ID: 1011022856 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:82833620-82833642 |
| Sequence | GGCTGTCCTTGCTCATTCCT AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1011022856_1011022859 | 3 | Left | 1011022856 | 6:82833620-82833642 | CCTAGGAATGAGCAAGGACAGCC | No data | ||
| Right | 1011022859 | 6:82833646-82833668 | CTGTGAGACTAGCAGCAAGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1011022856 | Original CRISPR | GGCTGTCCTTGCTCATTCCT AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||