ID: 1011022859

View in Genome Browser
Species Human (GRCh38)
Location 6:82833646-82833668
Sequence CTGTGAGACTAGCAGCAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011022856_1011022859 3 Left 1011022856 6:82833620-82833642 CCTAGGAATGAGCAAGGACAGCC No data
Right 1011022859 6:82833646-82833668 CTGTGAGACTAGCAGCAAGATGG No data
1011022851_1011022859 25 Left 1011022851 6:82833598-82833620 CCCAAAGTTAGCTTGGCCTACAC 0: 12
1: 72
2: 183
3: 479
4: 675
Right 1011022859 6:82833646-82833668 CTGTGAGACTAGCAGCAAGATGG No data
1011022854_1011022859 9 Left 1011022854 6:82833614-82833636 CCTACACCTAGGAATGAGCAAGG No data
Right 1011022859 6:82833646-82833668 CTGTGAGACTAGCAGCAAGATGG No data
1011022852_1011022859 24 Left 1011022852 6:82833599-82833621 CCAAAGTTAGCTTGGCCTACACC No data
Right 1011022859 6:82833646-82833668 CTGTGAGACTAGCAGCAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011022859 Original CRISPR CTGTGAGACTAGCAGCAAGA TGG Intergenic
No off target data available for this crispr