ID: 1011022854

View in Genome Browser
Species Human (GRCh38)
Location 6:82833614-82833636
Sequence CCTTGCTCATTCCTAGGTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011022854_1011022859 9 Left 1011022854 6:82833614-82833636 CCTACACCTAGGAATGAGCAAGG No data
Right 1011022859 6:82833646-82833668 CTGTGAGACTAGCAGCAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011022854 Original CRISPR CCTTGCTCATTCCTAGGTGT AGG (reversed) Intergenic
No off target data available for this crispr