ID: 1011022852

View in Genome Browser
Species Human (GRCh38)
Location 6:82833599-82833621
Sequence GGTGTAGGCCAAGCTAACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011022852_1011022859 24 Left 1011022852 6:82833599-82833621 CCAAAGTTAGCTTGGCCTACACC No data
Right 1011022859 6:82833646-82833668 CTGTGAGACTAGCAGCAAGATGG No data
1011022852_1011022855 -8 Left 1011022852 6:82833599-82833621 CCAAAGTTAGCTTGGCCTACACC No data
Right 1011022855 6:82833614-82833636 CCTACACCTAGGAATGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011022852 Original CRISPR GGTGTAGGCCAAGCTAACTT TGG (reversed) Intergenic
No off target data available for this crispr