ID: 1011032350

View in Genome Browser
Species Human (GRCh38)
Location 6:82937513-82937535
Sequence TCTTTCCCACACACTGAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 216}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011032350_1011032353 17 Left 1011032350 6:82937513-82937535 CCATGCTCAGTGTGTGGGAAAGA 0: 1
1: 0
2: 1
3: 20
4: 216
Right 1011032353 6:82937553-82937575 GCAGCTCCAGGCAACAGAAGAGG 0: 1
1: 1
2: 3
3: 66
4: 342
1011032350_1011032351 5 Left 1011032350 6:82937513-82937535 CCATGCTCAGTGTGTGGGAAAGA 0: 1
1: 0
2: 1
3: 20
4: 216
Right 1011032351 6:82937541-82937563 GTCCTCTCAGTAGCAGCTCCAGG 0: 1
1: 0
2: 0
3: 14
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011032350 Original CRISPR TCTTTCCCACACACTGAGCA TGG (reversed) Intronic
900358460 1:2276060-2276082 TCTTTGGTTCACACTGAGCAAGG + Intronic
901661707 1:10802240-10802262 TTTTTCCCAAACTCTGAGCTTGG + Intergenic
902373846 1:16021021-16021043 TCCTTCCCACACCCTGTGAATGG - Intronic
903358360 1:22761948-22761970 CCCCTCACACACACTGAGCAAGG - Intronic
903786134 1:25862563-25862585 TCTTTCCCTCTCCCTGGGCAAGG + Exonic
906034898 1:42744325-42744347 CTTTACCCACACACTGAGCTGGG - Intergenic
906867905 1:49442150-49442172 TCTTTCCCACACTGTAAGCTGGG + Intronic
908083686 1:60607973-60607995 TCTTAGCCACTGACTGAGCATGG + Intergenic
911894545 1:103414914-103414936 CATTTCCCACAAACTGAACAAGG + Intergenic
912240563 1:107903561-107903583 TCTTTGCCACACTTTGAGAATGG - Intronic
912454113 1:109786499-109786521 TCTTTCCAACCCACAGATCAAGG + Intergenic
914517261 1:148384508-148384530 CCTTTCCCATACAAAGAGCAAGG + Intergenic
915271935 1:154759582-154759604 TCTCTCCTACACACCCAGCATGG + Intronic
918539085 1:185607793-185607815 AATTTGCCAGACACTGAGCAAGG + Intergenic
918633008 1:186741597-186741619 TCTTTGCCAGATACTGTGCAAGG - Intergenic
920031550 1:203040378-203040400 TCTTCCCCACACACTGGGAAGGG - Intronic
920721931 1:208395746-208395768 TCTGGCCAACACACTGAGAATGG - Intergenic
921924254 1:220698566-220698588 TCTTTCCCACTCACTATGCTTGG - Exonic
922135060 1:222816382-222816404 TTTTTGCCACAAAGTGAGCAAGG + Intergenic
923226103 1:231940178-231940200 TCTTTACCACACACAGAGAGAGG - Intronic
923600664 1:235399883-235399905 TTTTCCCCACACACCAAGCAGGG - Intronic
1064324218 10:14333588-14333610 TCCATCCCACACACTGAGGCAGG - Intronic
1066621182 10:37352663-37352685 TCTCACCCACACACTGTGCCGGG + Intronic
1067524630 10:47030733-47030755 TCTTTCCCAGACACGGAGGTGGG - Intergenic
1069603337 10:69723767-69723789 TCTTTCACACACAGTTATCAGGG + Intergenic
1069803308 10:71097261-71097283 ACTTTCTCACACCCTGAGAACGG - Intergenic
1069808019 10:71138055-71138077 TCAGTCCCAGGCACTGAGCAGGG + Intergenic
1070387885 10:75942316-75942338 TCTTTCCCAAAGCCTGAACAAGG + Intronic
1070710253 10:78676147-78676169 TCTTCCCCAGAGACTGGGCAGGG + Intergenic
1072672250 10:97439040-97439062 TCTTTCTCACAGGCTGGGCAAGG - Intronic
1072786547 10:98286971-98286993 TCTTCCTAACCCACTGAGCATGG - Intergenic
1073038283 10:100579627-100579649 TCCTTCCCACACACTCACCCTGG - Intergenic
1074245004 10:111680840-111680862 CCTTTCCCACACGCTGAATATGG + Intergenic
1075158939 10:120005869-120005891 TGTTTCCCACACACCGAAAATGG - Intergenic
1075941945 10:126397246-126397268 TCTTTCCTAGGCACTGAGCTAGG - Intergenic
1078643456 11:13116848-13116870 TCTATCCCAGACACTGTGCTGGG - Intergenic
1079869940 11:25784639-25784661 ACTTTCCCAAACATTGAGAAGGG + Intergenic
1080381692 11:31778256-31778278 ACTTTCCCTCATACTGAGTAAGG - Intronic
1080600998 11:33820488-33820510 TTCTTCCCACAGAGTGAGCAGGG + Intergenic
1081592910 11:44437411-44437433 TCCTACCCACACCCAGAGCAGGG - Intergenic
1083431852 11:62617298-62617320 ACTGTCCCAGACACTGAGCCTGG - Exonic
1083618518 11:64037679-64037701 TCTTTCCCAGACACAGAGACTGG + Intronic
1084485043 11:69443335-69443357 TCTTTCCCCCAGACTGTTCAGGG - Intergenic
1084595989 11:70117436-70117458 TCTACCCCTCACTCTGAGCATGG + Intronic
1085796019 11:79540705-79540727 CCTTTCCCACACAGGCAGCATGG - Intergenic
1088813861 11:113408735-113408757 TCTTTCACAGACTTTGAGCATGG + Intergenic
1089166715 11:116483133-116483155 CATTTCCCTCACTCTGAGCATGG + Intergenic
1091284601 11:134401625-134401647 TCTTACCCAGGTACTGAGCATGG - Intronic
1091332851 11:134744203-134744225 TCTTCCTCAAGCACTGAGCAAGG - Intergenic
1093110564 12:15146717-15146739 TCTCTCCCAGGCACAGAGCATGG + Intronic
1094498563 12:31004473-31004495 TCTTTCCCTCCCTCTCAGCAAGG + Intergenic
1097166845 12:57090553-57090575 GCTTTCCCACTCAGTGAGCCAGG - Intronic
1098997830 12:77142036-77142058 TGTTTCCCACACAATAAGGATGG + Intergenic
1099654393 12:85470103-85470125 TCTTTCCCAGAGACAGAGCTTGG + Intergenic
1101245933 12:102884485-102884507 TCTTTCCCACCCACACAACATGG + Intronic
1102036997 12:109776411-109776433 TGAATCCCAAACACTGAGCACGG + Intergenic
1103712715 12:122924802-122924824 TCTGTCCCACACAGTGTGCTGGG - Intronic
1104002815 12:124871121-124871143 TCATCCACACACACTGACCAAGG + Intronic
1104526634 12:129530240-129530262 TATTTTCCAAACACTGAGCTAGG + Intronic
1106318773 13:28618925-28618947 TCTCTCACACACACAGAGGATGG + Intergenic
1106620532 13:31367042-31367064 TCTTTCCCACTTGCTGAGAAGGG - Intergenic
1108714294 13:53063764-53063786 TGTTGCCCACACACTGAGAAGGG - Intergenic
1110034789 13:70669445-70669467 TATTTGCCAGACACTGTGCAAGG + Intergenic
1112609777 13:100945136-100945158 TCTTTCACACAAACTGAACAAGG + Intergenic
1112688071 13:101854985-101855007 TCTTTCCTACACAATGGGAAGGG - Intronic
1113702391 13:112397053-112397075 TCTTTCTCACTCACAGAGCTGGG - Intronic
1115361414 14:32507575-32507597 TCCTTCCTACACACGCAGCAAGG + Intronic
1115534697 14:34362201-34362223 CCTTTCCATCACAGTGAGCAGGG + Intronic
1116973594 14:51093792-51093814 GCTTTCCCACACACTGGCCGCGG + Intronic
1117354021 14:54906248-54906270 TTTCTCCCACACACCAAGCAGGG - Intergenic
1118197518 14:63641484-63641506 TCTTTCCCTGAAAATGAGCAAGG + Intronic
1119161683 14:72458125-72458147 CCTCACCCCCACACTGAGCAAGG + Intronic
1119481385 14:74960472-74960494 TATGTCCCAGACACTGAGCAAGG - Intergenic
1121724805 14:96139492-96139514 TCTTTCCAACTCTCTGATCAAGG - Intergenic
1122983500 14:105201963-105201985 TTGTCCCCACACAATGAGCACGG - Intergenic
1125729550 15:41885455-41885477 TATGTCCCACACACTGTGCTAGG - Intronic
1125864236 15:43029416-43029438 TCATTACCAGACAATGAGCAAGG + Intronic
1126256494 15:46632804-46632826 TCTTTCCCCCTCAGAGAGCAAGG + Intergenic
1127789068 15:62382132-62382154 TCATTTCCACAAAATGAGCATGG - Intergenic
1130958834 15:88646421-88646443 GCATTCACACACACTGAGCATGG - Intronic
1131309891 15:91280451-91280473 TCTTCTGCAAACACTGAGCATGG - Intronic
1133026334 16:2990445-2990467 TCTTTCCCAGACACTGAAGGGGG + Intergenic
1133056638 16:3148674-3148696 TATGTGCCAGACACTGAGCAGGG - Intronic
1134440753 16:14298481-14298503 ACTTTCCCAGAGGCTGAGCACGG + Intergenic
1135503399 16:23016247-23016269 TCTGTCCCCAACCCTGAGCAAGG + Intergenic
1136083360 16:27867570-27867592 TCTCTGACACACAGTGAGCAAGG - Intronic
1136579182 16:31141725-31141747 TGTCCCCCACACACAGAGCATGG - Exonic
1137378636 16:47976990-47977012 TCTTTCCCACAGAGTCAGCTAGG - Intergenic
1138108972 16:54308176-54308198 TCCTTGCCACACCCTGAGAAGGG + Intergenic
1138984709 16:62314367-62314389 ACTTTCCCAAACACTGATAAAGG - Intergenic
1139030111 16:62869647-62869669 TTTTTCCCAAACACTGATCTGGG - Intergenic
1141200905 16:81896803-81896825 TCTTTGCCACAAAGTGAGTATGG + Intronic
1141872962 16:86801569-86801591 TCTTTGCCCCAGAATGAGCAAGG - Intergenic
1142901966 17:3017842-3017864 TCTGCCCCACACTCTGGGCATGG - Intronic
1143479735 17:7221386-7221408 TCTTTTCTACACACTGGGGATGG + Intronic
1143562489 17:7704207-7704229 ACCTTCCCAAACACTGAGAATGG + Intergenic
1144838599 17:18171755-18171777 TCTTACCCAGAAACTGGGCACGG - Exonic
1148804792 17:50258770-50258792 TCTTTCCCAAACACTGGAAAAGG + Intergenic
1148904534 17:50903819-50903841 TCTTCCCCAGGGACTGAGCAGGG - Intergenic
1149651455 17:58278900-58278922 CCTTTCCCAGACGCTGAGGAAGG - Intronic
1149779579 17:59386698-59386720 TCTTATCCAAACACTCAGCATGG + Intronic
1150950200 17:69795080-69795102 TCTTTCCCACTCCCTTAGCAGGG - Intergenic
1151193326 17:72414232-72414254 TCTTTGCCAGACAGTGAGCTTGG - Intergenic
1152091491 17:78250036-78250058 GCTTTGTCGCACACTGAGCATGG + Intergenic
1152751033 17:82062475-82062497 TGTTCCCCGCACACTGAGCCTGG - Intronic
1153683687 18:7524669-7524691 TATTACCAACACACTGAGAAAGG - Intergenic
1155038411 18:22044622-22044644 TCTTCCCAACGCACTGAGCTTGG - Intergenic
1155847501 18:30727877-30727899 TTTTTGCCAGACACTGTGCAAGG - Intergenic
1158266712 18:55666978-55667000 TTTGTTCCACACACTCAGCATGG - Intergenic
1158901265 18:61963924-61963946 ATTTTCCCAAACACTGACCAAGG + Intergenic
1159017701 18:63115076-63115098 TTTTCCCCACACACCAAGCAGGG - Intergenic
1160691815 19:463813-463835 TGTTTCCCACACAGTGAACGGGG - Exonic
1163316415 19:16543123-16543145 TCTTTTCCCCACAATTAGCAAGG - Intronic
1164826775 19:31289823-31289845 TCTTTCCCTGACACAGAGGAAGG - Intronic
1164852901 19:31499812-31499834 TTCTTCCCACACAATGAGAAAGG + Intergenic
1165453589 19:35898814-35898836 CCTCTCCCGCACAGTGAGCAGGG - Exonic
1168415046 19:56162387-56162409 TCTTCCCCACACGGTGGGCATGG - Intergenic
925324668 2:3008658-3008680 TCATTCACACACCCTGGGCAGGG - Intergenic
926724574 2:15987288-15987310 TGTCTACCACACACTAAGCATGG + Intergenic
927170287 2:20363645-20363667 TCATTCTCACACACTGCACACGG - Intergenic
927519281 2:23689365-23689387 TCTTGCCCACAGTCTGAGCCAGG - Intronic
928429701 2:31207090-31207112 TCTGTCCCAAACACTGTGCGGGG - Intronic
929517482 2:42616949-42616971 TTTTGCTCACACTCTGAGCAAGG + Intronic
930967994 2:57355346-57355368 TGTTACCCACATAGTGAGCATGG + Intergenic
931917005 2:66967260-66967282 TGTTTACCAGACACTGAGCTAGG - Intergenic
933330194 2:80883670-80883692 TCTTTCACACACACCAAACATGG + Intergenic
934656312 2:96118264-96118286 TCTTTCCCACCCTCTGGGCTGGG + Intergenic
934656505 2:96119193-96119215 GCTTTCCCAGACACATAGCAGGG + Intergenic
935742484 2:106162006-106162028 TCTTTATCACACACTGAGTCAGG + Intronic
938376919 2:130814020-130814042 TCTTTCTCCCACAGTGAGCCTGG + Intergenic
938657221 2:133446886-133446908 TCTTTCCCACCCACTAAATATGG - Intronic
939355074 2:141091116-141091138 TGTTTCCCACACAATGAAGATGG + Intronic
941544212 2:166827212-166827234 TCTTTGCCACACTCTCATCAAGG - Intergenic
942002668 2:171664205-171664227 ATTTTTCTACACACTGAGCAGGG - Intergenic
943382318 2:187166440-187166462 TCTTTCTCAGATACTGACCAGGG + Intergenic
945535555 2:211013344-211013366 TCTTTCCAAAAAACAGAGCAGGG + Intergenic
946323459 2:218968338-218968360 GCATGCCCACACACAGAGCATGG + Intergenic
946661623 2:222007154-222007176 TTTTTCCCCCACACAGACCAAGG - Intergenic
948885001 2:240877987-240878009 TCTCACCCACGCACTGAGCCAGG + Intronic
1169777282 20:9269487-9269509 TCATTCCAACACAGTGAGCAAGG + Intronic
1174665379 20:52253332-52253354 TTTTTCCCCCACACTTAGAATGG + Intergenic
1174723331 20:52836650-52836672 TCTGTCCCAAAGACTGAGTAAGG - Intergenic
1179022843 21:37655929-37655951 TCTTTCCCACACACAGCCCTGGG + Intronic
1179881837 21:44296273-44296295 TGTTTCCCCCACACTGAGATGGG - Intronic
1180124866 21:45783898-45783920 ACTTTCACACACACAAAGCACGG + Intronic
1184600557 22:45540911-45540933 TCTACTCCACACACTGGGCACGG - Intronic
1185419454 22:50727415-50727437 TCATTGCCACACACAGAGCCTGG - Intergenic
950117001 3:10457434-10457456 TCTTTCCCACACACAAAGCACGG - Intronic
955087273 3:55715463-55715485 TCATTCCCACACACTGAACTTGG + Intronic
955685221 3:61542650-61542672 TCCTTCCCTGACACTCAGCATGG - Intergenic
955788800 3:62567352-62567374 TCTTTGCCAGACACTGGGCTAGG + Intronic
955861073 3:63331188-63331210 TCTTCCCAACACACTGATCCAGG + Intronic
956669431 3:71672471-71672493 TCCATCCCACAGCCTGAGCAGGG + Intergenic
957362547 3:79177665-79177687 TCTTTCCCATAAATTGAACATGG + Intronic
958475627 3:94577292-94577314 ACTTTGCCAAACACTGAGCATGG - Intergenic
961212881 3:125139582-125139604 TCTTTCCCACACCCTGAACCTGG + Intronic
962319891 3:134381768-134381790 TCTTCCCCAAACGCTCAGCAGGG + Intergenic
962780862 3:138715109-138715131 TCTTTCCTACACATAGAGAAGGG - Intronic
964790901 3:160452682-160452704 GCTGTCCCAGACACTGAGCCTGG + Intronic
966534561 3:181017094-181017116 TTTTTGCCAAACACTGGGCAAGG - Intergenic
967137738 3:186526724-186526746 ACTTTCCCACTCTCTGACCAGGG - Intergenic
967147348 3:186617335-186617357 TCTTTACCACAAGCTGAGCCCGG - Exonic
970331748 4:14993575-14993597 TCTGTACCAGACACTGTGCAAGG - Intergenic
971352819 4:25868112-25868134 TCTTTCCCCCACCCTGAGCTGGG + Intronic
974535908 4:63174728-63174750 TCCTTCTCACACACCGAACAGGG - Intergenic
975499598 4:75070071-75070093 TCCTTCCCACATACTTAACAAGG + Intergenic
977587982 4:98796184-98796206 TATGTCCCTCACACTGAGCTAGG + Intergenic
978765304 4:112399209-112399231 TCTTTCCCAAACTCTGAACAAGG - Intronic
981619197 4:146674381-146674403 TATTTTTCAAACACTGAGCAAGG - Intergenic
982393115 4:154887099-154887121 TATTTGCCACACACTGTGGAAGG - Intergenic
983680297 4:170345553-170345575 TCTTCCCCAAATACTGAGCCTGG - Intergenic
984154184 4:176174031-176174053 TCTTTCCCACAAGCTCAGTATGG - Intronic
986104451 5:4646249-4646271 TCTCACCCACACAGTGAGCATGG + Intergenic
986233446 5:5886648-5886670 TCTCTCCCACACCCTCTGCAGGG + Intergenic
988652425 5:33167083-33167105 TAATTCCCACACAGTCAGCAAGG + Intergenic
988712129 5:33789177-33789199 TCTCTCACACACACTCAGCAAGG + Intronic
988724245 5:33909867-33909889 TGCTTCCCACACACGGAGAATGG + Intergenic
989141001 5:38201239-38201261 TCTTTCTCATTCACTGTGCATGG - Intergenic
990759965 5:59118088-59118110 TTTTTACCACACACTGTGCCGGG - Intronic
991478497 5:67050108-67050130 TTTGTCCCTCACACTGAGCCAGG + Intronic
997405161 5:133639854-133639876 TCTTTCCCACAAACTCCGAAGGG + Intergenic
999266797 5:150271732-150271754 CCTTTCCAACACACTGACCATGG + Intronic
1000083120 5:157865861-157865883 TCTTTCCCACCAACAGAGTATGG - Intergenic
1001788066 5:174430983-174431005 TTGTTCCCAGGCACTGAGCAGGG - Intergenic
1002953316 6:1837757-1837779 TCTTTCCCACTCACTGGGGAAGG - Intronic
1004084423 6:12430804-12430826 TCTTTCCATCACACTGTGCTTGG - Intergenic
1004602198 6:17161120-17161142 TAATTCCCACTCACTGAGCCAGG - Intergenic
1007154243 6:39726137-39726159 TGTTTCCCACACAATGGTCACGG + Intergenic
1007462015 6:42025850-42025872 TTTTTCACACACACGGAACATGG + Intronic
1007694929 6:43725927-43725949 TCTTTCCACCACTCTCAGCAGGG - Intergenic
1008150495 6:47944775-47944797 TCTTTGCCAAACACTGAGTTAGG + Intronic
1008351782 6:50499797-50499819 TCTTTCCCCCACTCTGTGTAGGG + Intergenic
1010637942 6:78283462-78283484 CAGTTCCCACACACTTAGCAAGG + Intergenic
1011032350 6:82937513-82937535 TCTTTCCCACACACTGAGCATGG - Intronic
1011664570 6:89622062-89622084 AGTTTCCCACCCTCTGAGCATGG - Intronic
1011979000 6:93347760-93347782 TCCTCCACACACACTGAGAAAGG - Intronic
1013738729 6:113258855-113258877 TTTTCCCCACACATTGAGCATGG - Intergenic
1015084448 6:129272049-129272071 TCTTTTCCAAACAATGAGTAAGG - Intronic
1015985785 6:138882766-138882788 TTTCTCCCACACAGTGAGCTGGG - Exonic
1016042595 6:139446586-139446608 TCTGTCCCTCAGACTGAGCCGGG - Intergenic
1016677281 6:146785932-146785954 CCCTTCACACACACTGTGCAAGG + Intronic
1017313667 6:153003053-153003075 TCTTTCCCATGCACTGAGTCGGG + Intergenic
1018658988 6:166067713-166067735 GCTATCCCATAGACTGAGCAGGG - Intergenic
1018658994 6:166067757-166067779 GCTATCCCATAGACTGAGCAGGG - Intergenic
1020692061 7:11368207-11368229 TCTCTCCCACACAATGAGAGAGG - Intergenic
1020780264 7:12509057-12509079 ACTTTTCCACAGACTGAGGAAGG - Intergenic
1020858444 7:13457945-13457967 TCTTTTCCACACAGTGTGCATGG + Intergenic
1021293519 7:18875243-18875265 TTTTTCCCACTCAGAGAGCAAGG - Intronic
1021592639 7:22280417-22280439 CCTTTCCCCCAACCTGAGCATGG - Intronic
1021717948 7:23476664-23476686 TCTTCCTTCCACACTGAGCAAGG - Intergenic
1021843811 7:24744887-24744909 TCTTGCCCACACACACAGCATGG - Intronic
1024538143 7:50455231-50455253 TCCTTCCCAAACTCTAAGCAAGG - Intronic
1028093203 7:86728702-86728724 CATTTGCCACACACAGAGCAGGG + Intronic
1029519339 7:101050288-101050310 TCTGTCCTACACACTGCGCTGGG - Intronic
1037209839 8:16373377-16373399 TCTTTCTCACTCACTGACAATGG + Intronic
1039161170 8:34622830-34622852 TATTTCTCAAACACTGAGCAAGG - Intergenic
1039770768 8:40684581-40684603 TCATTCCCCAACCCTGAGCACGG - Intronic
1040433561 8:47367396-47367418 TCTTTGTGACACTCTGAGCAGGG + Intronic
1043310910 8:78858914-78858936 TCTGTCGCACACCCTGAGAAGGG - Intergenic
1043348324 8:79326460-79326482 TCCTTCCTTCTCACTGAGCATGG + Intergenic
1044335693 8:90982518-90982540 TCTTTTCCAATCGCTGAGCAAGG + Intronic
1047520765 8:125593877-125593899 TCCTTCCCAAACACTGAGAGTGG - Intergenic
1048407999 8:134142562-134142584 TACTTACCACACAATGAGCATGG + Intergenic
1049404501 8:142445887-142445909 TCCTGCTCACACACTGAGCTTGG - Intergenic
1051798907 9:20908869-20908891 AGTATCCCACACACTTAGCATGG - Intronic
1054718878 9:68583954-68583976 TCTTTCCCACTCACTGGATAAGG + Intergenic
1056296685 9:85200369-85200391 TCTTTCCCACAGAGAGAACAGGG - Intergenic
1057829716 9:98397110-98397132 TTTTACCCCCATACTGAGCAGGG + Intronic
1058981084 9:110171306-110171328 CCTTATCCACACACGGAGCATGG - Exonic
1059933494 9:119284400-119284422 TCTTTGCCAAACACAGAGCTAGG - Intronic
1186812099 X:13200356-13200378 ACTTTCCCCCACCCTGAGCTTGG + Intergenic
1187473496 X:19589629-19589651 TTTATGCCACACACGGAGCAAGG - Intronic
1190058791 X:47197794-47197816 AGGTTCCCACACACTGAGCTGGG - Intronic
1190114294 X:47616156-47616178 TCTGTTCCCCACACTGAGCCTGG + Intronic
1192493643 X:71598385-71598407 TCATTCCCACACATAGAGCGGGG - Intronic
1198445807 X:136712865-136712887 TCTTTCCCATGCTCTGAGAATGG - Intronic
1199153525 X:144518735-144518757 TGGTTACCACACACTGGGCAGGG - Intergenic
1200077276 X:153557397-153557419 TGTTGCTCACCCACTGAGCAGGG + Intronic