ID: 1011044343

View in Genome Browser
Species Human (GRCh38)
Location 6:83065703-83065725
Sequence GCCTGCCATGGCGGCTTCTG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 183}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011044343_1011044357 22 Left 1011044343 6:83065703-83065725 CCGCAGAAGCCGCCATGGCAGGC 0: 1
1: 0
2: 2
3: 17
4: 183
Right 1011044357 6:83065748-83065770 GCTGGAGGTTCCGAGGGGCCCGG 0: 1
1: 0
2: 1
3: 18
4: 320
1011044343_1011044350 7 Left 1011044343 6:83065703-83065725 CCGCAGAAGCCGCCATGGCAGGC 0: 1
1: 0
2: 2
3: 17
4: 183
Right 1011044350 6:83065733-83065755 CCCAGACCGGACCAAGCTGGAGG 0: 1
1: 0
2: 0
3: 6
4: 112
1011044343_1011044354 16 Left 1011044343 6:83065703-83065725 CCGCAGAAGCCGCCATGGCAGGC 0: 1
1: 0
2: 2
3: 17
4: 183
Right 1011044354 6:83065742-83065764 GACCAAGCTGGAGGTTCCGAGGG 0: 1
1: 0
2: 0
3: 5
4: 86
1011044343_1011044346 -6 Left 1011044343 6:83065703-83065725 CCGCAGAAGCCGCCATGGCAGGC 0: 1
1: 0
2: 2
3: 17
4: 183
Right 1011044346 6:83065720-83065742 GCAGGCTTCCAGTCCCAGACCGG 0: 1
1: 0
2: 3
3: 22
4: 173
1011044343_1011044358 23 Left 1011044343 6:83065703-83065725 CCGCAGAAGCCGCCATGGCAGGC 0: 1
1: 0
2: 2
3: 17
4: 183
Right 1011044358 6:83065749-83065771 CTGGAGGTTCCGAGGGGCCCGGG 0: 1
1: 0
2: 2
3: 28
4: 271
1011044343_1011044348 4 Left 1011044343 6:83065703-83065725 CCGCAGAAGCCGCCATGGCAGGC 0: 1
1: 0
2: 2
3: 17
4: 183
Right 1011044348 6:83065730-83065752 AGTCCCAGACCGGACCAAGCTGG 0: 1
1: 0
2: 0
3: 3
4: 74
1011044343_1011044353 15 Left 1011044343 6:83065703-83065725 CCGCAGAAGCCGCCATGGCAGGC 0: 1
1: 0
2: 2
3: 17
4: 183
Right 1011044353 6:83065741-83065763 GGACCAAGCTGGAGGTTCCGAGG 0: 1
1: 0
2: 0
3: 11
4: 134
1011044343_1011044355 17 Left 1011044343 6:83065703-83065725 CCGCAGAAGCCGCCATGGCAGGC 0: 1
1: 0
2: 2
3: 17
4: 183
Right 1011044355 6:83065743-83065765 ACCAAGCTGGAGGTTCCGAGGGG 0: 1
1: 0
2: 0
3: 2
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011044343 Original CRISPR GCCTGCCATGGCGGCTTCTG CGG (reversed) Exonic
900272737 1:1800953-1800975 TCCTGCAAAGGCGCCTTCTGCGG - Intronic
900600224 1:3499695-3499717 GCCTGCCCGGCCGGCTTCTTTGG - Exonic
900648021 1:3717791-3717813 CCCTGCCCTGGCAGCATCTGGGG - Intronic
900870338 1:5297724-5297746 TCCTGCCAGGGCTGCTTCTTAGG + Intergenic
902228498 1:15012310-15012332 GCCTCCCATGGGGACCTCTGGGG + Intronic
903657743 1:24959404-24959426 CCCTTTGATGGCGGCTTCTGAGG - Intronic
904613288 1:31736754-31736776 TCCTGCCCTGGCGGCTGCTCAGG - Intronic
906997340 1:50810903-50810925 GCCTGGCATGGTGGCACCTGTGG + Intronic
912708052 1:111929408-111929430 GCCTGCCTTGGCATCTCCTGGGG + Intronic
917565273 1:176206846-176206868 GCCTTCCGTGGCGGTTTCGGCGG - Exonic
918400561 1:184158522-184158544 CCCTGCCATGGCAGCCTATGGGG + Intergenic
921563149 1:216682813-216682835 GGCTGCCATGGGAGCTGCTGGGG - Intronic
921592909 1:217024412-217024434 GTTTGTCATGGCTGCTTCTGAGG + Intronic
922636924 1:227182984-227183006 GGCTGCCATGTCGGCTTCCCTGG + Intronic
1063382625 10:5595785-5595807 GCTTCCCATGGCAGCTTTTGTGG - Intergenic
1071936553 10:90538027-90538049 GCCAGCCATGGTGGCCTCAGGGG - Intergenic
1072801376 10:98394581-98394603 GCCTTCCATTCCTGCTTCTGCGG + Intronic
1072810858 10:98460486-98460508 GCCTGGCATGGTGGCTACTCAGG + Intronic
1073189704 10:101642655-101642677 GCCTACCAAGGAGGCTTCAGAGG - Intronic
1074196072 10:111186529-111186551 GCCTGCCATGGGGTCCTCAGGGG - Intergenic
1074495137 10:113973606-113973628 GCCTGTCATTTCGGCTTCTCTGG - Intergenic
1075735639 10:124663113-124663135 GCCTGCCTTGTGGTCTTCTGGGG - Intronic
1075934348 10:126326807-126326829 GCCTGCCATGTGGAGTTCTGGGG - Intronic
1076814809 10:132909511-132909533 GCCTGACATGGTGGCTGCTGGGG + Intronic
1077119158 11:898882-898904 GACCGCCATGGCGGCCTCTGGGG - Intronic
1080126316 11:28738388-28738410 GCCTGCCATGGCTGCTTCTCAGG - Intergenic
1082782814 11:57300465-57300487 GCCTGCCCTGGAGGCTTCGGAGG - Intronic
1083173525 11:60936192-60936214 ACCACCCATGGTGGCTTCTGTGG - Exonic
1083263008 11:61533216-61533238 GCCGGGCATGGCAGCTGCTGGGG - Intronic
1084870678 11:72096745-72096767 GCCTGTCATGGAGGCCTGTGAGG - Intronic
1085317715 11:75555453-75555475 CCCTCCCATGGTGGCCTCTGTGG + Intergenic
1090013062 11:123062208-123062230 GCCTGCCATTACGGCTTCCCCGG + Exonic
1090933552 11:131321379-131321401 GCCACCCATGGTGGATTCTGGGG - Intergenic
1091294800 11:134466180-134466202 GCCAGTCATGGCTGCCTCTGCGG - Intergenic
1091714944 12:2770309-2770331 GCCTGCCATGGAAGCTGCTGAGG + Intergenic
1096754378 12:53786558-53786580 GCCTGGCATGGCGACTGGTGTGG - Intergenic
1098527733 12:71505592-71505614 ACCTCCCATGGTGGATTCTGTGG - Intronic
1100869440 12:98894976-98894998 GCCTGCCCTGGCGGCAGCGGCGG + Intronic
1102942834 12:116959109-116959131 GCCTCCCATGCCTGCTTCTCAGG - Intronic
1104771966 12:131369234-131369256 GCCTGGCAGGGCTGCCTCTGGGG - Intergenic
1104919998 12:132285737-132285759 TCCTGCCATAGCTGCATCTGGGG - Intronic
1107151615 13:37118176-37118198 GCATGCTATGGTAGCTTCTGGGG + Intergenic
1107464335 13:40635789-40635811 GCCTGCCCTGCCCACTTCTGGGG + Intronic
1107969850 13:45630922-45630944 GCCTGCCCTAGGGGCTACTGTGG - Intergenic
1110426544 13:75373650-75373672 GCCTGCTGTGGCTGCTCCTGGGG + Intronic
1114577645 14:23728510-23728532 GTCTGCCATGGCAGCCTCTCTGG + Intergenic
1117253064 14:53954258-53954280 GCCTGGCATGGCTTCTTCGGGGG - Intronic
1117336166 14:54758952-54758974 GCCTGGCATGGCGGCTGGGGTGG - Intronic
1117793160 14:59362174-59362196 GCCTGGGGTGGAGGCTTCTGGGG + Intronic
1121323514 14:93006587-93006609 TCCTCCCATGGGGGCTACTGAGG + Intronic
1121633745 14:95439863-95439885 GCCTGTCAAGGCTGCTTCTTTGG + Intronic
1122401880 14:101472212-101472234 GCCTGCCTTGGGGCCCTCTGGGG + Intergenic
1123018753 14:105387766-105387788 GCCTGCCATGGCTGGCTCGGTGG + Intronic
1123041206 14:105490940-105490962 GCCTGCAAGGGCGGACTCTGCGG + Intronic
1123060387 14:105591765-105591787 GCCTGCCAAGAGGGCTGCTGTGG + Intergenic
1123084865 14:105712736-105712758 GCCTGCCAAGAGGGCTGCTGTGG + Intergenic
1124608717 15:31193107-31193129 GTCTGCAATGGCAGCATCTGGGG - Intergenic
1125605209 15:40936380-40936402 ACCTGCCCTGCCGGCTTCTCTGG + Exonic
1125969374 15:43899602-43899624 GCCTCCCATGGCGGCCTCAGTGG - Intronic
1126622305 15:50652206-50652228 GCCTGTAATGCCAGCTTCTGAGG + Intronic
1128083048 15:64867569-64867591 GCCAGCCATGGCTGCTGGTGGGG - Exonic
1132052499 15:98618654-98618676 GCCTGCCATCGCAGCTACTCGGG - Intergenic
1132932235 16:2464564-2464586 GCCAGCCAGGGCGGCCCCTGCGG - Exonic
1133313651 16:4868168-4868190 GCCTGCCGTGGTTGCTTCAGGGG + Intronic
1133421027 16:5646989-5647011 GGCTGCGATGGAGGCTTCTAGGG + Intergenic
1133434655 16:5768738-5768760 GCCAGCCTTTGCTGCTTCTGGGG + Intergenic
1136236931 16:28920052-28920074 GCCTGCCATGGCAACTGCTATGG - Intronic
1136927389 16:34388046-34388068 GCCTGCTATGCAGGCTGCTGAGG + Intergenic
1136977185 16:35023760-35023782 GCCTGCTATGCAGGCTGCTGAGG - Exonic
1137604208 16:49776402-49776424 GCCTGCCTGGGCGGCCTCTGGGG - Intronic
1138135039 16:54514018-54514040 CCCTGACATTGCTGCTTCTGCGG - Intergenic
1138347063 16:56326576-56326598 GCCTGCCACGTTGGCTGCTGGGG + Intronic
1139455217 16:67069243-67069265 GCCTGCCATCCCAGCTTCTCAGG + Intronic
1142222918 16:88864265-88864287 GCCTGCCCTGGAGGCCGCTGTGG + Exonic
1142998780 17:3777454-3777476 GGCTGCCATGGCCGTCTCTGGGG + Intronic
1143663586 17:8342870-8342892 GCCAGGCATGGTGGCATCTGTGG - Intronic
1144376676 17:14649879-14649901 GGGTGCAATGGCTGCTTCTGAGG - Intergenic
1145271045 17:21405107-21405129 GCGGGCCAGGGGGGCTTCTGAGG + Intronic
1145309248 17:21692494-21692516 GCGGGCCAGGGGGGCTTCTGAGG + Intergenic
1148455852 17:47811044-47811066 GCCAGCCAGGGGAGCTTCTGAGG - Intronic
1148637582 17:49160470-49160492 GCCTGTCATGGTGGCTTCCCGGG + Intronic
1159994753 18:74953296-74953318 GCTTGGCATGCCGCCTTCTGTGG + Intronic
1160502847 18:79410873-79410895 GACTGCCATGGCGACGTCTGGGG - Exonic
1160716104 19:577548-577570 GGCAGCCACGGCGGCTTCTGAGG - Intronic
1161451120 19:4345960-4345982 GCCTGCCACGGCTGCTGATGAGG + Exonic
1165425401 19:35742717-35742739 CACTGGCATGGCCGCTTCTGAGG - Exonic
1165622959 19:37263896-37263918 GGCTGAGATGGGGGCTTCTGGGG - Intergenic
1166094908 19:40532329-40532351 CCCTGCCTTGGGGGCTTGTGGGG + Intronic
1166385158 19:42376552-42376574 GCCAGCCATGCCATCTTCTGTGG - Exonic
1167063969 19:47170337-47170359 GCCTGTCATCCCAGCTTCTGGGG - Intronic
1168278289 19:55289171-55289193 GCCTCCCATGTCAGCTTCAGAGG - Intronic
927593506 2:24377128-24377150 GCCTGCAATCCCGGCTTCTTGGG - Intergenic
938289394 2:130141437-130141459 GCCTGCCTTGGAGGGTTCTGGGG + Intronic
938467136 2:131531501-131531523 GCCTGCCTTGGAGGGTTCTGGGG - Intronic
944866071 2:203863373-203863395 CCCTGTCAGGGTGGCTTCTGAGG - Intergenic
946147376 2:217741245-217741267 GCCTGCTATGGGGGCCACTGGGG + Intronic
947788550 2:232847539-232847561 GGCTGCTGTGGCGGCTGCTGTGG - Exonic
1169191113 20:3659843-3659865 GCCTGCCTGGGCCGCCTCTGTGG - Intronic
1169443207 20:5650186-5650208 GCCTGGCATGGTGGCTACTTAGG + Intergenic
1170140496 20:13121317-13121339 GGCTGGCATGCAGGCTTCTGGGG - Intronic
1172095974 20:32460698-32460720 GACTGCAACGGGGGCTTCTGGGG + Intronic
1172691566 20:36793875-36793897 CCTTGCCATGGAGGCTGCTGCGG + Exonic
1173010720 20:39179214-39179236 GCCTGCAATGGCCTCTGCTGTGG - Intergenic
1175785939 20:61711878-61711900 GCCAGCCATGGAGACATCTGGGG + Intronic
1179616489 21:42586668-42586690 GCCTGCCAGGGCCCCTGCTGTGG - Intergenic
1180136317 21:45864192-45864214 GCCTTCCATCACTGCTTCTGTGG + Intronic
1181031408 22:20150279-20150301 GCCTGTCATGGCCGCTCCTGCGG + Intronic
1181511925 22:23393123-23393145 GCTTGTCATGGCCGCTCCTGGGG - Intergenic
1182149782 22:28019949-28019971 GCCTGCCACGGCGGCCTCACCGG + Intronic
1183828107 22:40404303-40404325 GCCTGCCACCGCAGCCTCTGTGG - Exonic
1184510011 22:44927935-44927957 TCCTGCCATGGCTGAGTCTGGGG + Intronic
1184835907 22:47020946-47020968 CCCTGCCATGTGGGCTTCTCTGG - Intronic
949133838 3:538011-538033 GCCTGCCATGAGGCCTTATGAGG + Intergenic
950183621 3:10931931-10931953 GCCTGCCATGGGGACTTCCTTGG - Intronic
950551889 3:13671070-13671092 CTCTGCCATGGCGGCACCTGTGG + Intergenic
951881380 3:27484111-27484133 GCCGGCCATGGAGGCTGATGGGG - Intronic
952310179 3:32181442-32181464 GCAAGCCATGCTGGCTTCTGTGG - Intergenic
953107873 3:39903014-39903036 GCTTGCCATGGCAGCTCTTGTGG + Intronic
956171173 3:66434620-66434642 GCCTGCAATCCCAGCTTCTGGGG + Intronic
957775752 3:84756129-84756151 GCCAGGCATGGCAGCTGCTGTGG + Intergenic
960525675 3:118707016-118707038 GCCTGGAATGGCCGCTGCTGGGG - Intergenic
961456859 3:127028713-127028735 GCCTGGCACCGAGGCTTCTGTGG - Intronic
961651918 3:128421059-128421081 GCCTGCCACGCTGGCTCCTGGGG - Intergenic
962129822 3:132660531-132660553 CCCAGCCATGGCGGAGTCTGTGG + Exonic
967108668 3:186273728-186273750 CTCTGCCAAGGCGACTTCTGTGG + Intronic
967723895 3:192843856-192843878 GGTTGCCATGGCTGCTTATGAGG - Intronic
968512984 4:1003450-1003472 GCCTGCCCGGGCGGCTTCTCGGG - Exonic
968525773 4:1055993-1056015 GCCTGTGATGCCGGCTTCAGCGG - Intergenic
968601676 4:1512772-1512794 GCCTGCCAGGCGGGCTTCAGCGG + Intergenic
968970365 4:3790518-3790540 GACTGCCTTGCCAGCTTCTGTGG + Intergenic
969003292 4:3999932-3999954 GCCTGCCATCCCAGCTACTGGGG + Intergenic
971733495 4:30416687-30416709 GGCTGCCATGAAGCCTTCTGAGG - Intergenic
975576326 4:75866276-75866298 GACTGCCATGGCGGATGCTGAGG - Exonic
977274344 4:94957236-94957258 GCCTTCCATGGCGGTATATGAGG + Intronic
983323897 4:166228262-166228284 GCCAGGCATGCCGGCTGCTGCGG - Intergenic
985066800 4:186130498-186130520 GCCAGGCATGGTGGCTACTGGGG - Intronic
985252961 4:188041913-188041935 GCCTGCCATGGCCGCATCCTGGG + Intergenic
985864816 5:2506529-2506551 GCCTGCCATCTCAGCTACTGGGG - Intergenic
986111981 5:4728310-4728332 CCCTGCCATGGAGTCTTCAGGGG + Intergenic
986686665 5:10280896-10280918 GCCTGTCATCCCGGCTTCTCCGG - Intronic
990041429 5:51382833-51382855 GCCTGCCTTGGCTGCTCCGGAGG - Intergenic
992244647 5:74807972-74807994 GCCGGCCATGGTGGCTACTCAGG + Intronic
997429383 5:133826984-133827006 GCGTGCCATTGGGCCTTCTGTGG - Intergenic
998295992 5:140968984-140969006 GCATGCTGTGGAGGCTTCTGTGG + Exonic
1000854112 5:166378638-166378660 GCCAGCCATGCCAGCTGCTGTGG + Intergenic
1001584020 5:172820575-172820597 GCCTGCCAAGCCGACTGCTGAGG + Intergenic
1004241430 6:13925335-13925357 GCGTGCCATCGAGGCTTTTGGGG + Intronic
1004288440 6:14344763-14344785 TCCTGTCCTGGCGGCTTCTTGGG - Intergenic
1004445586 6:15694416-15694438 GCCTGCAATGGCAGCTACTCGGG + Intergenic
1005272010 6:24176153-24176175 GCCTGGCATGGTGGCACCTGTGG + Intronic
1008466773 6:51840257-51840279 GCCTTCCGTGGCTGCCTCTGAGG - Intronic
1009527061 6:64760784-64760806 GCCAGCCATGGATGCTTCGGTGG + Intronic
1011044343 6:83065703-83065725 GCCTGCCATGGCGGCTTCTGCGG - Exonic
1012887497 6:104861679-104861701 GCCCACCATGGAGGCTGCTGGGG - Intergenic
1014844469 6:126258332-126258354 GTCTGCCATGGCGGCTGCCAGGG + Intergenic
1017523916 6:155226311-155226333 GCCAGCCAAGGGGGCTACTGAGG - Intronic
1019587497 7:1813332-1813354 GCCTTCCACCCCGGCTTCTGTGG - Intergenic
1021674633 7:23067887-23067909 GCCTGCCATGGGGCCTGCTGTGG + Intergenic
1024375877 7:48637331-48637353 GCTTGCCATGGCTTCTTCTATGG + Intronic
1026102330 7:67393440-67393462 GCCTGCCATGGATGGTTGTGTGG + Intergenic
1026102493 7:67394621-67394643 GCCTGCCATGGATGGTTGTGTGG + Intergenic
1027529950 7:79317779-79317801 GCTTGCCATGAAGGCTTCTTGGG + Intronic
1027532557 7:79354041-79354063 GCCAGCCTTGGGGGCTTCTAGGG + Intronic
1028987703 7:97021245-97021267 GCCGGCCAGGGCGCCCTCTGGGG - Intronic
1032442613 7:131953593-131953615 CCCTCCCACGGCTGCTTCTGTGG - Intergenic
1035253770 7:157613535-157613557 GCCCGCCCTGCCGGCTTCTGAGG - Intronic
1035764040 8:2091495-2091517 GCCTCCCGTGAAGGCTTCTGGGG - Intronic
1035816797 8:2550036-2550058 GTCTGCCACGGGGGCTTCTGGGG + Intergenic
1037295069 8:17391031-17391053 GCCAGCCATGGGGGTATCTGGGG + Intronic
1037774024 8:21820825-21820847 GTCTGCCAGGGAGGATTCTGTGG + Intergenic
1039885530 8:41652090-41652112 ACCTACCAGGGCGGCCTCTGGGG - Intergenic
1040294494 8:46142184-46142206 GGCAGCCCTGGGGGCTTCTGGGG + Intergenic
1040295053 8:46144733-46144755 GCCAGCCCAGGGGGCTTCTGGGG + Intergenic
1040305471 8:46209604-46209626 GACAGCCCTGGAGGCTTCTGGGG - Intergenic
1040308306 8:46223631-46223653 GCCTGCCCTGGACACTTCTGGGG - Intergenic
1040331721 8:46389052-46389074 GACAGCCCTGGGGGCTTCTGGGG - Intergenic
1040332013 8:46390535-46390557 GCCTGCCAAGGTGGCCTCTCAGG + Intergenic
1042020638 8:64369640-64369662 GCCCGCCAGGGCCGCATCTGCGG + Intergenic
1042856978 8:73277537-73277559 GCCTGGAATGGAGGCTTCTCTGG - Intergenic
1042867782 8:73370619-73370641 CGCTGCCATGGCGACTGCTGGGG + Intergenic
1044082650 8:87904264-87904286 GCCTGCCATAACGGCAACTGGGG + Intergenic
1044473802 8:92603166-92603188 GACAGCAATGGCGGGTTCTGGGG - Intergenic
1046950890 8:120018783-120018805 GCCTGAGATGGCAGCTTCTCAGG + Intronic
1046965684 8:120163079-120163101 GCCTGGACTGGCGCCTTCTGGGG - Intronic
1048189662 8:132276389-132276411 GCCTGCCCTGGATGTTTCTGTGG - Intronic
1049197878 8:141325454-141325476 GCCTGCCATGCTGGGGTCTGAGG + Intergenic
1049394244 8:142391733-142391755 GCCAGGCATGCCGGCTGCTGCGG - Intronic
1049449905 8:142655013-142655035 GCCTCCTATGGCGGCTTCAAGGG + Intergenic
1050473743 9:6019684-6019706 GCCTGCCATGGAGCCATATGGGG + Intergenic
1053278539 9:36801395-36801417 GCATGCTATGGCTACTTCTGCGG + Intergenic
1055249887 9:74291233-74291255 ATCTGCCATGCTGGCTTCTGAGG - Intergenic
1057442434 9:95091877-95091899 GCCTCCCATGGGGGCTGCTGGGG - Intergenic
1060177491 9:121507797-121507819 CTCTGCCATGGAGGCTTCAGCGG - Intergenic
1062327278 9:136018270-136018292 GGCTGCCAAGGGGGCTGCTGGGG + Intronic
1062360530 9:136185912-136185934 GCCACCCAGGGCGGCTCCTGGGG + Intergenic
1062475398 9:136724227-136724249 AACTGCCCTGGCGGCTTCAGAGG - Intergenic
1189288749 X:39870543-39870565 GCCTGCAATGGGGCCCTCTGGGG - Intergenic
1189491156 X:41472706-41472728 GCCTGCCCTGGCCTCTACTGCGG - Intronic
1189717000 X:43877319-43877341 ACCTGCCCTGGTGACTTCTGAGG + Intronic
1192362633 X:70449234-70449256 GCCTGCCATGGCCCCTTCTGAGG + Intronic
1198545928 X:137692692-137692714 GCCGGGCATGGTGGCTTTTGGGG - Intergenic
1199601494 X:149543929-149543951 GCCGGCCATGGGTGCTTGTGGGG + Intronic
1199648883 X:149935555-149935577 GCCGGCCATGGGTGCTTGTGGGG - Intronic