82206929 GTGTAGGCCGAACTAAGTTTAGG + Intronic
1152824525 17:82456227-82456249 GCATAAGCCAAGCTAATTTTAGG + Intergenic
1153154463 18:2132973-2132995 ATGTGGGCCAAGCTAACTTAGGG - Intergenic
1153249564 18:3107786-3107808 GCACAGGCTAAGCTAACTTTGGG + Intronic
1153345444 18:4020660-4020682 GTGTAGGCCAAACTAAGCTTGGG + Intronic
1153745475 18:8174300-8174322 ACTTAGGCCAAGCTAACTTTGGG - Intronic
1153787908 18:8551247-8551269 GCATAGGCCAAGCTAACTTTGGG - Intergenic
1153846471 18:9053932-9053954 GTGTGGGCCAAGCTAACTTTGGG - Intergenic
1153993593 18:10421105-10421127 GTGTAGGCCAAGCTAACTTTGGG - Intergenic
1154091002 18:11363146-11363168 GAGTAGGCTGAACTAACTTTGGG - Intergenic
1154149854 18:11898008-11898030 ATATAGGCCAAGCTAACTTTGGG + Intronic
1154205851 18:12336060-12336082 GTGTGGGCCAAGCTAGCTTCGGG + Intronic
1154438167 18:14362084-14362106 GTGTAGGGTGAACTAACTTTGGG + Intergenic
1155574279 18:27228015-27228037 GTTTAAGACAAGCTAACTTTGGG - Intergenic
1155699847 18:28730640-28730662 GCATAGGCCAAACTAATTTTGGG + Intergenic
1155713432 18:28910817-28910839 GTGTAGGCCAAACTAACTTTGGG + Intergenic
1155915532 18:31553580-31553602 GCTTAGGCTAAGCTAACTTTGGG + Intergenic
1155930065 18:31697634-31697656 ACATAGGCCAAGCTAACTATGGG - Intergenic
1156125400 18:33899031-33899053 ATTTAGGCCAAGCTAACTAGGGG + Intronic
1156291553 18:35752446-35752468 GCATAGGCCAAGCTAACTTTGGG - Intergenic
1156301532 18:35840654-35840676 GTGTAGGCTGAACTAACTTTGGG + Intergenic
1156553215 18:38040374-38040396 TTGAAGGTAAAGCTAACTTTAGG + Intergenic
1156817182 18:41325462-41325484 GTATAAGCCAACCTAACTTTGGG - Intergenic
1156903357 18:42326750-42326772 GTGTAGGCCTAACTAACTTTGGG - Intergenic
1157216868 18:45791478-45791500 GTGTAGGCTGACCTAACTCTGGG + Intergenic
1157237187 18:45975844-45975866 GCATAGGCCAAACTAGCTTTGGG - Intergenic
1157305232 18:46512018-46512040 GTTTGGGTCAAGCTAACTTTGGG + Intronic
1157368141 18:47085347-47085369 GCTCAAGCCAAGCTAACTTTGGG + Intronic
1158016417 18:52789789-52789811 GTGTAGGCTGAACCAACTTTGGG + Intronic
1158197248 18:54902078-54902100 GTGTGGGCCAAGCTAACTTTGGG - Exonic
1158780096 18:60638281-60638303 GTGTAGGCCAAGCTAACTATGGG - Intergenic
1159112580 18:64076435-64076457 GTGTAGGCTGAACTAACTTTGGG + Intergenic
1159174622 18:64816477-64816499 GCGTAGGCGAAACTAACTTTGGG - Intergenic
1159490960 18:69133569-69133591 GAGTAGGCTAAACTAACTATGGG - Intergenic
1159596205 18:70385008-70385030 GTGTAGGCTGAACTAACTTTGGG - Intergenic
1159775701 18:72601215-72601237 GCGTAGGTCAAGCTAACTTTGGG - Intronic
1159894921 18:73987476-73987498 GTGTAGGCCAAGCTAACTTTGGG + Intergenic
1160290857 18:77591677-77591699 GTGTAGGCTGAACTAACTTTGGG - Intergenic
1161443783 19:4306668-4306690 GTGTGGGCCAAGCTGACCTCAGG + Intronic
1161840199 19:6675451-6675473 GCATAGGCCGAACTAACTTTGGG + Intergenic
1161898470 19:7099886-7099908 GTGTGGGCCAAGCTAACCTTGGG + Intergenic
1162208145 19:9071230-9071252 GCTTAGGCCAAACTAACTTTGGG + Intergenic
1162641236 19:12011937-12011959 GCATAGGCCAAACTAACCTTGGG + Intergenic
1163614938 19:18321469-18321491 GTATAGGCCAAACTAACCTTGGG + Intronic
1164477424 19:28586200-28586222 ATGTATGCCAAGCTCACTCTGGG + Intergenic
1164523015 19:28993011-28993033 GCATAGGCCAAGTTAATTTTGGG + Intergenic
1164586134 19:29477281-29477303 ATGTAGGCCAAGCTCACTATGGG + Intergenic
1164884324 19:31764647-31764669 GCATAGGCCAAGCTAACTATGGG + Intergenic
1165122395 19:33568654-33568676 GCATAGGCCGAACTAACTTTGGG + Intergenic
1165126450 19:33601217-33601239 GCATAGACCAAGCTAACTTATGG + Intergenic
1165133310 19:33646969-33646991 GCATAGGCCAAGCTAACTGTGGG - Intronic
1165300623 19:34966233-34966255 GCATAGGCCTAACTAACTTTGGG + Intergenic
1166400511 19:42475831-42475853 GCTTAGGCTAAACTAACTTTGGG - Intergenic
1166432014 19:42735997-42736019 GCATAGGCCAGGCTAACCTTGGG + Intronic
1166435129 19:42761204-42761226 GCATAGGCCAGGCTAACCTTGGG + Intronic
1166445000 19:42851229-42851251 GCATAGGCCAGGCTAACATTGGG + Intronic
1166470804 19:43078170-43078192 GCATAGGCCAGGCTAACCTTGGG + Intronic
1166481958 19:43182089-43182111 GCATAGGCCAGGCTAACCTTGGG + Intronic
1166484439 19:43201189-43201211 GCATAGGCCAGGCTAACCTTGGG + Intronic
1166592698 19:44014984-44015006 GCGTGGGCCCAGCTAACTTGGGG - Intergenic
1166621997 19:44309444-44309466 GCATAGGCCAAGCTAACTATGGG - Intergenic
1166820734 19:45578103-45578125 GTGAAGGCTGAACTAACTTTGGG + Intronic
1167256996 19:48436627-48436649 GCATAGGCCAAACCAACTTTGGG - Intronic
1167580676 19:50340265-50340287 GCTTAGGCCAAGCTAACTTTGGG + Intronic
1167805860 19:51784769-51784791 GTGTAGGCTGAACTGACTTTGGG + Intronic
1167839147 19:52099620-52099642 GTGTAGGCCAAACTAGCTTTGGG + Intergenic
1168153140 19:54459725-54459747 GTGTGGGTCAAGCCAACTTCAGG + Intronic
1168438657 19:56344156-56344178 GCATAGGCCAAACAAACTTTGGG + Intronic
925438849 2:3866770-3866792 GTGTAGGCCAAACTAACTTTGGG + Intergenic
925716294 2:6787030-6787052 GTATAGACCAAGCTAACCATGGG + Intergenic
926484129 2:13433833-13433855 GCGTAGGCTAAACTAACTTTGGG - Intergenic
926586041 2:14686733-14686755 ATGTAGGCCAAGCTAACTACGGG - Intergenic
926720173 2:15954221-15954243 GCGTAGGCTGAACTAACTTTGGG + Intergenic
926871462 2:17422584-17422606 GTGTAGGCCAAGCTAATTATTGG - Intergenic
926905475 2:17801388-17801410 ACATAGGCCAAACTAACTTTGGG + Intergenic
927594945 2:24388038-24388060 GTGTAGGCCAAGCTAAGTTTGGG - Intergenic
928296469 2:30088439-30088461 GTGTAGGCTGAACTAACTTTGGG + Intergenic
928420236 2:31132683-31132705 GTGTAGGCTGCACTAACTTTGGG + Intronic
928441131 2:31293058-31293080 ATGTAGGCCGAACTAACTTTGGG - Intergenic
928671714 2:33609825-33609847 ATGTAGGCCAAACTAGCCTTGGG + Intergenic
929550771 2:42890151-42890173 GTTTGGGCCAAGATAACTTTGGG - Intergenic
930049020 2:47199475-47199497 GTGTAGCCCAAGCAATCCTTGGG + Intergenic
930065889 2:47327289-47327311 GCATAGGCCGAACTAACTTTGGG - Intergenic
930164431 2:48190320-48190342 GCATAGGCCAAGCTAACCATAGG - Intergenic
930167254 2:48215060-48215082 GTGTAAGCTGAACTAACTTTGGG - Intergenic
930571471 2:53091785-53091807 GGGTGGGCCAAGTTAACTATGGG - Intergenic
930621231 2:53645968-53645990 GTGTAGGCTGAACTAACTTTGGG + Intronic
930621539 2:53649244-53649266 ACTTAGGCCAAGCTAACTTTGGG + Intronic
930656030 2:54007970-54007992 GCATAGGCCGAGCTAACTTTGGG - Intronic
930755141 2:54965956-54965978 ATGTAGGCTGAACTAACTTTGGG - Intronic
930884799 2:56313634-56313656 CTATTGGCTAAGCTAACTTTGGG + Intronic
931449411 2:62355734-62355756 GCATAAGCCAAACTAACTTTGGG - Intergenic
931453019 2:62384430-62384452 GTGTGGGTCAAGCTAACTTTGGG - Intergenic
931608329 2:64074277-64074299 GCTTGGGCCAACCTAACTTTGGG - Intergenic
931608394 2:64074764-64074786 GCACAGGCCAAACTAACTTTGGG - Intergenic
931928651 2:67104190-67104212 GATGGGGCCAAGCTAACTTTGGG + Intergenic
932157938 2:69435221-69435243 GCTTGGGCCAAGCTAACTTTGGG - Intronic
932863402 2:75317322-75317344 GCATAGGCCAAACTAATTTTGGG + Intergenic
932993213 2:76813622-76813644 AAGTAGGCCAAGTTAACTTTTGG + Intronic
933045406 2:77529102-77529124 GCATAGGCCAAACTAACTTTGGG - Intronic
933051252 2:77605367-77605389 GAGCAGGCCAAGGTAAGTTTGGG + Intergenic
933406880 2:81871886-81871908 GTATAGGCCAAGCTAACCATAGG + Intergenic
933511860 2:83249810-83249832 GCGTAGGCCAAACTAACTTTGGG - Intergenic
933578678 2:84100356-84100378 GTTTAGGCCAAGCTAACTATGGG - Intergenic
934871542 2:97871311-97871333 GAACAGGCAAAGCTAACTTTGGG + Intronic
935016540 2:99187876-99187898 GTGATGGCCAAGCTGAGTTTTGG + Intronic
935175526 2:100645425-100645447 GCATAGGACAAGCTAACTTTGGG - Intergenic
935432680 2:102993258-102993280 GTGTTGGTCAAGCTTACCTTGGG + Intergenic
936591400 2:113808055-113808077 GTGTAGGCCAAGATAACTTTAGG + Intergenic
937153512 2:119702179-119702201 GCATAGGCCAAACTAACTTTGGG - Intergenic
937184781 2:120030113-120030135 GCGTAGGCCTAACTAACTTCGGG + Intronic
937414247 2:121701743-121701765 GCATAGGCTAAACTAACTTTGGG + Intergenic
937492833 2:122387857-122387879 GTATAGACCAAACTAACATTAGG + Intergenic
937520371 2:122706567-122706589 ATGTAGGACAAGCTAACTATGGG + Intergenic
937584007 2:123524229-123524251 CTGTAAGCCAAGCTAACTTTGGG - Intergenic
937652891 2:124340203-124340225 GCATAGGCCAAGCTAAATTTGGG - Intronic
937712547 2:124995048-124995070 GCATAGGCCAAGGTAACTATGGG + Intergenic
938041183 2:128077443-128077465 GCATAGGACAAACTAACTTTGGG - Intergenic
938372467 2:130780436-130780458 GTGTAGGCCAGGCTAACCGTAGG - Intergenic
938973451 2:136453055-136453077 GCATAGGCCAAACTAACTTTGGG - Intergenic
939133995 2:138273052-138273074 GTGTAGGCCAAGCTAACTATGGG + Intergenic
939265413 2:139866281-139866303 GCATAGGCCAAACTAACTTTAGG - Intergenic
939265687 2:139870091-139870113 ATGTAGGCCAAACTAACTCCAGG + Intergenic
939320551 2:140614941-140614963 GCATAGGCCAAGCTATCTATGGG + Intronic
939356398 2:141108825-141108847 ATGTGGGCCAAGCTTCCTTTGGG + Intronic
940176069 2:150878794-150878816 GCATAGGGCAAGCTATCTTTGGG - Intergenic
940361359 2:152799567-152799589 GTGTAGGCCAAATTAACTTTGGG - Intergenic
940486901 2:154307026-154307048 GTGCAGGCCAAACTAATTTTGGG - Intronic
940509370 2:154593207-154593229 GCTTGGGCCAAGCTATCTTTGGG + Intergenic
940612871 2:156012036-156012058 GTGTAGGCTGAACTAACTTTGGG - Intergenic
940650009 2:156433143-156433165 GCGTAGGCTGAACTAACTTTGGG + Intergenic
940707727 2:157125678-157125700 GTGTAGGTCGAACTGACTTTGGG + Intergenic
940988116 2:160069689-160069711 GCATAGGTCAAACTAACTTTGGG + Intergenic
941244308 2:163078296-163078318 GCATTGGCCAAGCTAACTCTGGG + Intergenic
941403097 2:165056140-165056162 GCATAGGCCAAGCTAACTTTGGG + Intergenic
941877416 2:170448226-170448248 GTGTAGGCCGAACTAACTTCAGG - Intronic
941878111 2:170455269-170455291 GTGTAAGCTGAACTAACTTTAGG - Intronic
941912062 2:170773256-170773278 GTATAGGCTAAACTAACTTTGGG - Intergenic
942026231 2:171913329-171913351 GCGTAGGCTGAACTAACTTTGGG - Intronic
942098176 2:172553541-172553563 GCATAGGCCAAACTAACTTTGGG - Intergenic
943062756 2:183056059-183056081 GTGTTGGCCAAATTAATTTTTGG + Intergenic
943261980 2:185677542-185677564 GAGTTGGCCCAACTAACTTTGGG + Intergenic
943284487 2:185980301-185980323 GCATAGGCCAAGCTAACTTTGGG - Intergenic
943983844 2:194594019-194594041 GTGTAGGCCAAACTAACTTTGGG + Intergenic
944024040 2:195142410-195142432 GCATGGGCCAAACTAACTTTGGG - Intergenic
944220817 2:197302554-197302576 GTGTAGGCCACACCTACTTTTGG + Intronic
944314176 2:198267631-198267653 GCATATACCAAGCTAACTTTGGG - Intronic
944453859 2:199873543-199873565 GCATAGGCCAAGCTAACTATGGG + Intergenic
944646957 2:201789547-201789569 GTGAAGGCCAAACTAACTTTGGG - Intergenic
944689011 2:202142670-202142692 GTGTAGGCTGAACTAACTTTGGG - Intronic
945169004 2:206976353-206976375 TCCTGGGCCAAGCTAACTTTGGG - Intergenic
945392322 2:209279292-209279314 ATGTAGGCCAAACTAACCTTAGG + Intergenic
945555485 2:211270446-211270468 ATGTAGGCCAAACTAACTAGAGG + Intergenic
945675155 2:212846926-212846948 TTGTAGGTCATGGTAACTTTAGG + Intergenic
945869343 2:215209352-215209374 ACATAGGCCAAACTAACTTTCGG - Intergenic
946471688 2:219966569-219966591 GCTTAGGCCAAGCTAACTTTGGG + Intergenic
946492069 2:220158186-220158208 GCATAGACCAAACTAACTTTGGG - Intergenic
946527282 2:220534553-220534575 GTGTAGGCCAACCTAACTTTGGG + Intergenic
946707516 2:222473072-222473094 GTGTAGGCCAGGCTACCCATGGG - Intronic
946760218 2:222985989-222986011 GCGTAGGCCAAGCTAACCATGGG - Intergenic
946765644 2:223037536-223037558 GCATAGGCCAAACTAACTTTGGG - Intergenic
946829915 2:223718113-223718135 GTGTAGGCTGAACAAACTTTGGG + Intergenic
946830150 2:223720437-223720459 GTGTAGGCTAAACTAACTTTGGG - Intergenic
947032725 2:225816514-225816536 GGTTGGCCCAAGCTAACTTTGGG + Intergenic
947045861 2:225982542-225982564 GTGTAGGCTGAACTAACTTTGGG - Intergenic
947093881 2:226544474-226544496 GTGTAGACCAAACTAACTATGGG + Intergenic
947216189 2:227752481-227752503 GCATAGGCCGAACTAACTTTAGG + Intergenic
947236449 2:227946216-227946238 GTGTAGGCCAAGCTAACCATGGG - Intergenic
947238521 2:227969532-227969554 TCATAGGCCCAGCTAACTTTGGG - Intergenic
947304630 2:228730523-228730545 GTGTAGGTCAAACTAACTATAGG + Intergenic
947519225 2:230830957-230830979 GTGTAGGTGGAACTAACTTTAGG - Intergenic
947519971 2:230838034-230838056 GTGTAGGCTGAACTAACTTTGGG + Intergenic
947802742 2:232941455-232941477 GCGTAGGCTGAACTAACTTTGGG - Intronic
947842926 2:233220128-233220150 ATATAGGCCAAGCTAACTATGGG - Intronic
947950749 2:234145108-234145130 GCATGGGCCAAGCTAACTTTGGG + Intergenic
948006642 2:234614961-234614983 GCGTAGGCTAAACTAACTTTGGG + Intergenic
948020172 2:234725725-234725747 GCGTAGGCCAAACTAACTTTGGG + Intergenic
948032295 2:234828786-234828808 GCATAGGCCAAAGTAACTTTGGG - Intergenic
948302439 2:236917856-236917878 GTGTAGGCCGAACTAACTTTGGG - Intergenic
1169302437 20:4455888-4455910 GCATAGACCAAACTAACTTTGGG + Intergenic
1169324709 20:4665824-4665846 GTGTAGGCTGAGCTAACTTTAGG + Intergenic
1169410766 20:5367851-5367873 GTGTAGGCCAAGTTAACTGTGGG - Intergenic
1169455173 20:5746305-5746327 GTGTAGGCTGCACTAACTTTGGG + Intergenic
1169651949 20:7878627-7878649 GCTTGGGCCAAGCTAACATTGGG - Intergenic
1169653251 20:7893295-7893317 GTGTAGGCCAGACTAACTTTGGG + Intronic
1169722211 20:8690816-8690838 GTACAGGCCAAGATAACTATGGG - Intronic
1169742873 20:8914398-8914420 GCATAGGCCAAACTAACTATGGG + Intronic
1170220434 20:13936262-13936284 GTGTGAGCTAAGCTAACTTTGGG + Intronic
1170368133 20:15619307-15619329 GTGTAGGCTGAACCAACTTTGGG - Intronic
1170733264 20:18992010-18992032 GCATAGGCCAAGCTAATCTTGGG + Intergenic
1170936299 20:20812816-20812838 GCATAGGCCAAAATAACTTTGGG - Intergenic
1171398150 20:24852997-24853019 GCATAGGCCAAGCTAACTTTGGG - Intergenic
1172795764 20:37536178-37536200 GTGTAGGCCGAACGAACTTTGGG + Intergenic
1172799027 20:37563600-37563622 GCTTGGGCCAAGCTAACTTTGGG + Intergenic
1173060485 20:39655558-39655580 GCTTGGGCCAGGCTAACTTTGGG + Intergenic
1173632566 20:44527698-44527720 GTGTAGGCTGAACTAACTTTGGG + Intergenic
1173693336 20:44983485-44983507 CTGTAGTCCCAGCTAACTTTTGG + Intronic
1173746982 20:45445136-45445158 GTGTAGGCAGAACTAACCTTAGG - Intergenic
1174013675 20:47470919-47470941 GCATAGGCCAAGCTAACTTTGGG - Intergenic
1174102985 20:48141314-48141336 GTGTGGGACGAGCTAACTTTGGG + Intergenic
1174536678 20:51256665-51256687 GTGTGGGCCAAGCTAACTTTGGG - Intergenic
1174537055 20:51259393-51259415 GCGTGGGCTAAACTAACTTTGGG + Intergenic
1174836105 20:53856511-53856533 GTGGATACCAAACTAACTTTGGG - Intergenic
1174851645 20:54001278-54001300 GGGTAGGCCACACTAACTTCGGG + Intronic
1174905396 20:54545070-54545092 GCTTGGGCCAAGCTAACGTTGGG - Intronic
1175070685 20:56331322-56331344 GCATAGGCCAACCTAACTTTGGG + Intergenic
1175071265 20:56335934-56335956 GTGTGGGCCAAGCTAATTTTGGG - Intergenic
1176457508 21:6927388-6927410 GTGTAGGGTGAACTAACTTTGGG - Intergenic
1176835682 21:13792472-13792494 GTGTAGGGTGAACTAACTTTGGG - Intergenic
1176910603 21:14560402-14560424 GTGTAGGCCAAGCTAACTTTAGG + Intronic
1177323376 21:19551553-19551575 GCATAGGCCAAGCTAGCTATGGG + Intergenic
1177420622 21:20852140-20852162 TAGTATGCCAAACTAACTTTGGG - Intergenic
1177509987 21:22074157-22074179 CCTTGGGCCAAGCTAACTTTAGG - Intergenic
1177510595 21:22081945-22081967 GTGTAGGTCAAACTAACTTTGGG - Intergenic
1177530471 21:22352224-22352246 ATGAAGGCCAAATTAACTTTGGG - Intergenic
1177589341 21:23142653-23142675 GTGTAGGCCAAACTAACTTTGGG + Intergenic
1177737372 21:25108321-25108343 GCATAGGCCAAACTAACTTTTGG - Intergenic
1177782412 21:25635199-25635221 GCGTAGGCTGAACTAACTTTGGG + Intergenic
1177801415 21:25832392-25832414 GTGTAGGCCAAATTAACTTTGGG + Intergenic
1178097552 21:29232238-29232260 GCATAGACCGAGCTAACTTTGGG - Intronic
1178115026 21:29408065-29408087 GCATAGGCCAAACTAACTTTGGG - Intronic
1178254554 21:31040430-31040452 GTGTAGGCCAAACTAACTTTGGG + Intergenic
1179239749 21:39579657-39579679 GTATAGGCTGAACTAACTTTGGG + Intronic
1179599397 21:42465989-42466011 GCACAGGCCAAGCTAACTTTGGG + Intergenic
1179672883 21:42962138-42962160 GTGGAGGCCGAACTAACTCTGGG - Intergenic
1180106247 21:45620041-45620063 GTGTAGGCTGAGCTAACCTAGGG - Intergenic
1180471405 22:15659697-15659719 GTGTAAGCTCAACTAACTTTGGG - Intergenic
1181304968 22:21910791-21910813 GTGTAGGCTGAACTAACTTTGGG - Intergenic
1181446345 22:22978036-22978058 GTGTAGGCTGAACCAACTTTGGG - Intergenic
1181640714 22:24196537-24196559 GTGTAGGCTGAACTAACTTTGGG + Intergenic
1181708670 22:24666139-24666161 GTGTAGACTGAACTAACTTTGGG - Intergenic
1182454955 22:30444453-30444475 GCTTAGGCCAAGCTAACTTTGGG - Intergenic
1182559653 22:31149774-31149796 GCGTAGGCCAAACTAACTTTGGG + Intergenic
1184156565 22:42671416-42671438 GCGTAGGCCAAACTAACCCTGGG - Intergenic
1184306359 22:43605229-43605251 GTGTAGGCCAAGCTAACTATGGG + Intronic
1184576682 22:45373641-45373663 GCCTAGGCCAAACTAACTTTGGG - Intronic
1184917586 22:47581584-47581606 GTGTAGGCCAAACTGACTTTGGG - Intergenic
949108052 3:224253-224275 ACATAGGCCAAGCTATCTTTGGG - Intronic
949493107 3:4608049-4608071 GCTTAGGCAAAGCTAACTTTGGG - Intronic
949613477 3:5728184-5728206 GCATAGGCCGAACTAACTTTGGG - Intergenic
949992462 3:9591120-9591142 GCATAGGCCAAACTATCTTTGGG + Intergenic
949993532 3:9599128-9599150 GTGGATGCCAAACTAACTTTGGG - Intergenic
949997626 3:9630974-9630996 ATGTAGGCCAGACTACCTTTGGG - Intergenic
950029743 3:9844343-9844365 GCTTGGGCCAAGCTAACTTTGGG + Intronic
950626536 3:14251584-14251606 GTGTGGACCAAGCTAACCTTGGG - Intergenic
950780653 3:15388842-15388864 GTGTAGGCTGAACTAACTTTGGG - Intronic
950921048 3:16695282-16695304 GCATAGGCCGAACTAACTTTGGG + Intergenic
951113511 3:18833285-18833307 GCGTAGGCTGAACTAACTTTGGG - Intergenic
951280082 3:20737583-20737605 GCATAGGCCAAACTAACCTTGGG + Intergenic
951343303 3:21515664-21515686 GCGTGGGCCAAGCTAACCATGGG + Intronic
951644021 3:24867287-24867309 GGCTTGGCCAAACTAACTTTGGG - Intergenic
951663174 3:25093437-25093459 GCTTGGGCCAAACTAACTTTGGG + Intergenic
951942476 3:28094688-28094710 GCTTGGGCCAAGCTAACTTTGGG - Intergenic
952184489 3:30953922-30953944 CACTAGGCCAAGCTAACCTTCGG - Intergenic
952619659 3:35322509-35322531 GTATAGGCCAAGATAACCATGGG - Intergenic
952665063 3:35894477-35894499 GCATAGGCCAAGCTAACTAAGGG + Intergenic
952767363 3:36965916-36965938 GAGTAGGCCAAACTAACCTTGGG - Intergenic
952801702 3:37298665-37298687 GTGTAGGCTGAACTAACTTTGGG - Intronic
953178010 3:40569232-40569254 GTGTAGACCAAGCCGACTTTGGG - Intronic
953438956 3:42901568-42901590 GCACAGGCCAAACTAACTTTGGG - Intronic
953745296 3:45569433-45569455 GCATAGGCCAAACTAACTTTGGG + Intronic
953746338 3:45576846-45576868 GTGTAGGCCAAGCTGAATATAGG + Intronic
953990570 3:47480105-47480127 GGATAGGCGAAGGTAACTTTGGG - Intergenic
955329675 3:58036791-58036813 GCATAGGCCAAACTAACCTTGGG - Intronic
955416094 3:58692797-58692819 GCGTAGGCCAAACTAACTTTGGG + Intergenic
955605818 3:60701877-60701899 GTGTAGGCTGAACTAACTTTTGG - Intronic
955655750 3:61243077-61243099 GCGTAGGCCAGACTAACTTTGGG - Intronic
955858273 3:63298177-63298199 GTGTAGGCCAAACCAACAATTGG - Intronic
956158631 3:66324650-66324672 GTGTAGGCCAAACTAACTTTGGG - Intronic
956369067 3:68538406-68538428 GCATAGGCTAAGCTAACTTTGGG - Intronic
956599464 3:71003962-71003984 ATGTTGCCCAAGCTGACTTTGGG + Intronic
956915473 3:73866714-73866736 GTATATGCCAAGCTAACTTTGGG + Intergenic
957240745 3:77658362-77658384 GCGTGGGCCACGTTAACTTTGGG + Intergenic
957509508 3:81169401-81169423 GTGGAGCCCAAGCTAACTCTAGG - Intergenic
957781435 3:84822440-84822462 ATGTAGACCAAGCTAACTATGGG - Intergenic
958525848 3:95258222-95258244 GTGTAAGTCAAACTAACTTCGGG + Intergenic
958573205 3:95913051-95913073 GTGTAGGCTGAACTAACTTTGGG - Intergenic
958681392 3:97336255-97336277 GCATAGGCCAAACTAACTTTGGG - Intronic
958749906 3:98183388-98183410 GTGTAGGCCAAACTACATTTGGG + Intronic
958930238 3:100199797-100199819 GTGTAGGCCAAGCTAACTTTGGG - Intergenic
959053544 3:101547382-101547404 GTGTAGCCTAAGCTAACAATGGG + Intergenic
959152917 3:102629164-102629186 GCATAGGCCAAGCTAACAATGGG + Intergenic
959161929 3:102734465-102734487 GTGTAGGTGAAACTAATTTTGGG + Intergenic
959281715 3:104350014-104350036 GCATAGGCCAAACTAACTTTGGG - Intergenic
959350761 3:105260178-105260200 GTGTAGGCCAAGCTAAACATGGG + Intergenic
959970534 3:112404402-112404424 GTGTAAGCCGAACTAACTTTGGG + Intergenic
959980670 3:112513099-112513121 GCATAGGCCAAACTAACTTTGGG + Intergenic
960004670 3:112769928-112769950 GTGTAGGTTGAACTAACTTTGGG + Intronic
960556908 3:119039936-119039958 GCGTAGGCTGAACTAACTTTGGG + Intronic
961031338 3:123606824-123606846 GTTTAAGTCAAGCTAACTCTGGG + Intergenic
961264751 3:125632846-125632868 GCATAGGCCAAGCTAACCTTTGG + Intergenic
962051060 3:131816008-131816030 ACATAGGCCAAGCTAACTATGGG - Intronic
963019154 3:140855443-140855465 GTGTAGGCCAGAATAACTTTCGG - Intergenic
963314207 3:143741874-143741896 GCGTAGGCTGAGTTAACTTTGGG + Intronic
963470537 3:145736117-145736139 GCATAGGCCAAACTAACCTTGGG - Intergenic
963644884 3:147901339-147901361 GTATATGCCAAGCAAACTTTAGG - Intergenic
963693704 3:148537326-148537348 GTGTAGGCCAGGCTAACCATGGG - Intergenic
963760898 3:149286139-149286161 GCGTAGGCCGAGCTAACTTTGGG - Intergenic
964010640 3:151887617-151887639 GCATAGACCAAGCTGACTTTGGG - Intergenic
964011617 3:151898754-151898776 GCATAGACCAAGCTGACTTTGGG + Intergenic
964026746 3:152083111-152083133 GTGCAGGCCAAGCTCACATGTGG - Intergenic
964068562 3:152604800-152604822 GTGTACGCTGAACTAACTTTGGG - Intergenic
964098933 3:152965366-152965388 GTGTAGACCACACTAACTTTGGG - Intergenic
964111925 3:153096766-153096788 GCGTAGGCCAAACTAACTTTGGG + Intergenic
964312811 3:155412403-155412425 GCATAGGCCAAGCTAACTTTAGG - Intronic
964453082 3:156831453-156831475 GTATGGGCCAATCTAACTTTGGG - Intronic
964611295 3:158618803-158618825 GCACAGGCCAAACTAACTTTTGG + Intergenic
964759835 3:160124322-160124344 GTGTAGGCTGAACTAACTTTGGG - Intergenic
964807866 3:160631291-160631313 GCATAGACCAAACTAACTTTGGG - Intergenic
964986812 3:162752461-162752483 GTGTAGGCCAAACTAACTCTAGG + Intergenic
965123484 3:164594266-164594288 AAATAGGCCAAGCTAACTTGGGG - Intergenic
965124036 3:164601203-164601225 TAGTAGGCCAAGCAAACTTTGGG - Intergenic
965142787 3:164861405-164861427 GCTTGGGCCAAGCTAATTTTTGG + Intergenic
966162517 3:176983341-176983363 GCTTGGGCCACGCTAACTTTGGG - Intergenic
966757382 3:183384244-183384266 GCGTAGGCTGAACTAACTTTGGG + Intronic
966934902 3:184699820-184699842 GCGTAGGCTGAACTAACTTTGGG - Intergenic
966993183 3:185254626-185254648 GCTTAGGCCAAGTTAACTTTGGG + Intronic
967244605 3:187473038-187473060 GCATAGGCCAAACTAAATTTAGG - Intergenic
967683536 3:192393513-192393535 GAGTAGGCCAAGCTTATTTTTGG + Intronic
967962303 3:194935553-194935575 GCGTAGGCTGAACTAACTTTGGG - Intergenic
968124187 3:196146320-196146342 GTGTGGGCCAAGCTAAGTTTGGG - Intergenic
968928535 4:3562902-3562924 GCGTAGGCCGAACTAACTTTGGG + Intergenic
969064457 4:4467323-4467345 TCGTAGGCCAAACTAACTTTGGG - Intronic
969209674 4:5677322-5677344 GTGTGGGCCCAGCTGACTCTTGG - Intronic
969727458 4:8929994-8930016 GTGAAGGCTGAACTAACTTTGGG - Intergenic
970235063 4:13950394-13950416 CTGTAGGCCGAACTAACTTTGGG + Intergenic
970440004 4:16072547-16072569 CCATAGGCCCAGCTAACTTTGGG + Intronic
970442698 4:16095644-16095666 GCATAGGCCGAACTAACTTTGGG - Intergenic
970529007 4:16963104-16963126 GCATAGGCCGAACTAACTTTGGG - Intergenic
970649961 4:18166827-18166849 GTGTAGGCTAAACTTACTTTGGG + Intergenic
971238330 4:24864112-24864134 GCGTGGGCCGGGCTAACTTTGGG + Intronic
971642905 4:29158329-29158351 GTGTAGGCCAAGTAAAGTGTGGG - Intergenic
971659169 4:29389858-29389880 GCTTGGGCCAAACTAACTTTGGG + Intergenic
971728053 4:30338486-30338508 AGGTAGGCCAAGCTAACTATGGG - Intergenic
971784753 4:31085509-31085531 GAGTAGGCTAAAGTAACTTTGGG - Intronic
971827997 4:31652429-31652451 GTGTAGGCCGAACTAGCTATAGG + Intergenic
972228748 4:37045390-37045412 GTGTAGGCCAAACTAGCTTTGGG - Intergenic
972568608 4:40290744-40290766 GTGTAGGCTGAACTAACTTTGGG + Intergenic
972682133 4:41316269-41316291 GCACAGGCCAAGCTAACTTGGGG - Intergenic
973252889 4:48079144-48079166 GCGTAGGCTAAACTAACTTTGGG + Intronic
973581801 4:52351445-52351467 GTGTATGCTGAACTAACTTTGGG + Intergenic
974013273 4:56626320-56626342 GCATGGGCCAAGCTAATTTTTGG + Intergenic
974029180 4:56760454-56760476 GCTTAGGCCAAGCTAACTTTGGG + Intergenic
974910263 4:68109083-68109105 GTGTAGGAGATGCAAACTTTGGG - Intronic
974923189 4:68267471-68267493 GCATAGGCCAAACTAACTCTGGG + Intergenic
974948311 4:68555475-68555497 GTGTAGGCCAAACTAACTTAAGG - Intronic
975293468 4:72705176-72705198 GCATAGGCCGAGCTAACTTTGGG + Intergenic
975707151 4:77122503-77122525 GTGTAGGCTGAACTAACTTTGGG + Intergenic
975851044 4:78572917-78572939 GTGTGGGGCAAACTAACTTCAGG - Intronic
975862694 4:78694320-78694342 GCATGGGCCAAGCTAACTTTGGG - Intergenic
976008147 4:80455264-80455286 GTGTAGGCGAAACTAATTTTGGG - Intronic
976217405 4:82728276-82728298 GTGTAGGCCAAGCTAAGTTTGGG + Intronic
976255494 4:83096167-83096189 GTGTAGGCTGAACCAACTTTGGG - Intronic
976262177 4:83156074-83156096 GCATAGGCCAAGCTGACTATGGG + Intergenic
976278816 4:83306666-83306688 GTGTAGGCTGAACTAACTTTGGG + Intronic
976302210 4:83525912-83525934 GTGCACACCAAGCTAACTTTGGG - Intergenic
976302383 4:83527572-83527594 GTGTAGGCCAAGCTAACTACAGG + Intergenic
976740429 4:88350778-88350800 GAATAAGCCAAGCTAACATTGGG - Intergenic
976746600 4:88409287-88409309 GCATGAGCCAAGCTAACTTTGGG - Intronic
977354569 4:95928998-95929020 GTGTAGGCTGAACTAACTTGGGG - Intergenic
977585267 4:98769275-98769297 ATATAAGCCAAGCTAACTATGGG + Intergenic
977610509 4:99025214-99025236 GCACAGGCCAAACTAACTTTGGG - Intronic
977672681 4:99714477-99714499 GCATAGCCCAAGCTAACTTTGGG + Intergenic
977679863 4:99786555-99786577 GTATAGACCAAGCTGACTTTGGG + Intergenic
977761946 4:100748352-100748374 GCATAGGCCAAACTAATTTTGGG - Intronic
978339708 4:107709386-107709408 GTTTGGGTCAAGCTAACTTTGGG + Intronic
978398604 4:108308302-108308324 GCATAGGCCAAACTAACTTTTGG - Intergenic
978427305 4:108595911-108595933 GTGTAGTCCAAGCTAACTTTGGG + Intergenic
978713687 4:111816390-111816412 GCATAGGCCAAGCTAACTTTGGG + Intergenic
978863225 4:113476468-113476490 GTGTAAACCAAGCCAACTATGGG + Intronic
978950428 4:114552358-114552380 GTGTAGGCCAAACTAACTTTGGG + Intergenic
979308185 4:119172783-119172805 GAATAGGCCAAACTAACTTTGGG - Intronic
979624998 4:122834731-122834753 GCTTAGGCCCAGATAACTTTGGG + Intronic
979719151 4:123878883-123878905 GCGTAGGCCAAACTAACTTTGGG + Intergenic
979898835 4:126192411-126192433 GTGTAGGCCGAACTAGCCTTGGG + Intergenic
979918984 4:126475572-126475594 GTGTAGGCCAAGTTAACATTGGG + Intergenic
980071741 4:128250582-128250604 GCATAGGCCAAACTAATTTTGGG + Intergenic
980121505 4:128732604-128732626 GTATAGGCCAAACTAGCCTTGGG - Intergenic
980269971 4:130571798-130571820 GTGTAGGCAGAACTAACTTTGGG + Intergenic
980339910 4:131531740-131531762 GCATAGGCCAAACTAACTTTGGG + Intergenic
980396860 4:132225980-132226002 GAATATGCAAAGCTAACTTTAGG + Intergenic
980466777 4:133196713-133196735 GCATAGGCCAAGCTAACTTTGGG - Intronic
980489227 4:133504365-133504387 GAATGGGCCAAGCTAACTTTGGG - Intergenic
980497063 4:133599878-133599900 GTGTAGGACGAAATAACTTTGGG + Intergenic
980588560 4:134853035-134853057 GTGTAGGCCAAGCTAACTATTGG + Intergenic
980777230 4:137452823-137452845 GCGTAGGCTGAACTAACTTTGGG - Intergenic
980829119 4:138108391-138108413 GCATAGGCCAAGCTAACTTTGGG + Intergenic
980829427 4:138111901-138111923 GAGAAGGCCAAGCTAACTTTTGG - Intergenic
980832885 4:138152969-138152991 GTGTAGGTTGAACTAACTTTGGG - Intergenic
980912587 4:139007157-139007179 GCATAGGCCTAGCTAACCTTGGG + Intergenic
981166575 4:141566072-141566094 GCCTAGGCCAAGCTAACTTTAGG + Intergenic
981305748 4:143245354-143245376 GTGTAGGCCAAACTAACTTTGGG + Intergenic
981696871 4:147567769-147567791 GTGTAGGCTGATCTAACTTTGGG + Intergenic
982008753 4:151086985-151087007 GCGTAGGCTGAACTAACTTTGGG + Intergenic
982237214 4:153262781-153262803 ATGTAGGCCGAACTAACTTTGGG - Intronic
982639083 4:157933968-157933990 GCATAGGCAAAGCTAATTTTGGG - Intergenic
982702997 4:158676586-158676608 GAGTAGGCTGAACTAACTTTGGG - Intronic
982788230 4:159560428-159560450 GGGTAGGCTGAACTAACTTTGGG - Intergenic
983053476 4:163075667-163075689 GCATAGGCCAAGCTAATTTGGGG + Intergenic
983425529 4:167579692-167579714 GTGTAGACTGAACTAACTTTGGG + Intergenic
983660057 4:170122165-170122187 GTGTAGGCCAAGTTAGCCTTGGG + Intergenic
983736387 4:171067786-171067808 ATGTAGGCCAAGCTAACTGTGGG + Intergenic
984701902 4:182823848-182823870 GTGTAGGCTGAACTAACTTTAGG + Intergenic
985054943 4:186027894-186027916 ATGTAAGCCAAGCTAACCTTGGG - Intergenic
985196737 4:187438300-187438322 GTGTAGGCCAAGCTAACCATGGG - Intergenic
985216691 4:187660974-187660996 GCATAGGCCAAGCTAACTATGGG + Intergenic
985347541 4:189022510-189022532 GTGTAGGCTGAACTAACTTTGGG + Intergenic
985426946 4:189840535-189840557 GTGTAAGCCACACTAACTATGGG + Intergenic
985426956 4:189840608-189840630 GTGTAAGCCATGCTAACTTTGGG + Intergenic
985653390 5:1117384-1117406 GCGTAGGCTGAACTAACTTTGGG + Intergenic
985753028 5:1693577-1693599 GTGTACACCAGGCTGACTTTGGG + Intergenic
986212223 5:5684752-5684774 GTGTAGGCTCAACTAACTTTGGG - Intergenic
987118714 5:14746717-14746739 GTGTAGGCTGAACTGACTTTGGG - Intronic
987456591 5:18154851-18154873 GTATAGGCCAAGCTAACTTTGGG - Intergenic
987486560 5:18533761-18533783 GGTTAGGCCAAACTAACTTTGGG - Intergenic
987491257 5:18582860-18582882 GTGTAAGTCAAGCTAACGATGGG - Intergenic
987757155 5:22110881-22110903 GCTTAAGCCAAGCTAACTTTGGG - Intronic
988510228 5:31858467-31858489 GTGTAGGCCAAACTAACTTTGGG + Intronic
988658448 5:33237960-33237982 GCATAGAGCAAGCTAACTTTGGG - Intergenic
988680128 5:33476804-33476826 GTGTAGGCCAAGCTAGCCATGGG + Intergenic
988681957 5:33492199-33492221 GCATAGGCCAAGCTAACCATGGG - Intergenic
988783223 5:34542289-34542311 GCGTAGGCAGAGCTAACTTTGGG - Intergenic
988783721 5:34546703-34546725 GTATGGGCCAAGCTAATTTTAGG + Intergenic
988828728 5:34967466-34967488 GCATAGGCCAAACTAACTTTGGG + Intergenic
988834316 5:35016343-35016365 ATATAGGCTAAGCTAACTATGGG + Intronic
988875366 5:35439328-35439350 GCATAAGCCAAGCTAACTTTGGG - Intergenic
988882690 5:35520572-35520594 GTATAGGCCAAACTAACTTTTGG - Intergenic
989159280 5:38374785-38374807 GCGTAGGCCGAACTAACCTTGGG - Intronic
989412900 5:41140730-41140752 GCTTGGGCCAAGCTAACTTTGGG - Intergenic
990123030 5:52479511-52479533 GTATAGGCCAAGCGAACTTTGGG - Intergenic
990237777 5:53786373-53786395 CTATAGGCCAAACTAACTCTGGG + Intergenic
990306435 5:54498138-54498160 GTGTAGGCCAAACTAACATCAGG + Intergenic
990495816 5:56346782-56346804 GCATAGGCCAAGCTAACCATGGG - Intergenic
990826947 5:59911039-59911061 GCATAGGCCAAACTAACTTTGGG + Intronic
991027478 5:62045751-62045773 GTGTAGGTCAAGCTAACTATAGG - Intergenic
991142010 5:63255414-63255436 GTGTAAGCTGAACTAACTTTGGG + Intergenic
991207631 5:64067584-64067606 GTGTAGGCTGAACCAACTTTGGG + Intergenic
991423924 5:66470808-66470830 GTGTAGGCCGAACTAACTTTGGG + Intergenic
991426027 5:66492554-66492576 GCCTAGGCCAAACTAACTTTGGG - Intergenic
991492157 5:67194122-67194144 GTGTAGACCAAGCTGAATTTGGG + Intronic
991610059 5:68440662-68440684 GCATAGGCCAAGCTAACCATGGG - Intergenic
991611494 5:68454310-68454332 GCATAGGCCAAGTTAACTATAGG - Intergenic
991670798 5:69045658-69045680 GCATAGGCCGAACTAACTTTGGG - Intergenic
991675973 5:69090327-69090349 GCTTGGGCCAAGCTAACTTTGGG - Intergenic
991692897 5:69242698-69242720 GTGTTGGCAATGCTAACTATGGG - Intronic
991951272 5:71948759-71948781 GTGTAGGCTGAACTAACTTTGGG - Intergenic
991997297 5:72400599-72400621 GCTTGGCCCAAGCTAACTTTGGG + Intergenic
992060083 5:73035623-73035645 CTGTAGTCCCAGCTAATTTTGGG - Intronic
992107357 5:73460951-73460973 GTGTAGGCTTAACTAACTTTGGG + Intergenic
992286677 5:75242547-75242569 GTGTAGGCCAAACTAACTTTGGG - Intergenic
992688969 5:79224732-79224754 GCATAGGCCAAGCTAACGTTGGG - Intronic
992722775 5:79577269-79577291 GCATAGGCCAAACTGACTTTGGG + Intergenic
992723179 5:79580561-79580583 GCATAGGCCAAACTAACTTTGGG + Intergenic
992761337 5:79953378-79953400 GCATAGGCCGAACTAACTTTGGG + Intergenic
993013232 5:82507744-82507766 GAGTAGGCCAGGCTAACCATGGG + Intergenic
993039008 5:82790864-82790886 GTGTGGGCCAAACTCACTTTGGG + Intergenic
993344484 5:86765560-86765582 GCTTGGGCCAAGCTAACTTTGGG - Intergenic
993416531 5:87639847-87639869 GTGTAGGCCAATCCAACAATGGG - Intergenic
993422772 5:87721983-87722005 GCGTAGGCTGAACTAACTTTGGG - Intergenic
993966411 5:94365673-94365695 ATGTAGGCTGAGCTAACTTTGGG + Intronic
994034601 5:95184517-95184539 GTGTAGGGCAAACTAACTTTGGG + Intronic
994648340 5:102497698-102497720 GCTTAGGCCGAACTAACTTTGGG + Intronic
994840861 5:104923540-104923562 GCACAGGCCAAGCTAACTTTGGG - Intergenic
994903387 5:105804372-105804394 GAGTAGGCCAAGCAAACCGTGGG - Intergenic
995200937 5:109424653-109424675 GTGTAAACTGAGCTAACTTTGGG + Intergenic
995281310 5:110338796-110338818 GTGTAGGCCAAACTAGCCTTAGG - Intronic
995588476 5:113673787-113673809 GCTTGGGCCAAGCTAACTTTGGG + Intergenic
995926372 5:117380006-117380028 GTGTAGGCTGAACTAACTTTGGG - Intergenic
996132294 5:119796185-119796207 GTGTAGGCTGAACTAACTTTGGG - Intergenic
996832670 5:127756793-127756815 GCATAGGCCGAACTAACTTTGGG - Intergenic
996861000 5:128065632-128065654 GTGTAGGCCAAGCTAACTTTGGG + Intergenic
997301424 5:132808831-132808853 GCATAGGCCAAATTAACTTTGGG + Intergenic
997948857 5:138225858-138225880 GCATAGGCCAAGGTAACTATGGG + Intergenic
998030638 5:138864613-138864635 GCATAGGCTAAGCTAACTATGGG - Intronic
998093804 5:139385713-139385735 GTGTAGGCTGAACTAACCTTGGG + Intergenic
998744849 5:145246821-145246843 GTGTAGGCCAAACTAACCTAGGG + Intergenic
999105547 5:149067828-149067850 GTGTAGGCCAAGCTAACCATGGG - Intergenic
999898065 5:156056217-156056239 GTGTAGGCTGAACTAACTTTGGG + Intronic
1000089554 5:157918396-157918418 GCATAGGCCAAACTAACTTTGGG - Intergenic
1000233600 5:159337437-159337459 GTGTGGGCCAAGCTAACTTTGGG + Intergenic
1000608977 5:163354799-163354821 CTATAGGCCAACCTAACTTAGGG - Intergenic
1000725429 5:164763683-164763705 GTGTAGGCCAAACTAACCTTGGG - Intergenic
1000831764 5:166110865-166110887 GTGTAGGCTAAACTAACTGTTGG + Intergenic
1000847920 5:166304575-166304597 GCATAGGCCAAGCTAACCATGGG - Intergenic
1000848002 5:166305258-166305280 GTGTAGGCCAAGCTGGGTGTAGG - Intergenic
1001915961 5:175560252-175560274 GTGCAGGCCAAACTAACTTTGGG - Intergenic
1002181651 5:177433908-177433930 GCGTAGGCCAAGCTCACCTGTGG - Exonic
1003025098 6:2547789-2547811 GCATAGGCCAAGCTAACTTTGGG + Intergenic
1003054540 6:2806319-2806341 GCTTGGGCCAAGCTAACTTTGGG + Intergenic
1003223698 6:4185928-4185950 GTGTAGGCTGAACTAACTTTGGG - Intergenic
1003267922 6:4582797-4582819 GTGTAGGCCAAAGTAACTTTGGG + Intergenic
1003269265 6:4592953-4592975 GCATAGACCAAGCTAACTTTGGG - Intergenic
1003312415 6:4981118-4981140 GTGTAGGCCAAACTAGCTTTGGG - Intergenic
1003374855 6:5567018-5567040 GCGTAGGCCGAACCAACTTTGGG + Intronic
1003693089 6:8374195-8374217 GCATATGCCAAGCTAACTGTGGG - Intergenic
1003801845 6:9678886-9678908 GCATAGGTCAAGCTAATTTTGGG - Intronic
1004358991 6:14954371-14954393 GCGTAGGCTGAACTAACTTTGGG + Intergenic
1004368417 6:15031359-15031381 GTGTAGGCTGAACTAACTTTGGG - Intergenic
1004390328 6:15204407-15204429 GTGTAGGCTGAACTAACTTTGGG - Intergenic
1004474561 6:15959321-15959343 GCTTAGACCAAACTAACTTTGGG - Intergenic
1004604679 6:17182924-17182946 GGGTAGGCCAAGTTAATTTGGGG + Intergenic
1004646472 6:17566560-17566582 GTGTAGGCTGAACTAACTTTGGG + Intergenic
1004648176 6:17582780-17582802 GTGTAGGGCAATCTGTCTTTAGG + Intergenic
1005034435 6:21542743-21542765 GTGTAGGCGGAACCAACTTTGGG - Intergenic
1005103539 6:22199272-22199294 GTGTAGGCCAAGCTAATTATGGG - Intergenic
1005218854 6:23563071-23563093 GTGTAGGCCAAACTAACTTTGGG - Intergenic
1005336010 6:24797005-24797027 GCATAGGCCAAACTAACTTTGGG - Intergenic
1005370937 6:25132111-25132133 AGGTAGGCCAAACTAATTTTGGG - Intergenic
1005429251 6:25736998-25737020 GCACGGGCCAAGCTAACTTTGGG + Intergenic
1005482545 6:26268504-26268526 GTGTAGGCTGAACTACCTTTGGG + Intergenic
1005621060 6:27620710-27620732 GTGTAGGTGGAACTAACTTTGGG + Intergenic
1005624105 6:27647283-27647305 ATGTAGGCTGAACTAACTTTGGG + Intergenic
1005761023 6:28968460-28968482 GTGTAGGCCAAGCTAACCATTGG + Intergenic
1005912501 6:30323318-30323340 GCGTAGGCTGAACTAACTTTGGG - Intergenic
1005936909 6:30530051-30530073 GCAAAGGCCAAGCTAACTTTGGG + Intergenic
1007276804 6:40679991-40680013 GCGTAGGCTGAACTAACTTTGGG + Intergenic
1007467025 6:42059720-42059742 GCGGAGGCTAAACTAACTTTGGG - Intronic
1007503523 6:42316610-42316632 GTGTAGACCAAGCTAACCATGGG + Intronic
1007539157 6:42625015-42625037 GTGTAGGCCAAACTAACTTTGGG - Intronic
1007539492 6:42627869-42627891 GTGCAGGCCAAACTAACTTTGGG - Intronic
1007880138 6:45155602-45155624 ACATAGGCCAAGCTAACTATGGG - Intronic
1008103405 6:47416850-47416872 GCATAGGACAAGCTAACTATGGG - Intergenic
1008476154 6:51937992-51938014 GTGTAAGCCAAGCTAACTATGGG + Intronic
1008656007 6:53614544-53614566 GCTTATGCCAAGATAACTTTGGG - Intronic
1009266829 6:61566564-61566586 GCGTAGGTCAAACTAACCTTGGG - Intergenic
1010201248 6:73284024-73284046 GCATAGGCCAAACTAACCTTGGG + Intronic
1010440186 6:75885062-75885084 GTGTAGGCCGAACTAATCTTGGG - Intronic
1010637456 6:78279077-78279099 GTGTAGGCTGGACTAACTTTGGG + Intergenic
1010729848 6:79379758-79379780 GCGTGCGCCAAGCTAACTTTGGG + Intergenic
1010843636 6:80678405-80678427 GCGTAGGCTGAACTAACTTTGGG - Intergenic
1011022851 6:82833598-82833620 GTGTAGGCCAAGCTAACTTTGGG - Intergenic
1011256898 6:85431812-85431834 GCTTAGACCAAGCTAATTTTGGG + Intergenic
1011438852 6:87366969-87366991 GTGCAGGCCAAGCTAACCATGGG - Intronic
1011612753 6:89169200-89169222 GTGTAAGCCAGACTAACTTTGGG - Intergenic
1011631019 6:89324447-89324469 GCGTAGGTTAAACTAACTTTGGG - Intergenic
1011676655 6:89741413-89741435 GTATAGGCCAAGTAAACTATGGG + Intronic
1011754669 6:90486526-90486548 GTGTGGGCCAAACTGACTTTGGG + Intergenic
1011824855 6:91293846-91293868 GTGTAGGCTGAACTAACTTTGGG - Intergenic
1011848921 6:91602066-91602088 GCCTAGGCCAAGCTAACTATGGG + Intergenic
1011894023 6:92201437-92201459 GTGTAGGCCAAGCTAACTTTGGG + Intergenic
1011939809 6:92828850-92828872 GTGTAGGCTGAACTAACTTTGGG - Intergenic
1012248345 6:96952500-96952522 GTGTAGGCCCAGCTAACCATGGG + Intronic
1013089538 6:106887778-106887800 CCATAGGCCAAACTAACTTTGGG + Intergenic
1013246140 6:108289230-108289252 GTATAGGCTGAACTAACTTTGGG - Intergenic
1013249263 6:108317783-108317805 GCACAGGCCAAGCTAACTTTAGG - Intronic
1013478460 6:110531161-110531183 GCATGGGCCAAGCTAACTTTGGG - Intergenic
1013485009 6:110588598-110588620 GTGTGGGGCAAGCTAACTTTGGG + Intergenic
1013487871 6:110615632-110615654 GCATGGGCCAAGCTAACTTTGGG + Intronic
1014450463 6:121576084-121576106 GCATAGGTCAAGCTAACTTTGGG + Intergenic
1014629393 6:123770749-123770771 GTATAAGCCAAGCTAACCATGGG - Intergenic
1015173168 6:130277326-130277348 GTGTAAGCCAAGCTAACCATGGG - Intronic
1015415552 6:132943938-132943960 GTGTAAGCCAAAGTAACGTTAGG - Intergenic
1016028649 6:139314830-139314852 GCGTAGGGCGAACTAACTTTGGG + Intergenic
1016163983 6:140917092-140917114 GCGTAGGCCAAACTAACTGTGGG + Intergenic
1016513148 6:144865499-144865521 GTGTAGACCAAGCTAACTTTGGG + Intergenic
1016513989 6:144873447-144873469 GCATAGGCCAAGCTAACTACGGG + Intergenic
1016521372 6:144950657-144950679 GTGTAGGCTGAACTCACTTTGGG - Intergenic
1016680634 6:146825094-146825116 ATGTAGGCCAAGCCAACTATGGG - Intergenic
1016704246 6:147088529-147088551 GCATGGGCCAAGTTAACTTTGGG + Intergenic
1016742532 6:147542900-147542922 GTGTGGGCTGAACTAACTTTTGG - Intronic
1017046561 6:150352152-150352174 GTGTGGGCCAAGCTAACCTTGGG + Intergenic
1017177731 6:151520461-151520483 GTGTAGGCTGAAATAACTTTGGG + Intronic
1017780033 6:157708625-157708647 GCTTAGGCTAAGCTAACTTTGGG - Intronic
1017917379 6:158842315-158842337 GTTTGGGTCAAGCTAACTTTGGG - Intergenic
1017921851 6:158879746-158879768 GCATAGGCCAAACCAACTTTTGG - Intronic
1017975683 6:159355243-159355265 GCATAGGCCAAGCTAACTTTGGG + Intergenic
1017984760 6:159434247-159434269 GCATAGGCCAAGCCAACTGTGGG - Intergenic
1018076953 6:160225890-160225912 GTATAGGCTGAACTAACTTTGGG + Intronic
1018179690 6:161211003-161211025 GCATAGGCCAAATTAACTTTTGG - Intronic
1018188969 6:161291881-161291903 GCATAGGCCGAACTAACTTTGGG + Intergenic
1018189652 6:161299199-161299221 GCATAGGCCAAACTAACTTTGGG + Intergenic
1018562759 6:165119206-165119228 GAGTAGGTCAAACTAACTTTGGG - Intergenic
1018779683 6:167051398-167051420 GCATGGGCCAAGCTAACTTTGGG - Exonic
1019268951 7:135191-135213 GTGTAGTGCAATCCAACTTTTGG + Intergenic
1019381295 7:725556-725578 GAGTAGGCCAAGCTAACTTTAGG + Intronic
1019782440 7:2951433-2951455 GCAGAGGCCAAACTAACTTTGGG + Intronic
1020340704 7:7107063-7107085 GCATAGGCCAAACTAACTTCGGG - Intergenic
1020350599 7:7214741-7214763 GGGTAGGCCGAACAAACTTTCGG + Intronic
1020654311 7:10911442-10911464 GTGTAGACCAAGCTAACTTTGGG + Intergenic
1020737736 7:11972652-11972674 GTGTGGGCCAAGCTAACTGTGGG + Intergenic
1020762722 7:12288617-12288639 GTGTAGGCCGAACTAACTTTGGG + Intergenic
1021479862 7:21104254-21104276 GCGTTGGCCAAGCTAACCATGGG - Intergenic
1021507626 7:21402933-21402955 GTGTAGGCTGAACTAACTTCGGG - Intergenic
1021598037 7:22337603-22337625 CCGTGGGCCAAGCTAACTTTGGG - Intronic
1021738842 7:23664976-23664998 GTGTAGGCCAAGCTAACTTTGGG - Intergenic
1021754353 7:23836842-23836864 GCATAGGCCGAACTAACTTTGGG + Intergenic
1021885178 7:25130791-25130813 GCATAGGCCAAGCTAACTACGGG - Intergenic
1022649392 7:32260687-32260709 GCATAGGCCGAACTAACTTTGGG + Intronic
1023189863 7:37568746-37568768 GCTTGGGCCAAGCTAACTTTGGG - Intergenic
1023436970 7:40149348-40149370 GTGTAGGCTGAACTAACTTTAGG + Intronic
1023523309 7:41071308-41071330 GGGTAGGCCAAGCTAACTTTGGG + Intergenic
1023537336 7:41227403-41227425 GTGCAGGTCAAGCTATCTTTGGG + Intergenic
1023579736 7:41668954-41668976 GTGTGGGACAAACTAATTTTGGG - Intergenic
1023604376 7:41915274-41915296 ACGTAGGCCAAGCTAACTATGGG - Intergenic
1023699779 7:42881756-42881778 GTATAGACCAAGCTTACTATGGG + Intergenic
1023970783 7:44989250-44989272 GTGTAGGCTGAACTAACTTTGGG - Intergenic
1024029477 7:45445976-45445998 ATGTAGGCCAAGCTAAATATGGG + Intergenic
1024140419 7:46457557-46457579 GTTTAGGCCAAGATAACTTTGGG - Intergenic
1024315839 7:48015831-48015853 GAGTAGGCCAAACTAACTTTGGG + Intronic
1024378587 7:48667832-48667854 GCATAGGCCAAGCTAACCATGGG - Intergenic
1024675697 7:51636328-51636350 GCTTAAGCCAAGCTAACTTTGGG - Intergenic
1024775387 7:52779096-52779118 GCATAAGCCAAGCTAACTATAGG + Intergenic
1024821802 7:53339808-53339830 GTGTAGACCAAACTAACTTTGGG - Intergenic
1026085034 7:67255929-67255951 GCTTGGGCCAAGCAAACTTTGGG - Intergenic
1026128936 7:67604646-67604668 GTGTATGCCAAGGTAACTATGGG + Intergenic
1026147747 7:67762234-67762256 GCATAGGCCAAACTAACTTTGGG - Intergenic
1026192690 7:68143929-68143951 ATGTAGGCCAAGCTAACCATGGG - Intergenic
1026228890 7:68466345-68466367 GCGTAGGCTGAACTAACTTTTGG + Intergenic
1026483814 7:70800752-70800774 GTGTAGGCCAAATTAACTACGGG - Intergenic
1026495208 7:70895843-70895865 GCGTAGGCTGAACTAACTTTGGG - Intergenic
1026496366 7:70907125-70907147 GCGTAGGCTAAACTAACTTTGGG + Intergenic
1026692140 7:72558994-72559016 GCTTGGGCCAAGCAAACTTTGGG + Intronic
1026695526 7:72587828-72587850 GTGTAGACTGAACTAACTTTGGG - Intronic
1027467630 7:78535609-78535631 GTGCAGGCTGAACTAACTTTGGG + Intronic
1027735971 7:81933289-81933311 GCATAGGCCAAGCTACCTTTGGG - Intergenic
1027745025 7:82062161-82062183 GTGTGGGCCAAGATAACTTTGGG - Intronic
1027871238 7:83710821-83710843 GCATGGGCCAAGCTAACATTGGG - Intergenic
1027954047 7:84857146-84857168 GCACAAGCCAAGCTAACTTTGGG + Intergenic
1028248464 7:88511495-88511517 GTGCAGGCCAAGGTAACTACGGG - Intergenic
1028351940 7:89859573-89859595 GTGTAGGCCAAACCAACTTTGGG - Intergenic
1028557333 7:92138046-92138068 GTGTAGGCTGAACGAACTTTGGG - Intronic
1028713611 7:93939317-93939339 GTGTGGGCCAAACTAGCTTTGGG - Intergenic
1029030310 7:97459992-97460014 GTGTAGGCTGAACTAACTTTGGG + Intergenic
1030155602 7:106451324-106451346 GTGTAGGCTAAATTAACTTTGGG - Intergenic
1030364322 7:108628151-108628173 ATGTAGGCTGAACTAACTTTGGG - Intergenic
1030680990 7:112433685-112433707 GTATAGGCAGAACTAACTTTGGG - Intronic
1030782721 7:113621814-113621836 GTGTAGGCCAAACTAACTTTGGG + Intergenic
1031227470 7:119058624-119058646 GTGTAGGCCAAACTAACTTTTGG + Intergenic
1031325718 7:120394681-120394703 GTGTAGGGCTAGCTAACCATGGG - Intronic
1031664740 7:124470141-124470163 ATGTAGGCAAAGCTAACTTCGGG - Intergenic
1032246701 7:130219473-130219495 GCATAGGCCAAGCTAACTTTGGG + Intergenic
1032247386 7:130224522-130224544 GCGTAGGCTGAACTAACTTTGGG + Intergenic
1032669673 7:134071712-134071734 ATGTAGGCCCAGCTAACTATGGG - Intergenic
1033067315 7:138168405-138168427 GTGTGGGCCAAGATAACTTTGGG - Intergenic
1033071572 7:138208133-138208155 ATGTAGGCTGAACTAACTTTGGG - Intergenic
1033076896 7:138258116-138258138 GGGTAGGCCAAACTAACTTTGGG + Intergenic
1033091353 7:138389101-138389123 GTATAGGCCAAGCTAACTTTGGG - Intergenic
1033121150 7:138667839-138667861 GTGTAGGCTGAACTAGCTTTGGG + Intronic
1033340306 7:140486786-140486808 GTGTAGGCTGAACTAACTTTGGG - Intergenic
1034042772 7:147896887-147896909 GTGTAGGCGGAACTAACTTTGGG - Intronic
1034482661 7:151334645-151334667 GTGTAGGCCAAGCTAATTTTGGG + Intergenic
1034585677 7:152090154-152090176 GTGTATGCCAAGCTAACTTTAGG - Intronic
1034637401 7:152578129-152578151 GCCTGGGCCAGGCTAACTTTGGG - Intergenic
1034686762 7:152978663-152978685 ATACAGGCCAAGCTAACTTTGGG - Intergenic
1034710005 7:153183049-153183071 GCTTAGGCCAAACTAGCTTTGGG - Intergenic
1034915576 7:155035817-155035839 GCTTAGGCCAAGCTAGCTTTGGG - Intergenic
1035181579 7:157093161-157093183 GTGTAGGCCATGCTAACCATGGG + Intergenic
1035183379 7:157107212-157107234 GTTTAGGCCAAGCTAACCTTGGG + Intergenic
1035209101 7:157314550-157314572 GTGGAGGCCAAACTAACTTTGGG + Intergenic
1036194059 8:6698751-6698773 GCTCAGGCTAAGCTAACTTTAGG + Intergenic
1036382203 8:8243833-8243855 GCATGGGCCAAGCTAACTTTGGG + Intergenic
1036426746 8:8652027-8652049 GTGTAGGCTGAGCTAACTTTGGG - Intergenic
1036466381 8:9001896-9001918 GCGTAGGCCAAACTAACACTGGG - Intergenic
1036637522 8:10562080-10562102 GCAGAGGCCAAACTAACTTTAGG + Intergenic
1036677174 8:10844131-10844153 GTGTAGGCTGAACTAACTTTGGG + Intergenic
1037134269 8:15443584-15443606 GTGTAGGCTGAACTAGCTTTGGG + Intronic
1037203465 8:16285824-16285846 GTATAGACCAAACTAACTTTAGG - Intronic
1037267636 8:17083500-17083522 AGTTAGGCCAAACTAACTTTGGG - Intronic
1037396927 8:18453130-18453152 CTGTAGACCAAACTAGCTTTGGG + Intergenic
1037652555 8:20852131-20852153 ACGTAGGCCAAGCTAACTATAGG - Intergenic
1037735586 8:21563285-21563307 GCATAGGCCAAGATAACTTGGGG + Intergenic
1038371629 8:26999159-26999181 GCTTAAGCCAAGCTAACTTTGGG + Intergenic
1038393598 8:27229842-27229864 GTGTAGGCTGAACTAACTTTGGG + Intergenic
1038398712 8:27266782-27266804 GTTTAGGACAAGCTAACTTTAGG + Intergenic
1039113620 8:34067724-34067746 GTGTAGGTCAGGCTAACTATGGG + Intergenic
1039143375 8:34418159-34418181 GATTATGCCAAGCTAACTTTGGG + Intergenic
1039167202 8:34696537-34696559 GCTTGGGCCAAGCTAACTTTAGG - Intergenic
1039183725 8:34893682-34893704 GTGTAGGGCAAACCAACTTTGGG - Intergenic
1039259141 8:35751518-35751540 GTATAGGCCAAACTAACTTTGGG - Intronic
1039959417 8:42234569-42234591 GCATGGACCAAGCTAACTTTGGG + Intergenic
1039961386 8:42250569-42250591 GCTTAGGCCAAGATAACTTTGGG - Intergenic
1040526322 8:48228272-48228294 GTGTAGGCCAAACCAACTTTGGG - Intergenic
1040855404 8:51943700-51943722 GTAGAGGCCAAGCTAACTTTGGG + Intergenic
1040859019 8:51979779-51979801 GGGTAGGCCAAACCAACTTTGGG + Intergenic
1040998034 8:53421471-53421493 GTGTAGGCTGGACTAACTTTGGG + Intergenic
1041183481 8:55273345-55273367 GCGTAGGCTGAACTAACTTTGGG + Intronic
1041351692 8:56953318-56953340 GCATGGGCCAAGCTAACTTTTGG + Intergenic
1041977814 8:63819251-63819273 GCATAGGCCAAACTAACTTTAGG - Intergenic
1042004505 8:64166218-64166240 ATGTGGGTCAAGCTAACTTTGGG - Intergenic
1042198322 8:66253763-66253785 GCATAGGCCAAACTAACTTTGGG + Intergenic
1042397980 8:68313306-68313328 GCGTGGGTCAAGCTAACTGTGGG + Intronic
1042427426 8:68664293-68664315 ATATAGGCCAAGCTAACTACTGG - Intronic
1042824421 8:72965668-72965690 GTTTAAGCCAAGCTAACCATGGG - Intergenic
1042828822 8:73005309-73005331 GTGTAGGCCAAACTAACTTTGGG + Intergenic
1042933543 8:74036116-74036138 GTGTAAGCCAAGTTAACTTTGGG + Intergenic
1043182122 8:77097804-77097826 GGGTAGGTCGAACTAACTTTGGG - Intergenic
1043250690 8:78069518-78069540 GTATAGGCAGAACTAACTTTGGG + Intergenic
1043313636 8:78893676-78893698 GGATGGGCCAAGCTAACTTTGGG + Intergenic
1043379959 8:79691950-79691972 GCCTAGGCCAAGCTAACCATGGG - Intergenic
1043444278 8:80304144-80304166 GCATAGGCCAAGCTAATTTTGGG - Intergenic
1043853489 8:85240192-85240214 GTGTGAACCAAGCTAACTTTGGG + Intronic
1043877922 8:85507493-85507515 ACGTACGCCAAGCTAACTTTGGG - Intergenic
1043947041 8:86265035-86265057 GTGTAGGCCAAGCTAACCATGGG - Intronic
1043991857 8:86765300-86765322 ATGTAGGCCAAGGTAACTGTGGG + Intergenic
1044003624 8:86915517-86915539 GCATGGGCCGAGCTAACTTTGGG - Intronic
1044396774 8:91721934-91721956 GTGAGGGCCTAGCTAACTTTAGG + Intergenic
1044573800 8:93747438-93747460 GTGAAGGCCAAGCTAACTATGGG - Intergenic
1044989237 8:97780890-97780912 TTCTGGGCCACGCTAACTTTGGG + Intronic
1045472262 8:102523115-102523137 GTGTAGCCCAAGCTAACTTTGGG + Intergenic
1045646791 8:104307228-104307250 GTGTGGGCCAAGCTAACTTCGGG + Intergenic
1045649343 8:104327921-104327943 GTATGGGCCAAACTAACTTTGGG - Intergenic
1045690879 8:104758682-104758704 GTGTAGGCTGAACTAACTTTGGG - Intronic
1045734204 8:105276190-105276212 ATGTGAGCCAAGCTAACTTTGGG + Intronic
1045991837 8:108316860-108316882 GTATAGGCTGAACTAACTTTGGG + Intronic
1046164808 8:110418582-110418604 GTGTAGACCAAAGTAGCTTTGGG + Intergenic
1046190623 8:110790158-110790180 GTGTAGGCCAGGCTAACTTTGGG - Intergenic
1046591130 8:116208716-116208738 GTGGAGGCCGAGCTAACTTTAGG + Intergenic
1047047335 8:121069625-121069647 GTACAGCCCAAGCTAACTTTGGG + Intergenic
1047048550 8:121082807-121082829 GTTTAGATCAAGCTAACTTTGGG + Intergenic
1047866465 8:129029336-129029358 GTGTAAGCTGAACTAACTTTGGG - Intergenic
1048043771 8:130754497-130754519 GGGTAAGCCAAGCTAACTTTGGG + Intergenic
1048397338 8:134026546-134026568 GTGTAGGCTAAGCTAACTTTGGG + Intergenic
1048688378 8:136930089-136930111 GCACAGGCCAAGCTAACTATAGG + Intergenic
1048743529 8:137588497-137588519 ATTTGGGCCAAGTTAACTTTAGG + Intergenic
1049448718 8:142646292-142646314 GTGTAGGTCAAACTAACATTGGG + Intergenic
1049449553 8:142653134-142653156 GAGTGGGCCAAGCTAACTTTGGG + Intergenic
1049460035 8:142722495-142722517 GGGAAGGCCAAGCTGACTTAGGG + Intergenic
1049514536 8:143046668-143046690 GCATAGGCCAAGCTAACTATGGG + Intronic
1049522929 8:143103751-143103773 GCTTGGACCAAGCTAACTTTGGG - Intergenic
1049959207 9:722108-722130 GCACAGGCCAAGCTAACTGTGGG + Intronic
1050103221 9:2139957-2139979 GAATAGGTCAAGCTAACTTTGGG - Intronic
1050163323 9:2740185-2740207 GTGTGAGCCAAGCTAACTTTGGG - Intronic
1050166550 9:2770410-2770432 GCATGGGCCAAGCTAACATTGGG - Intronic
1050324227 9:4484714-4484736 GTGTAGGCCAAACTAACTTTAGG + Intergenic
1050442146 9:5676012-5676034 GCCTAGGCCATGCTAACTTTAGG + Intronic
1050482116 9:6097931-6097953 ACGTAGGCTAAGCTAACTCTGGG - Intergenic
1050491716 9:6195528-6195550 GCAAAGGCCAAACTAACTTTTGG - Intergenic
1050493759 9:6217429-6217451 GCTTGGGCCAAGCTAACTTTGGG - Intronic
1050623058 9:7474776-7474798 ATGTAGGCCAAGCGAACCATGGG - Intergenic
1050633039 9:7580864-7580886 ACATAGGCCAAGCTAACTATGGG + Intergenic
1050990215 9:12141005-12141027 GTGTAGGCTGAACTAACTTTGGG - Intergenic
1051049034 9:12909623-12909645 GCATAGGCCAAACTAACTTTGGG - Intergenic
1051248834 9:15138594-15138616 GTTTTGGCCAGGCTAACTTCGGG - Intergenic
1051269762 9:15344081-15344103 GCATAGGCCAAGCTAATTATGGG + Intergenic
1051507878 9:17845325-17845347 GTGTGAGCCAAGCTAACTTTGGG - Intergenic
1051630954 9:19140546-19140568 ATGTAGGCTGAACTAACTTTAGG + Intronic
1051890066 9:21932241-21932263 GCTTAGGCCAAGCTAACTTTGGG + Intronic
1051924814 9:22310954-22310976 GCGTAGACAAAGCTAACTTGGGG - Intergenic
1051974629 9:22934711-22934733 GTGTAGGCCAAATTAACTTTGGG + Intergenic
1052074049 9:24118693-24118715 GCGTAGGCTGAACTAACTTTGGG - Intergenic
1052290299 9:26832705-26832727 CTGTAGGCTGAACTAACTTTTGG - Intergenic
1052447091 9:28577042-28577064 GCTTGGGCCAAGCTAACTTTGGG + Intronic
1052545562 9:29873631-29873653 GTGTAGGCCAAACTAACACTGGG + Intergenic
1052729162 9:32265071-32265093 GTGTAAGCCAAGCTAATCATGGG - Intergenic
1053098297 9:35348154-35348176 GTGTAGACCAGGCTAACCTGGGG - Intronic
1053803416 9:41778044-41778066 GCGTAGGCCGAACTAACTTTGGG + Intergenic
1054141847 9:61537080-61537102 GCGTAGGCCGAACTAACTTTGGG - Intergenic
1054191709 9:61989354-61989376 GCGTAGGCCGAACTAACTTTGGG + Intergenic
1054461605 9:65468255-65468277 GCGTAGGCCGAACTAACTTTGGG - Intergenic
1054646661 9:67598358-67598380 GCGTAGGCCGAACTAACTTTGGG - Intergenic
1054725196 9:68642903-68642925 GCATAGGCCGAACTAACTTTGGG - Intergenic
1054775242 9:69119582-69119604 GTGTAGGCGGAACTAACTTTGGG + Intergenic
1054861409 9:69957660-69957682 GCATAGGCAAAGCTAACTATGGG + Intergenic
1055332634 9:75199578-75199600 GTGTGGGCCAAGATAATTTAGGG - Intergenic
1055348768 9:75363436-75363458 GCTTGGCCCAAGCTAACTTTGGG + Intergenic
1055352928 9:75407865-75407887 GCTTAGGCCAAGCTAACTTTGGG + Intergenic
1055410960 9:76028838-76028860 GTGTGGGCCAAACTAAATTTGGG - Intronic
1055468138 9:76585573-76585595 GCATAGGCCAAGCTAACTGTGGG - Intergenic
1055484611 9:76745193-76745215 GTTTAGGCCAAGCTAACTTTGGG + Intronic
1055520891 9:77080113-77080135 GTGTAGGCCAAGCTAACGATGGG - Intergenic
1055813760 9:80181417-80181439 GAGTAGGCCAAGCTAACCATGGG + Intergenic
1055833096 9:80406079-80406101 GCTTGGCCCAAGCTAACTTTGGG - Intergenic
1056213969 9:84391142-84391164 GGGTAGGCTGAACTAACTTTGGG - Intergenic
1056215143 9:84399515-84399537 GCGTATGCCAAGCTAACTTTGGG + Intergenic
1056562358 9:87742719-87742741 GTGTAGGCTGAAGTAACTTTGGG + Intergenic
1056640201 9:88363302-88363324 GTGTAGGCTGAGCTAACTTTGGG - Intergenic
1056641252 9:88372841-88372863 GGGTAGGCTGAACTAACTTTGGG - Intergenic
1056641575 9:88376150-88376172 GGGTAGGCTGAACTAACTTTGGG + Intergenic
1056735590 9:89206790-89206812 GTGTAGGCCAAGCTAACTGTAGG - Intergenic
1056897485 9:90564452-90564474 GCATGGGCCAAGCTCACTTTGGG - Intergenic
1056901797 9:90606853-90606875 GCTTAGGCCAAACTAAATTTGGG - Intergenic
1056964348 9:91153504-91153526 GCATGGGCCAAGGTAACTTTAGG - Intergenic
1057400813 9:94721410-94721432 GTGTAGGCCAAGCTAACCATGGG - Intergenic
1057467420 9:95328097-95328119 GTATAGGCTGAACTAACTTTGGG + Intergenic
1057497719 9:95574109-95574131 ATGTAGGCCAAGCTGGTTTTTGG + Intergenic
1057578105 9:96260464-96260486 GTTTGGGCCAACCTAACTTTGGG + Intronic
1057779673 9:98039399-98039421 GCGTAGGCTGAACTAACTTTGGG + Intergenic
1058048526 9:100383216-100383238 GCTTGGGCCAAGCTAACTTTGGG + Intergenic
1058144239 9:101394074-101394096 GCATAGGCCAAACTAACCTTGGG + Intronic
1058449214 9:105080516-105080538 GCTTAGTCCAAGCTAACTTTGGG + Intergenic
1058982334 9:110181662-110181684 GTGTAGGCCAACCTAACCATGGG - Intergenic
1058992770 9:110270468-110270490 GCATAGGCCAAGCTAACTATGGG + Intergenic
1058997190 9:110311060-110311082 GCATAGGCCAAACTAACTTTGGG - Intronic
1059133268 9:111777416-111777438 GTGTAGGCTGAACTAACCTTGGG - Intronic
1059161969 9:112043038-112043060 GCGTAGGCTGAACTAACTTTGGG + Intronic
1059659681 9:116388587-116388609 GGGTAGGCCAGACTCACTTTGGG + Intronic
1060045658 9:120338116-120338138 ATGTAGGCCAAGCTAACTATGGG - Intergenic
1061089064 9:128416527-128416549 GCGTAGGCTGAACTAACTTTGGG - Intronic
1061555561 9:131366300-131366322 GCTTAGGCCAGGCTAACTTTGGG - Intergenic
1062222298 9:135423402-135423424 GTATGGTCCATGCTAACTTTGGG + Intergenic
1185776113 X:2804281-2804303 GCATAGGCCCAACTAACTTTGGG - Intronic
1185817765 X:3172239-3172261 GCGTAGGCTGAACTAACTTTGGG + Intergenic
1185861923 X:3587841-3587863 GCATAGGCCAAACTAACTTTGGG + Intergenic
1185960100 X:4539683-4539705 GCGCAGGCTAAACTAACTTTGGG + Intergenic
1186036618 X:5429912-5429934 GCATAGGCCAAACTAACCTTGGG + Intergenic
1186071604 X:5826899-5826921 GCATAGGCCGAACTAACTTTGGG - Intergenic
1186079157 X:5911849-5911871 GCACGGGCCAAGCTAACTTTGGG + Intronic
1186115605 X:6302161-6302183 GTGTAGGCTGAACTAACTTTGGG - Intergenic
1186132846 X:6487365-6487387 GCGTAGGCTGAACTAACTTTGGG - Intergenic
1186147876 X:6643872-6643894 GCATAGGCCAAGCTAACTTTGGG + Intergenic
1186153009 X:6695640-6695662 GCATACGCCAAACTAACTTTGGG + Intergenic
1186182010 X:6982777-6982799 GCATGGGCCAAGCTAACTTTGGG - Intergenic
1186209670 X:7236260-7236282 GCATAGGTCAAACTAACTTTGGG + Intronic
1186569013 X:10694880-10694902 GCTTGGGCCAAGCTACCTTTGGG + Intronic
1186807344 X:13153430-13153452 GCATAGGCCAAGCTAACCGTGGG + Intergenic
1187074292 X:15918468-15918490 GTATAGGCTAAGCTAATTTGAGG - Intergenic
1187112724 X:16318108-16318130 GCATAGGCCAAGCTAACCATGGG + Intergenic
1187113025 X:16320910-16320932 GTATGGGCCAAGCTAACTATGGG - Intergenic
1187133407 X:16524757-16524779 GCATGGGCCAAGCTAACTTTGGG + Intergenic
1187161282 X:16767704-16767726 GCATAGGCCAAACTAACTTTGGG + Intergenic
1187208657 X:17207551-17207573 GTGTGGGCAAAGCTAACTTTGGG + Intergenic
1187536645 X:20146979-20147001 GTGTAGGCTGGACTAACTTTAGG + Intergenic
1187616289 X:20997362-20997384 GCATAGGCCAAACTAACTCTGGG - Intergenic
1187841265 X:23491433-23491455 GAATGGGCCAAGCTAACTTTGGG + Intergenic
1188148626 X:26645241-26645263 GCATAGGCCAAACTAACCTTGGG - Intergenic
1188518988 X:31016744-31016766 GTGTAGGCTGAACTAGCTTTAGG - Intergenic
1188686335 X:33074897-33074919 GCTTATGCCAAGCTAACTTTGGG + Intronic
1188881271 X:35494546-35494568 GTGTAGGCCAAACTAGCCTTGGG - Intergenic
1188911613 X:35854773-35854795 GTGTAAGCCAAGCTAACTTTGGG - Intergenic
1189194194 X:39138650-39138672 GTGTGGGCCAAGCTAACTTTGGG - Intergenic
1189415288 X:40807326-40807348 CTGTAGGCCAAACTAACTTTGGG - Intergenic
1189415293 X:40807365-40807387 GCGTAGGCCAAACTAACTTTGGG - Intergenic
1189416771 X:40822220-40822242 GTGTAGGCCAATCTAACTTTGGG + Intergenic
1189419325 X:40842528-40842550 GCATGGGCCAAGCTAACTTTGGG + Intergenic
1189550920 X:42092537-42092559 GCATAGGCCAAACTAACTTTGGG + Intergenic
1189631646 X:42960584-42960606 GTGTAGGCTGAACTAACTGTGGG - Intergenic
1189683599 X:43541395-43541417 GCCTGGGCCAAGCTAACCTTGGG - Intergenic
1189691501 X:43621784-43621806 GCATAGGCCAAACTAACTTTGGG + Intergenic
1189960998 X:46324662-46324684 GCATGGGCCAAGCTAACTTTGGG - Intergenic
1189962835 X:46340764-46340786 ATGTAGGCCAAGCTAACCATGGG - Intergenic
1189967405 X:46389146-46389168 GAATAGGCCAAGCTAACTTTGGG + Intergenic
1190098114 X:47499065-47499087 GCATAGGCCAAGCTAACTATAGG - Intergenic
1190368616 X:49720853-49720875 GTGTAGGCAGAACTAACTTTGGG + Intergenic
1190477569 X:50842994-50843016 GCGTAGGCTGAACTAACTTTGGG - Intergenic
1190478517 X:50851374-50851396 GTGTAGGCTGAACTAACTTTGGG - Intergenic
1190686262 X:52876512-52876534 ACGTAGGCCAAGCTAACTATGGG + Intergenic
1190699304 X:52974919-52974941 ACGTAGGCCAAGCTAACTATGGG - Intronic
1191006575 X:55716524-55716546 GCGTAGGCCGAACTAACCTTGGG - Intergenic
1191127583 X:56974279-56974301 GCATAGGCCAAACTAACCTTGGG + Intergenic
1191741310 X:64438162-64438184 GTGTGGGCCAAGCTAACTTTGGG - Intergenic
1191845113 X:65541330-65541352 GTGTGGGCCAAGCTAACTATGGG + Intergenic
1191845368 X:65543371-65543393 GCATAGGCCGAACTAACTTTGGG - Intergenic
1192338678 X:70243444-70243466 GTGTAGGCTGAACTAACTTTGGG + Intergenic
1192414909 X:70970434-70970456 GCTTAGGCCAAACTAACTTTGGG - Intergenic
1192623008 X:72698786-72698808 GCATAGGCCAAACTAACTTTGGG - Intronic
1192777098 X:74256402-74256424 GTGTAGGCTAAACCAACTTTGGG - Intergenic
1192783960 X:74320218-74320240 GCATAGGCCAAGCTAACTTTGGG - Intergenic
1192804653 X:74498048-74498070 GTATAGGCCAAGCTAACTTTGGG + Intronic
1192812280 X:74557993-74558015 GTGTAGGCCGAAGTAACTTTGGG + Intergenic
1192812376 X:74558753-74558775 ATGTGGGCCAAGCTAACTTTGGG + Intergenic
1193148579 X:78102608-78102630 GTATAGGCCAAACTAGCCTTGGG + Intronic
1193431126 X:81407214-81407236 GTGTAGGCTGAAGTAACTTTGGG - Intergenic
1193700075 X:84749251-84749273 GCATAGGCCAAACTAACTTTGGG + Intergenic
1193849893 X:86524049-86524071 GCATAGGCCAAGGTAAATTTTGG - Intronic
1193910534 X:87300885-87300907 GTGTATGCCAAGCTAACCATGGG - Intergenic
1194051235 X:89071531-89071553 GTATAGGTCAAGCTAACACTGGG - Intergenic
1194051268 X:89071934-89071956 GTGTGGGCCAAGTTAATTTTGGG - Intergenic
1194073775 X:89362018-89362040 GTGTAGGCTGAACTAACTTTGGG - Intergenic
1194089445 X:89566848-89566870 GCATAGGCCAAGCAAACTTTGGG + Intergenic
1194111254 X:89837243-89837265 GTGTAGGCCAAACTAACTTGGGG - Intergenic
1194294359 X:92109802-92109824 GCATAGGCCAAACTAACCTTGGG - Intronic
1194345898 X:92765411-92765433 GAGTAGGCCAAACTATCTTTGGG + Intergenic
1194359905 X:92937404-92937426 GTGTAGGCCGACTTAAGTTTGGG + Intergenic
1194577103 X:95626747-95626769 GTGTAGGCTGAACTAACTTTGGG + Intergenic
1194620097 X:96160646-96160668 GTATAGGTCAAGCTAACTTTGGG - Intergenic
1194621341 X:96176190-96176212 ATCTAGGTCAAGCTAACTTTGGG - Intergenic
1194629199 X:96262834-96262856 GCATAGACCAAACTAACTTTAGG + Intergenic
1194718360 X:97312162-97312184 GCGTAGGCTGAACTAACTTTAGG - Intronic
1194886852 X:99326384-99326406 GCATAGGCCAAACTAACTTTGGG - Intergenic
1194932538 X:99904860-99904882 GTGTAGGCCGAACTAACTTTGGG - Intergenic
1195087063 X:101422740-101422762 GCATAGGTCAAACTAACTTTGGG - Intronic
1195141007 X:101959746-101959768 GCATAGACCAAGCTAACATTGGG - Intergenic
1195220547 X:102742240-102742262 GTGTAGGCCAAACTAACCTTGGG + Intronic
1195722629 X:107880822-107880844 GCTTAGGCCAAGCTAATTTTAGG - Intronic
1196251911 X:113470644-113470666 GTGTAGGCCAAACTTACCTTGGG - Intergenic
1196649059 X:118150245-118150267 GTGTAGGCTGAAATAACTTTGGG + Intergenic
1196727917 X:118913833-118913855 GCTTGGGCCAAGCTAACTTTGGG + Intergenic
1196762931 X:119216018-119216040 GCTTAAGCCAAGCTAACTTTGGG - Intergenic
1197042993 X:121962482-121962504 GCATAGGCTGAGCTAACTTTGGG - Intergenic
1197244178 X:124151179-124151201 CCATGGGCCAAGCTAACTTTGGG - Intronic
1197253003 X:124234311-124234333 GTGTAGGCTGTGCTAACTATAGG + Intronic
1197516688 X:127440895-127440917 ATGTAAGCCAAGCTAACTATGGG + Intergenic
1197568511 X:128118809-128118831 GTGTAGGCTGAACTAACTTTGGG + Intergenic
1197652617 X:129082320-129082342 GTGTAGGCCAAGCTAACCATGGG - Intergenic
1197663144 X:129195174-129195196 GCGTTGGCCAAGCTAACCATGGG - Intergenic
1198190135 X:134295804-134295826 ATTTAGGCCAAGATACCTTTAGG + Intergenic
1198213037 X:134532837-134532859 GCATAGGCCAAACTAACTTTGGG + Intergenic
1198382138 X:136093915-136093937 GTTTGGACCAAGTTAACTTTGGG + Intergenic
1198698509 X:139370007-139370029 GCTTGAGCCAAGCTAACTTTGGG - Intergenic
1199993453 X:153003535-153003557 GCATAGGCCAAACTAACTTTGGG + Intergenic
1200099633 X:153684123-153684145 GCATGGGCCAAGCTAACTTTGGG - Intronic
1200442106 Y:3222901-3222923 GCATAGGCCAAGCAAACTTTGGG + Intergenic
1200463915 Y:3491986-3492008 GTGTAGGCCAAACTAACTTGGGG - Intergenic
1200611865 Y:5334320-5334342 GCATAGGCCAAACTAACCTTGGG - Intronic
1200654246 Y:5882059-5882081 GAGTAGGCCAAACTATCTTTGGG + Intergenic
1200668104 Y:6053225-6053247 GTGTAGGCCGACTTAAGTTTGGG + Intergenic
1200729159 Y:6713576-6713598 GTGTAGGCTGAACTAACTTTGGG - Intergenic
1201293885 Y:12447428-12447450 GCATAGGCCCAACTAACTTTGGG + Intergenic
1201296483 Y:12467609-12467631 GTGTGGGCCAAACTAGCCTTGGG + Intergenic
1201319667 Y:12683956-12683978 GAATAAGCCAAACTAACTTTTGG - Intergenic
1201481353 Y:14442923-14442945 GTATAGGCTGAACTAACTTTGGG + Intergenic
1201516327 Y:14821894-14821916 GCATAGGCCAAGCTAACTTTGGG - Intronic
1201534164 Y:15027457-15027479 GTGTAGGCTGAAATAACTTTGGG + Intergenic
1201559564 Y:15301706-15301728 ACGTAGGTCAAGCTAACTTTAGG + Intergenic
1201578118 Y:15482020-15482042 GGGTAGGCCAAGCCAACTATGGG - Intergenic
1201634184 Y:16104076-16104098 GCATAGGCCAAACTAACCTTGGG - Intergenic
1201750473 Y:17426162-17426184 GCATAGGCTAAACTAACTTTGGG + Intergenic