ID: 1011026827

View in Genome Browser
Species Human (GRCh38)
Location 6:82878601-82878623
Sequence CTAGGTCAGGGGTTCTCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011026817_1011026827 -2 Left 1011026817 6:82878580-82878602 CCTCCTCATAAACCCAGTCACCT No data
Right 1011026827 6:82878601-82878623 CTAGGTCAGGGGTTCTCAGTGGG No data
1011026818_1011026827 -5 Left 1011026818 6:82878583-82878605 CCTCATAAACCCAGTCACCTAGG No data
Right 1011026827 6:82878601-82878623 CTAGGTCAGGGGTTCTCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011026827 Original CRISPR CTAGGTCAGGGGTTCTCAGT GGG Intergenic
No off target data available for this crispr