ID: 1011043546

View in Genome Browser
Species Human (GRCh38)
Location 6:83057380-83057402
Sequence CTGGGGATACAGAGTGAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 356
Summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 327}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011043546 Original CRISPR CTGGGGATACAGAGTGAACA AGG (reversed) Intronic
901091566 1:6645127-6645149 CTGGGGAGACAGAGGGTGCAAGG + Intronic
901880251 1:12189617-12189639 CTGGGAATACACAGAGAGCAGGG + Intronic
902411722 1:16215814-16215836 CTAGGGAGCCAAAGTGAACATGG - Intergenic
902743580 1:18457812-18457834 CTGGGTAGACTGAGGGAACAAGG + Intergenic
902986787 1:20159607-20159629 CTGGGGAGAAAGGGTGAACTGGG - Intergenic
903666657 1:25012106-25012128 CTGGGGACAGAGAATGATCAAGG - Intergenic
903688305 1:25149149-25149171 CTGGGGATTCAGGATGGACAAGG - Intergenic
906210835 1:44011411-44011433 CTGGGGGCACAGAGTGGGCAGGG + Intronic
907196186 1:52688857-52688879 ATGGGGTTACAGTGAGAACATGG + Intronic
909259961 1:73474776-73474798 CTTGGGAAACAGAGTGGGCAAGG + Intergenic
910861008 1:91742309-91742331 CAAGGGATTCAGAATGAACAAGG - Intronic
911326298 1:96473283-96473305 CTGGGGATGAAAAGTGAACCAGG - Intergenic
911387981 1:97201591-97201613 CTGGAGATACATAGTAAATAGGG + Intronic
911973212 1:104462577-104462599 CTGGGGAGAAAGGGTGAACTGGG + Intergenic
913079857 1:115373411-115373433 CTGGTGATACAGAGTGAATCAGG - Intergenic
913275706 1:117136154-117136176 CTGGGAAGACAGAGAGAAAATGG - Intergenic
915233309 1:154462272-154462294 CTGAGGATACAGAATAATCATGG - Intronic
915664251 1:157430417-157430439 CTGGGGAAAGAAAGAGAACATGG + Intergenic
916167689 1:161978368-161978390 CTGGGGATACAGAAGGCAGAGGG - Intergenic
916375851 1:164152503-164152525 CTTGGGCGACAGAGTGAAAAAGG - Intergenic
916838415 1:168574417-168574439 CCGGGGATCCAGAGATAACAAGG + Intergenic
918106779 1:181422262-181422284 CTGGGGATATGGAGTGAACGAGG - Intronic
918223564 1:182457850-182457872 CTGGGGATACAAATTACACAGGG - Intronic
918256859 1:182756479-182756501 ATGGGGATAAAGAATGAAGATGG + Intergenic
919504362 1:198379556-198379578 CTGAGGATATAAAGTGAAGAAGG + Intergenic
919973410 1:202595259-202595281 CTGGGGACAAAAGGTGAACAGGG + Exonic
921633915 1:217468800-217468822 GTGGGGATACAGATGAAACAGGG + Intronic
921746812 1:218749699-218749721 CTGGGGAGAAAGGGTGAACTGGG + Intergenic
923087291 1:230711296-230711318 GTGGGGACACAGAGAGAAGACGG + Intronic
923152520 1:231246395-231246417 CTGTGAATACAGCATGAACAAGG - Intronic
923582190 1:235228427-235228449 CTGGGGCTACTGAGTGCACTGGG + Intronic
1063309740 10:4940991-4941013 CTGAGGCTACAGAGAGAACAGGG + Intronic
1063317551 10:5021110-5021132 CTGAGGCTACGGAGAGAACAGGG - Intronic
1063324081 10:5079739-5079761 CTGAGGCTACAGAGAGAATAGGG - Intronic
1063901870 10:10741731-10741753 GTGGAGATACTGAGTGGACAAGG - Intergenic
1064274777 10:13895460-13895482 GTGGGGATACAGTGAAAACATGG - Intronic
1065214397 10:23436726-23436748 ATTGAGATACAGAGTGGACAAGG + Intergenic
1065380317 10:25083653-25083675 CTGAGGTTCCAGAGAGAACAGGG - Intergenic
1068092187 10:52445943-52445965 CTGGCTATACAGAGTTAACTTGG - Intergenic
1070810859 10:79297471-79297493 CTGGGTATATTGAGTGAGCAGGG - Intronic
1073040268 10:100599384-100599406 CTAAGGATAAAGAGTGAACCAGG - Intergenic
1073208382 10:101780477-101780499 CTGAGGATAGACAGAGAACAGGG - Intergenic
1073930474 10:108568265-108568287 GTGGGGCAACAGAGTGAAGAAGG - Intergenic
1074300716 10:112231258-112231280 TTGAGGATACAGTGAGAACAAGG + Intergenic
1074723716 10:116286060-116286082 CTGGGGATACAACAAGAACATGG - Intergenic
1074843770 10:117378950-117378972 CCAGGGATACTGAATGAACAGGG + Intergenic
1076260445 10:129060750-129060772 TTGGGGAAGCAAAGTGAACAAGG - Intergenic
1076681736 10:132175768-132175790 CTGTGGATACATCCTGAACAGGG - Intronic
1077046578 11:549350-549372 CTGTGGCTACAGTGGGAACAGGG + Intronic
1077161037 11:1113011-1113033 CTGGTGATGCAGCGTGGACACGG + Intergenic
1077493268 11:2871852-2871874 CTGAGGTGGCAGAGTGAACAGGG - Intergenic
1077588884 11:3476374-3476396 CTGGGGAGAAAGGGTGAACTGGG + Intergenic
1077673668 11:4179751-4179773 CTTGGGAAACTGAGTGTACAAGG + Intergenic
1079274907 11:19026298-19026320 CTGGAAAGACAGAGTAAACATGG - Intergenic
1079281747 11:19093522-19093544 CTGGGGACATGGAGTTAACAGGG - Intergenic
1079400507 11:20103059-20103081 CAGGGGATGCAGAGTGGGCATGG - Intronic
1081373892 11:42337025-42337047 GTGGGGATACAGTGAGAAGATGG + Intergenic
1081413321 11:42785238-42785260 CTGGGGGCAAAGAGTGACCAGGG + Intergenic
1084828102 11:71746566-71746588 CTGGGGAGAAAGGGTGAACTGGG - Intergenic
1084935032 11:72582340-72582362 CTGGGAAGACAGAGTCATCAAGG - Intronic
1085012949 11:73154002-73154024 CTGGGGATACAGAGACAATTTGG - Intergenic
1085340177 11:75726206-75726228 CTGGGGAAAGAGAGTGGCCAAGG + Intronic
1085444149 11:76589562-76589584 CTGGGGATACAGCGTGACAAAGG + Intergenic
1086130259 11:83394026-83394048 CTGGGCTTACAGAGTGAAATGGG + Intergenic
1086803053 11:91201572-91201594 CTGTGGATACACACTAAACATGG - Intergenic
1086806835 11:91254350-91254372 CTGGAGATAGAGAGTGATGATGG - Intergenic
1087825338 11:102758292-102758314 CTGAGGCTACTGAGTGAACTAGG - Intergenic
1088769431 11:113018597-113018619 TTGGGCATACTGAATGAACAAGG - Intronic
1089216519 11:116837565-116837587 CTGGGGAGCCAGAGTGACCGGGG + Intronic
1089694194 11:120206598-120206620 GTGGGGATACTGAGTGGAAAGGG - Intergenic
1089942494 11:122433434-122433456 ATGGGAATACAGAGAGAAGAGGG + Intergenic
1090264393 11:125344876-125344898 TTCAGGACACAGAGTGAACAAGG + Intronic
1090927564 11:131262026-131262048 CTGGGGATACAGAATGAATAAGG + Intergenic
1091853139 12:3717099-3717121 CTGGGCTTAGAGAGTGAATAGGG + Intronic
1092415142 12:8285139-8285161 CTGGGGAGAAAGGGTGAACTGGG + Intergenic
1092938135 12:13383049-13383071 CTAGGGATACAGAGTGTAAAAGG - Intronic
1093017847 12:14172301-14172323 CTGGGGATACAAAGATAAGATGG - Intergenic
1094069799 12:26400781-26400803 CAGGGGAGAGAGCGTGAACAAGG + Intronic
1095487863 12:42703231-42703253 CTGGGGAGGCTGAGGGAACAAGG + Intergenic
1097307151 12:58081754-58081776 CTGGTGACACAGAGGTAACAAGG + Intergenic
1098181864 12:67855810-67855832 CTGAGGACACAGGGTAAACAAGG - Intergenic
1098828773 12:75332891-75332913 CAGGGGATATAGAATGATCAGGG + Intronic
1100231527 12:92613262-92613284 CTGGGGACATGCAGTGAACAAGG - Intergenic
1100527241 12:95431356-95431378 TTGTGGAGACAGAGTGAAGAGGG + Intergenic
1103014478 12:117483024-117483046 CTGGGGAGTCAGAGGGAAGAAGG + Intronic
1103024387 12:117561936-117561958 CTGGAGATTCACAATGAACAAGG + Intronic
1104293072 12:127486737-127486759 CTGGGGAGAAAGGGTGAACTGGG - Intergenic
1104318859 12:127731189-127731211 CTGTGGATGCAGAGTGAGCAAGG - Intergenic
1104328150 12:127819498-127819520 CTGGGGCTCCAGAGTGACCTGGG + Intergenic
1104616437 12:130273694-130273716 CTGTGGATACAGAGGGTACATGG - Intergenic
1105607665 13:21940133-21940155 TTGGGGATACAGAGGGGGCATGG + Intergenic
1105617770 13:22035567-22035589 CTGGGAAATCAGAGTGAAGAAGG - Intergenic
1107423279 13:40269427-40269449 CTGGGCAAACAGACTGGACAAGG + Intergenic
1107850993 13:44573669-44573691 CTGGGGAGGCACAGTTAACAAGG + Exonic
1110282011 13:73704807-73704829 CTGGGGATACAGTGGTAAGAAGG - Intronic
1110357426 13:74584139-74584161 CTGGGAATACAGAGTGAAGCGGG + Intergenic
1110709326 13:78632746-78632768 TTGGTGATGCAGAGTAAACAAGG + Intronic
1112212182 13:97388720-97388742 CTGGAGATATAGACAGAACAGGG - Intronic
1114920055 14:27314737-27314759 CTGTGAATACATAGTGAGCATGG + Intergenic
1115499935 14:34040391-34040413 GTGGGGATACAAAGAGAAGATGG + Intronic
1116721038 14:48495820-48495842 TTGCTGATACAGAATGAACAAGG - Intergenic
1117313472 14:54551267-54551289 CTGGGGAAACAAAGTGAAGTTGG - Intergenic
1120081296 14:80219373-80219395 CTGGGGCTACAGATAGAAAACGG - Intronic
1120142591 14:80945184-80945206 CTGAGGATACAGAGAAAAGATGG - Intronic
1120299476 14:82688166-82688188 CTGGTGAGACAGAATGAAGAAGG + Intergenic
1121583110 14:95045335-95045357 CTGGGGAGACAGTGTGAACAAGG - Intergenic
1121709464 14:96026843-96026865 CTGAGGGTGCAGAGGGAACATGG + Intergenic
1121910161 14:97782795-97782817 CTGTGGATACAGAGAGTAAATGG + Intergenic
1122099742 14:99398251-99398273 TTGGGGATACAGCGTGAAGGTGG - Exonic
1122393717 14:101407965-101407987 CTGGGGGTACAGAGAGAAATTGG - Intergenic
1123773518 15:23554021-23554043 GTGAGGATACAGAGAGAAGATGG + Intergenic
1127386076 15:58468253-58468275 CTGGGGAAGCAGAGAGAGCAAGG - Intronic
1127990523 15:64112152-64112174 CTGAGGCTACAGAGTAAGCATGG + Intronic
1130515119 15:84620604-84620626 TTTGAGATACAGAGTGAAAATGG + Exonic
1131321182 15:91392758-91392780 CTGGGAATACAGGGTGGAAATGG + Intergenic
1132100819 15:99021749-99021771 CTGGGGATATAGAATGCAAAAGG - Intergenic
1132154371 15:99485403-99485425 CTGGGGACTCAGAGTGTCCATGG + Intergenic
1132503593 16:296131-296153 CTGGGGCTCCCGAGGGAACAGGG - Intronic
1132785695 16:1656099-1656121 CTGGGCATCCAGAGTGGGCAGGG + Exonic
1133002993 16:2860465-2860487 CTGGGGAAACAGTGTGGGCAGGG + Intergenic
1133837313 16:9378517-9378539 CTGTGGATAAAGAGTTAACAAGG + Intergenic
1134295595 16:12942693-12942715 CTGGGTAAACAAAGTGAAAAGGG - Intronic
1135029915 16:19030105-19030127 CTGGGGATACAGAGAGGAAAGGG + Intronic
1135939828 16:26812917-26812939 GTGTGGATACAGTGTGGACATGG + Intergenic
1136655519 16:31706874-31706896 CTGGGGCTGCAGAGGGACCAGGG - Intergenic
1137405474 16:48185818-48185840 CAGGGGCCACAGAGTGACCAGGG - Intronic
1138869044 16:60858615-60858637 CTGGGAATAAAGAGTAAGCAAGG + Intergenic
1139633450 16:68244546-68244568 CTGGGGAACCAGAGAGGACATGG - Intergenic
1140302682 16:73773481-73773503 CTGGGGATAAGCAGTGAATAAGG + Intergenic
1140846273 16:78891394-78891416 CAGGGAATACAGAGTTAAAAAGG + Intronic
1145258189 17:21339086-21339108 CTGGGGCTGCAGGGTGCACAGGG + Intergenic
1145318446 17:21748920-21748942 CTGGGGCTGCAGGGTGCACAGGG - Intergenic
1145864689 17:28233343-28233365 CTGGGGAGAAAGGGTGAACTGGG + Intergenic
1145866025 17:28242177-28242199 CTGAGGTCACAGAGTGAACGAGG - Intergenic
1147273832 17:39298224-39298246 CTTGGGATACTGAGTGAAGTAGG - Intronic
1148989050 17:51649587-51649609 CTGGTGATAGAGTGTGAAAAGGG + Intronic
1150675950 17:67245816-67245838 CGCGGGACACAGAGTAAACAAGG - Intronic
1151560391 17:74866636-74866658 CTGGGGACACAGAGTGGTGAGGG - Intronic
1151562445 17:74877935-74877957 CAGGGGGCACAGAGAGAACAGGG - Exonic
1152272466 17:79332879-79332901 ATGGGGAGACAAAGAGAACAGGG + Intronic
1152431315 17:80249546-80249568 CTGGGGACACACAGTGAACGAGG + Intronic
1152549033 17:81020084-81020106 GTGGGGATACGGAGGGACCATGG + Intergenic
1155517843 18:26640889-26640911 TTGGGGACACAGAGAGGACAAGG + Intronic
1155620085 18:27768516-27768538 CTGGGGACACACAGTAAACTTGG - Intergenic
1156371053 18:36471434-36471456 CTGTGGACACAGGGTGACCAAGG - Intronic
1158132356 18:54166763-54166785 CTGGGGCTACTAAGTGACCATGG - Intronic
1159579427 18:70218612-70218634 CTGAGGACACAGAGAGAAGATGG - Intergenic
1159922445 18:74238009-74238031 CTGGGGATACATGATGATCAAGG - Intergenic
1160327865 18:77967347-77967369 CTGGGCACACAGAGTCACCAAGG + Intergenic
1160361984 18:78291099-78291121 CTGGAGATACATAGTGATGATGG - Intergenic
1161616601 19:5274345-5274367 CTGGGGATACAGTGGAAAGAAGG + Intronic
1162084239 19:8238734-8238756 CTGGGGATACCCAGGGGACATGG + Intronic
1162633071 19:11944095-11944117 CTGGGGAGAAAGGGTGAACTGGG + Intronic
1162833331 19:13300331-13300353 CTGGGGATACAGCATTAACAAGG - Intronic
1162966410 19:14158281-14158303 CTGGGAACACAGAGGGTACAGGG + Intronic
1163184016 19:15623780-15623802 CTGGGGCTACAGTGGGGACAGGG + Intronic
1163432010 19:17273881-17273903 CTGGGGAGGCAGAGAGTACAGGG - Intronic
1163966217 19:20749662-20749684 CTGGGGAGAAAGGGTGAACTGGG + Intronic
1163989256 19:20983139-20983161 CTGTGGACACAGAGTAAAGAAGG - Intergenic
1164727515 19:30476184-30476206 CTGGGGCCACAGAGGGAAGAAGG - Intronic
1165318045 19:35068645-35068667 CTGGGGACTCTGAGAGAACATGG + Intergenic
1165412877 19:35673209-35673231 CTGGGGAGACAGAGGGAGGACGG - Intronic
1166214317 19:41325589-41325611 CTGGGGACACGGAGTGGAAAAGG - Intronic
1167001701 19:46749088-46749110 TTGAGGATACAGAATGAACGAGG - Intronic
1167096905 19:47379526-47379548 CTGGGGATACGGCATGAACAAGG - Intronic
1167942714 19:52960639-52960661 CCGGGGAGAAAGAGTGAACTGGG - Intronic
1168061489 19:53895106-53895128 CTGGGGATATAGAGAAAGCAGGG + Intronic
1168111854 19:54196869-54196891 CTGGGGATACTGCATGAACAAGG - Intergenic
926158152 2:10469464-10469486 CTGGTGCTCCAGAGTGCACAAGG - Intergenic
926847300 2:17155926-17155948 GAGGGGAAACAGAGTCAACATGG - Intergenic
926946501 2:18193301-18193323 TAGGGGAGACAGAGTGAAAATGG + Intronic
929028387 2:37627357-37627379 CAGGGGATACAGGGAGAACTAGG + Intergenic
929928928 2:46237271-46237293 CTAGGAATTCAGTGTGAACAGGG + Intergenic
930394777 2:50807562-50807584 CTGGGGAAACACTGTTAACAAGG - Intronic
930518705 2:52436684-52436706 CTGGGGAGAAAGGGTGAACTGGG - Intergenic
932428673 2:71660078-71660100 CTGGGGCTGCAGAGTGCCCAGGG - Intronic
936089578 2:109492346-109492368 CTGGGGCTCCAGAGTGGACAGGG + Intronic
936148397 2:109996956-109996978 ATGGGGATACAGAGAGAAAGAGG + Intergenic
936196280 2:110374412-110374434 ATGGGGATACAGAGAGAAAGAGG - Intergenic
936596946 2:113857133-113857155 ATGAGGATACAGGGTGAAGATGG + Intergenic
937090698 2:119204539-119204561 CTGGAGAGACAGGGAGAACAGGG + Intergenic
938659567 2:133471651-133471673 CTTTGGATACACAGTTAACATGG + Intronic
939062221 2:137436033-137436055 TTGGGGATACAGACTGAAAGGGG - Intronic
940805396 2:158181405-158181427 CTGGTGATACAACGTCAACATGG + Intronic
941110487 2:161415212-161415234 CTGGGGAGACAGAGTGGAAGTGG - Intergenic
943704846 2:191023485-191023507 CAGGGGAAACAGAGAGAACATGG + Intergenic
945780842 2:214169848-214169870 CTGGGGATAAAAAGGGAAAACGG + Intronic
945942668 2:215965470-215965492 CAGGGGATACAGAGGGAGGAAGG + Intronic
946150001 2:217758024-217758046 GTGGGGATACAGTGAGAAGATGG + Intergenic
948652763 2:239458825-239458847 CTGGGGATTCAGTTTCAACATGG + Intergenic
1171793738 20:29550630-29550652 CTGGGAATCCAGGGTGAAGAAGG - Intergenic
1172650180 20:36497076-36497098 CTGAGGACACAGAGTGCAAAAGG - Intronic
1172834275 20:37863009-37863031 CTGAGGAGACACAGTGAACAAGG - Intronic
1174986027 20:55452820-55452842 CTGAGGAGACAGAGAGAACTGGG + Intergenic
1175039198 20:56029863-56029885 CTGTGGATACAGAGAAAAGATGG + Intergenic
1175708238 20:61197285-61197307 CTGGGGAGAGAGAGTGCAGAGGG - Intergenic
1175902123 20:62364072-62364094 CTGGGGACACAGCGGGAATAAGG - Intronic
1176079636 20:63265776-63265798 CTGGGGAAACTGAGTCCACATGG + Intronic
1177233944 21:18361503-18361525 TGGAGGATACTGAGTGAACAAGG + Intronic
1181317403 22:21979468-21979490 CTGGGGACTCAGAGTCCACATGG - Intronic
1181682717 22:24506918-24506940 CTGGCAATACAGAGTGGTCAGGG - Intronic
1183726707 22:39594003-39594025 CTGGGGAGACACACTGAAGATGG + Intronic
949386008 3:3502992-3503014 CTGGGGAAACCTGGTGAACATGG - Intergenic
949402326 3:3678821-3678843 CTGGGGAAAGAAAGTGAACTGGG + Intergenic
949596129 3:5549026-5549048 CAAGGGATACAGAGGAAACATGG + Intergenic
952062926 3:29532398-29532420 TGGGGGAAACTGAGTGAACAGGG + Intronic
952387007 3:32849074-32849096 CTGGGGGTACTAAGTGGACAGGG + Intronic
952859948 3:37804629-37804651 CTGGGGACACAGTGGAAACAAGG - Intronic
953616708 3:44497044-44497066 CTGGGGATGGAAAGAGAACAGGG + Intergenic
957022655 3:75142111-75142133 CTGGGGAGAAAGGGTGAACTGGG - Intergenic
959442009 3:106388605-106388627 CTGGGTATTCAGAGAGACCATGG - Intergenic
965682479 3:171265746-171265768 CTGGGGAAACAGAGGGAAAGTGG + Intronic
969147707 4:5138787-5138809 CTGAGGATGTAGAGAGAACAAGG + Intronic
969186345 4:5477581-5477603 ATGGACATACAGCGTGAACAAGG - Intronic
969377250 4:6771144-6771166 CTGGGCATACAGCAAGAACATGG + Intergenic
969525207 4:7700776-7700798 GTGGGGATTCAGAGTTAACCTGG - Intronic
970550728 4:17178396-17178418 CAGAAGTTACAGAGTGAACAGGG + Intergenic
970559976 4:17273143-17273165 CTGAGGCTGCAGAGAGAACAAGG + Intergenic
971789427 4:31149286-31149308 CTTAGGAAACAGAGTGAATAGGG + Intergenic
974466059 4:62258087-62258109 CTGGAGACACAGAGAGAAAATGG - Intergenic
975230498 4:71927145-71927167 CTGGGGATACAGACTAGAAAAGG - Intergenic
975394189 4:73855786-73855808 ATGGGGAGAGAGAATGAACAAGG + Intergenic
976434023 4:84995996-84996018 TAGAGGATACAGAGAGAACAGGG + Intergenic
976515992 4:85967059-85967081 ATGGGGATAGAGAATGAGCAAGG + Intronic
979017654 4:115454571-115454593 ATGGGGAGACAGAGAGAAAAGGG + Intergenic
980483295 4:133418695-133418717 CTGGTGATACAGTGATAACAAGG + Intergenic
980766550 4:137313710-137313732 CTGGGGAGACATAATGAACTTGG + Intergenic
981093921 4:140759357-140759379 CTTGGAATAAAAAGTGAACAAGG + Intergenic
981551761 4:145948646-145948668 CTGGGGATAGAGCCTGAAGAAGG - Intergenic
982184373 4:152780595-152780617 CTGGGGATGCAGGGAGAAGAGGG - Intronic
982998482 4:162381613-162381635 CTGGGGCTTCCGACTGAACATGG + Intergenic
985282367 4:188300119-188300141 CTGAGGAAGCAGAGGGAACAGGG - Intergenic
986064920 5:4225883-4225905 CTAGGGACACAGAGAGAACACGG - Intergenic
986465756 5:8021282-8021304 CTGGAGATTCAGAATGAGCAAGG - Intergenic
986570475 5:9159309-9159331 CTGAGGATACAGACTGAAACAGG + Intronic
986750743 5:10785412-10785434 CAGGGGAAACAGATAGAACAGGG + Intergenic
987970570 5:24938890-24938912 CTAGGGATAGAGAGAGAACAGGG - Intergenic
991441055 5:66649776-66649798 CTGTGGATTCAGAGTGAAACAGG - Intronic
992987686 5:82250475-82250497 GTGGGGATACAGTGAGAAGATGG - Intronic
993328026 5:86566131-86566153 CTGGGGAGAAAGGGTGAACTGGG + Intergenic
993364400 5:87018992-87019014 CTGGGCTTACAGAGTGGGCAGGG - Intergenic
993461612 5:88189584-88189606 CTGGGGAGAAAGGGTGAACTGGG + Intergenic
994549468 5:101212333-101212355 ATGGGTATCCAGATTGAACAAGG + Intergenic
995652999 5:114392443-114392465 CTGGGTGGCCAGAGTGAACAGGG + Intronic
997202239 5:132017978-132018000 CTGGAGAGAGAGAGAGAACAGGG + Intergenic
997835658 5:137191030-137191052 CTGGGGATACAGAATGTTCCTGG + Intronic
998190437 5:140019298-140019320 CTGGGGTTATGGAGTGACCAAGG - Intronic
999277802 5:150343399-150343421 CTGGGGATCCCAAGTGAAAAAGG - Intergenic
999701634 5:154233738-154233760 CTGAGGATACAGGGTAGACAGGG + Intronic
1000440786 5:161260632-161260654 CTGGGGAAACAGAATAAAAATGG + Intergenic
1000760383 5:165216249-165216271 CTGAGGAAACAGAGTGAAGCAGG + Intergenic
1000897302 5:166871185-166871207 CTTGGTTGACAGAGTGAACAAGG - Intergenic
1001756131 5:174171719-174171741 CTGAGGATGGAAAGTGAACAAGG + Intronic
1001847936 5:174938061-174938083 CTGGGGATACAGAGGGGATGAGG - Intergenic
1001874671 5:175189208-175189230 CTGGGCTAACAGAGTGAAAATGG + Intergenic
1003240372 6:4340347-4340369 CTGGGGACACAGAATAAACTGGG + Intergenic
1003379574 6:5611212-5611234 GTGAGGATACCAAGTGAACAGGG + Intronic
1004816450 6:19316286-19316308 GTGAGGATACAGAGAGAAGACGG + Intergenic
1005442668 6:25887427-25887449 GTGGGGATACAGGGAGAAGACGG - Intergenic
1006104869 6:31710462-31710484 CTGGGGATGGAGAGGAAACACGG + Intronic
1006677066 6:35771935-35771957 TTGGGGATACAGATTGGAGATGG - Intergenic
1006845245 6:37056978-37057000 CTGGGGCTACAGAGTGAACCAGG + Intergenic
1007166019 6:39829725-39829747 CTAGGGATGCAGACTGAACCTGG + Intronic
1007838847 6:44699028-44699050 CTGGGTTTACAGAATGGACAAGG - Intergenic
1008011523 6:46472667-46472689 CTAGAGATACAATGTGAACAAGG - Intronic
1010880565 6:81164173-81164195 GTGGGGATATTGAGTGAAAAGGG - Intergenic
1010977583 6:82333214-82333236 GTGGGGAGAGAGAGAGAACAAGG - Intergenic
1011031555 6:82929793-82929815 GTGTGGATACAGAGGGAATATGG - Intronic
1011043546 6:83057380-83057402 CTGGGGATACAGAGTGAACAAGG - Intronic
1011687247 6:89833322-89833344 CTGGGGATACAGTGAGAGCTGGG + Intronic
1012611535 6:101225983-101226005 CTGGGGAGAAAGGGTGAACTGGG + Intergenic
1013482055 6:110561407-110561429 CTGGGAACACAGCATGAACAAGG + Intergenic
1014007773 6:116440928-116440950 CAGGGAATACACAGCGAACAGGG - Exonic
1014020057 6:116576541-116576563 CTGGGGAGCCAGATAGAACAGGG - Intronic
1014143644 6:117971801-117971823 CTGGGGCTACATAGAGGACAGGG + Intronic
1014330658 6:120059851-120059873 CTGGTGATAGAAAGTGAAGAGGG + Intergenic
1018596102 6:165482344-165482366 CTGGGGATAGAGAAGGAAGAGGG + Intronic
1019013004 6:168857634-168857656 CTGGGGATAGAGGGAGGACAAGG + Intergenic
1019917861 7:4144956-4144978 CTGGAGCTGCAGAGTTAACAAGG + Intronic
1020139232 7:5603677-5603699 CTGGGGCTACCAAGTGACCACGG - Intronic
1020188493 7:5976365-5976387 CTCGGGACACAGAGGTAACAAGG - Intronic
1020294422 7:6748405-6748427 CTCGGGACACAGAGGTAACAAGG + Intergenic
1020322913 7:6953250-6953272 CTGGGGAGAAAGGGTGAACTGGG + Intergenic
1021580510 7:22148047-22148069 CTGGGGATACAGAGACAAAGTGG - Intronic
1024062685 7:45710589-45710611 CTGGGGAAACACAGTCAACGTGG + Exonic
1024303865 7:47909853-47909875 CTGGGGAAGAATAGTGAACATGG + Intronic
1026154775 7:67817444-67817466 ATGAGGATACAGAGAGAAGATGG - Intergenic
1029481575 7:100816669-100816691 CTGGGGGTACAGAGTGAAGCAGG + Intronic
1030065240 7:105654368-105654390 TTGGGGATAGAGATTAAACACGG - Intronic
1031221341 7:118969827-118969849 TTTGGGATACATGGTGAACAGGG - Intergenic
1031911007 7:127516624-127516646 ATGGGGGTACACTGTGAACAAGG - Intergenic
1032079413 7:128851209-128851231 CTGGGGATACAGAGAAAAAGGGG - Intronic
1032377266 7:131433076-131433098 CTGGGGTTGCAGAGTGACAAGGG - Intronic
1032428966 7:131845324-131845346 CTCAGGATACATGGTGAACAAGG - Intergenic
1033982813 7:147187118-147187140 CTGGGGAGAAAGAATGAACATGG + Intronic
1036226146 8:6959402-6959424 CTGGGGATACAGAGAGCATCAGG + Intergenic
1036373149 8:8177732-8177754 CTGGGGAGAAAGGGTGAACTGGG - Intergenic
1036877755 8:12487909-12487931 CTGGGGAGAAAGGGTGAACTGGG + Intergenic
1037422949 8:18723592-18723614 CTGGAGATACAGAAGGAACAGGG - Intronic
1037587995 8:20291170-20291192 ATGGAGATCCAGAGTGATCAAGG + Intronic
1037723892 8:21467466-21467488 CAAGGGATTCAGAGTGAGCATGG - Intergenic
1037949696 8:23010846-23010868 ATGAGGACACAGAGTGAAGAAGG + Intronic
1039438947 8:37581394-37581416 CTGGGGGCACAGAAGGAACATGG - Intergenic
1039858518 8:41436815-41436837 CTGGGTATAAAGAGAGAAGAAGG + Intergenic
1041740998 8:61156305-61156327 CTGAGGTTACAGAATGAATAGGG - Intronic
1043842004 8:85117435-85117457 CTTGGGGTAAAGAGTAAACATGG + Intronic
1044160354 8:88906040-88906062 TTTGGGATACAGAGAGTACAAGG + Intergenic
1045968515 8:108054107-108054129 CTGGTGATACAATGTAAACAAGG + Intronic
1047388922 8:124434153-124434175 ATGGGGATGCAGAGGAAACAAGG - Intergenic
1047779035 8:128096944-128096966 CTGGGGAGGCAGAGGAAACATGG - Intergenic
1048477162 8:134754097-134754119 CTGGGGAAGCAGGGTGAAAAAGG + Intergenic
1048579178 8:135716789-135716811 CTGCAGACACACAGTGAACAAGG - Intergenic
1049503130 8:142978725-142978747 CTGGAGAGACAGAGGGGACATGG + Intergenic
1049623828 8:143611337-143611359 CAGGGGATACACTGTGAACGAGG + Intergenic
1051689444 9:19694855-19694877 CATGGCATACAGAGTGAAAATGG + Intronic
1053455826 9:38232583-38232605 CTGGGGATTTAGAGTGATCTTGG - Intergenic
1053470575 9:38343413-38343435 CTGAGGATGCAGAGTGATGATGG - Intergenic
1053662144 9:40291471-40291493 CTGGGGATGCAGAGAGAGGAGGG - Intronic
1053912590 9:42921639-42921661 CTGGGGATGCAGAGAGAGGAGGG - Intergenic
1054374270 9:64437712-64437734 CTGGGGATGCAGAGAGAGGAGGG - Intergenic
1054522466 9:66084813-66084835 CTGGGGATGCAGAGAGAGGAGGG + Intergenic
1054704217 9:68446387-68446409 CTTAGGATAGAGAGTGAATAGGG + Intronic
1055563700 9:77547219-77547241 GTGGGGAAACACAGTGAAAAAGG + Intronic
1055686993 9:78786010-78786032 CTGGGAGTCCAGAATGAACAAGG + Intergenic
1056295807 9:85192018-85192040 CTGGGAATACAGTGTGAACAAGG + Intergenic
1056408800 9:86303970-86303992 CTGGGAGTACAGAGGGAATAGGG + Intronic
1057009229 9:91586926-91586948 TATGGGATACTGAGTGAACAAGG - Intronic
1057754171 9:97818108-97818130 CTGGGGAGGTAGAGTGGACATGG + Intergenic
1057951234 9:99370404-99370426 CTGGGGATATGGCCTGAACAAGG - Intergenic
1059342260 9:113604119-113604141 CTGGGGATACAGTGAGAAGACGG - Intergenic
1059690962 9:116686149-116686171 ATGGGGAGAAAGAGTAAACAAGG + Intronic
1060199552 9:121644799-121644821 CTGGGGTCACACAGTGAAGAGGG + Intronic
1060234604 9:121853525-121853547 GTGGGGATGCAGAGTGGACAGGG + Intronic
1060302654 9:122384333-122384355 CTGGTGACTCAGAGCGAACATGG - Intronic
1061287167 9:129630640-129630662 CTGGAGCTACAGGGTCAACACGG - Intronic
1061301591 9:129708867-129708889 CTGGGGATACAGCATTGACAAGG + Intronic
1061408091 9:130403617-130403639 CTGGGGTCACAGAATGACCAAGG - Intronic
1061874424 9:133536774-133536796 CTGGGGACACAGTGTCAACCGGG + Exonic
1062223925 9:135438069-135438091 CTGGGGAGAAAGGGTGAACTGGG + Intergenic
1203547605 Un_KI270743v1:140165-140187 CTGGGGATGCAGACAGAAAAGGG + Intergenic
1186270490 X:7881511-7881533 ATGGGAAAACAGAGTGATCAAGG - Intergenic
1187281963 X:17864290-17864312 CTTGGGATGCAGAATCAACAAGG + Intergenic
1189018807 X:37313118-37313140 GTGGGGACAGAGAGTGAATATGG - Intergenic
1190314605 X:49142343-49142365 CTGGGGAGAAAGGGTGAACTGGG + Intergenic
1190663994 X:52680347-52680369 TCAGGGATAAAGAGTGAACATGG + Intronic
1190675428 X:52778075-52778097 TCAGGGATAAAGAGTGAACATGG - Intronic
1191811913 X:65197944-65197966 TTGGAGAAAAAGAGTGAACAGGG - Intergenic
1193909080 X:87280340-87280362 TTGGTGATACCCAGTGAACAGGG - Intergenic
1194395324 X:93376540-93376562 CTGGGGATAAAGATTGTTCATGG + Intergenic
1194400713 X:93435627-93435649 CTGGGGAGAAAGGGTGAACTGGG - Intergenic
1195363573 X:104107127-104107149 GTGGGGATATAGATGGAACAGGG - Intronic
1199420923 X:147643884-147643906 CAGGGGAAAGAGAGTGAAGAGGG - Intergenic
1199514862 X:148664657-148664679 CTTGGGATACAGAGAGAATGAGG - Intronic
1199600629 X:149539565-149539587 CTGGAGATGCAGGGTGAGCAGGG - Intergenic
1199747449 X:150782548-150782570 CTGGGAACACGGCGTGAACATGG - Intronic
1202037466 Y:20649137-20649159 CTGGGGAGAAAGGGTGAACTGGG - Intergenic