ID: 1011045342

View in Genome Browser
Species Human (GRCh38)
Location 6:83075752-83075774
Sequence CCTCTTCACCAGATAGTGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 580
Summary {0: 1, 1: 1, 2: 1, 3: 44, 4: 533}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011045336_1011045342 27 Left 1011045336 6:83075702-83075724 CCAACAGTGTTTGACAAGGGTGC 0: 1
1: 0
2: 0
3: 11
4: 88
Right 1011045342 6:83075752-83075774 CCTCTTCACCAGATAGTGTTGGG 0: 1
1: 1
2: 1
3: 44
4: 533
1011045338_1011045342 5 Left 1011045338 6:83075724-83075746 CCAAGACGACTCAGTCAGGAAAG 0: 1
1: 0
2: 3
3: 27
4: 259
Right 1011045342 6:83075752-83075774 CCTCTTCACCAGATAGTGTTGGG 0: 1
1: 1
2: 1
3: 44
4: 533

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011045342 Original CRISPR CCTCTTCACCAGATAGTGTT GGG Intronic
900672304 1:3862604-3862626 TATCTTCAACAGATAGTGCTGGG + Intronic
903141503 1:21341986-21342008 CCACTTCTCCAGATATTGTGAGG - Intronic
903195553 1:21684776-21684798 CCTCTTCACTAGATTTTGCTGGG - Intronic
904240872 1:29144297-29144319 CCTGTGAACCAGATAGTGCTTGG - Intergenic
904563141 1:31412199-31412221 CCTCTGGACAAGATAATGTTAGG - Intronic
906392049 1:45426363-45426385 TCTCTTCAACAAATAGTGCTGGG + Intronic
906915029 1:49999830-49999852 CCTATTCAACAAATAGTGCTGGG + Intronic
908709300 1:66996900-66996922 TCTCTTCAACAAATGGTGTTGGG + Intergenic
908834929 1:68219616-68219638 CCTCTTCAACAGATATTATTGGG + Intronic
909082918 1:71135270-71135292 TCTCTTCAATAAATAGTGTTAGG + Intergenic
909852415 1:80484863-80484885 CATCTCTACCAAATAGTGTTTGG - Intergenic
910634969 1:89397622-89397644 TCTCTTCAACAAATAGTGCTGGG - Intergenic
911268267 1:95769884-95769906 CCTCTTCATCATTCAGTGTTTGG + Intergenic
911719056 1:101170058-101170080 ACTCTTCACCAGTCTGTGTTGGG + Intergenic
912611814 1:111054982-111055004 CCTATTCAACAGATGGTGCTGGG - Intergenic
913482357 1:119300930-119300952 CCTTTTCACCAGATTTTGCTTGG + Intergenic
913721187 1:121597290-121597312 TCTCTTCCACAAATAGTGTTAGG - Intergenic
914234687 1:145798401-145798423 TCTCTTCAGCAAACAGTGTTGGG - Intronic
915395113 1:155577511-155577533 TCTCTTCAACAAATAGTGCTGGG - Intergenic
916386296 1:164274748-164274770 TCTCTTCACTAAATGGTGTTGGG + Intergenic
916736809 1:167614908-167614930 TCTCTTCAACAAATGGTGTTGGG - Intergenic
917315045 1:173715346-173715368 CAGCTTCCCCAGACAGTGTTTGG + Intronic
917569977 1:176255183-176255205 CCTCTTCAATAAATGGTGTTGGG - Intergenic
918172297 1:182010123-182010145 CCTATTCAACAGATGGTGCTGGG + Intergenic
918272723 1:182918906-182918928 TCTCTTCAACATATGGTGTTGGG + Intronic
918358428 1:183729462-183729484 CCTCATCAACAGTTAGTATTTGG - Intronic
919293912 1:195669657-195669679 CCTATTCAATAAATAGTGTTGGG - Intergenic
919485296 1:198138774-198138796 CCTATTCAACAAATAGTGCTGGG - Intergenic
919507100 1:198413078-198413100 GCTCTTCAACAAATAGTGTTGGG - Intergenic
920747419 1:208642299-208642321 CCTCTTCACAAGAGACAGTTTGG - Intergenic
920892155 1:209998704-209998726 CCTCTTCAATAAATGGTGTTGGG + Intronic
921385248 1:214562093-214562115 TTTCTTCAACAGATTGTGTTGGG + Intergenic
922069703 1:222179608-222179630 CCTGTTCAACAAATAGTGCTGGG + Intergenic
922378259 1:224991970-224991992 TCTCTTCAATAAATAGTGTTGGG - Intronic
923174545 1:231451500-231451522 CCTCTTCAACAAATGGTGCTGGG + Intergenic
924632784 1:245757657-245757679 TCTCTTCAACAAATAGTGTTGGG - Intronic
924691934 1:246360707-246360729 CCTATTCAACAAATAGTGCTGGG + Intronic
924789301 1:247229693-247229715 CCTATTCAACAAATGGTGTTGGG + Intergenic
924882914 1:248182409-248182431 CCTATTCAACAGATGGTGCTGGG - Intergenic
1063852095 10:10203870-10203892 TCTCTTCAACAAATGGTGTTAGG - Intergenic
1064464054 10:15562150-15562172 CCTCCCCACCTGATAGGGTTAGG - Intronic
1065613253 10:27493971-27493993 CCTCTTCAATAAATAGTGCTAGG + Intergenic
1066163731 10:32762771-32762793 TCTCTTTAACAAATAGTGTTGGG + Intronic
1066619583 10:37331514-37331536 CCTCTTCATCAAATGGTGCTTGG + Intronic
1066686958 10:37990750-37990772 CCTCTTCAGAAGACAGTGTGGGG - Intergenic
1067005572 10:42657797-42657819 CCTATTCAACAAATAGTGCTGGG + Intergenic
1067086910 10:43246679-43246701 TCTCTTCAACAAATAGTGCTGGG + Intronic
1067330777 10:45316455-45316477 TCTCTTCAACAAACAGTGTTGGG + Intergenic
1067411841 10:46071393-46071415 TCTCTTCAGCAAATGGTGTTGGG + Intergenic
1067767805 10:49100934-49100956 CCTCTTCAACAGACAGTGTAGGG + Intronic
1067940500 10:50650992-50651014 CTTCTCTACCAGATGGTGTTTGG - Intergenic
1067959369 10:50831018-50831040 CCTCTTCAACAAATGGTGTAAGG + Intronic
1068490773 10:57720974-57720996 CCTATTCAGAAGATGGTGTTGGG + Intergenic
1068678660 10:59794870-59794892 TCTCTTCAACAGATGGTGTTGGG + Intronic
1069005552 10:63314152-63314174 CCTATTCAACAAATAGTGCTGGG - Intronic
1070081994 10:73198115-73198137 TCTCTTTAACAGATGGTGTTAGG + Intronic
1070868060 10:79721474-79721496 TCTCTTCAACAAATGGTGTTGGG + Intergenic
1071054409 10:81492302-81492324 CCTATTCAACAAATAGTGCTGGG - Intergenic
1071230159 10:83577048-83577070 CCTATTCAATAAATAGTGTTGGG - Intergenic
1071634971 10:87243675-87243697 TCTCTTCAACAAATGGTGTTGGG + Intergenic
1071684390 10:87739240-87739262 TCTCTTCAACAAATAATGTTGGG - Intronic
1072078623 10:92004979-92005001 CCTCTTCAATAAATGGTGTTGGG - Intronic
1072380502 10:94864287-94864309 CCTTTTCAACAGATGGTGCTGGG - Intergenic
1072392777 10:95005462-95005484 CCTTTTCAACAAATTGTGTTGGG - Intergenic
1072866849 10:99071798-99071820 TCTCTTCAATAAATAGTGTTGGG - Intronic
1073864078 10:107782038-107782060 TCTCTTCCACAGATAGTGTTGGG - Intergenic
1074736182 10:116436103-116436125 CTTATTCACCAAATGGTGTTGGG + Intronic
1077784867 11:5373076-5373098 TCTCCTCAACAAATAGTGTTGGG + Intronic
1079073609 11:17369086-17369108 CCTCTTCACCATCAGGTGTTGGG + Intronic
1079260623 11:18875904-18875926 CACCTTCTCCAGTTAGTGTTTGG - Intergenic
1079342710 11:19626260-19626282 CCTCTTCAATAAATGGTGTTGGG - Intronic
1081055379 11:38404018-38404040 CTTCTTCAACAAATGGTGTTGGG - Intergenic
1081084401 11:38781151-38781173 TCTCTTCAATAGGTAGTGTTGGG - Intergenic
1082097378 11:48142078-48142100 CCTCTTCAACAAATGGTGCTGGG - Intronic
1082645725 11:55721836-55721858 TCTCTTCAACAAATGGTGTTAGG - Intergenic
1082909681 11:58356700-58356722 CCTTTTCAACAAATAGTCTTGGG - Intergenic
1083529174 11:63402343-63402365 CCTATTCAATAGATAGTGCTTGG - Intronic
1085243909 11:75082283-75082305 CCTCTTCAATAAATAGTGCTGGG + Intergenic
1085891930 11:80590210-80590232 CCTATTCAATAGATAGTGCTGGG + Intergenic
1086819384 11:91416197-91416219 CCTATTCAACAGATGGTGCTAGG + Intergenic
1087090619 11:94268339-94268361 CCTCTTCAACAAATGGTGCTGGG + Intergenic
1088043480 11:105418187-105418209 CCTCTGCCCCAGAAAGTGCTGGG + Intergenic
1088525602 11:110750056-110750078 CCTATTCAACAAATAGTGCTGGG - Intergenic
1088583427 11:111336554-111336576 CCTTCTCAACAGATAGGGTTAGG - Intergenic
1089375649 11:117992924-117992946 TCTCTTCAACAAATGGTGTTGGG - Intronic
1089937433 11:122378465-122378487 CCTTTTCAACAAATAGTGCTGGG + Intergenic
1089943823 11:122446536-122446558 CCTATTCAACAAATAGTGCTTGG - Intergenic
1090518745 11:127456594-127456616 CCTCTTCAATAAATGGTGTTGGG + Intergenic
1091167117 11:133488989-133489011 CCTCTTCACTAAATGGTGTTGGG + Intronic
1091504982 12:1058426-1058448 CCTCTTCAATAGATAGTACTGGG - Intronic
1092263449 12:6964153-6964175 CATCTTTACCAGACAGTGTTAGG - Intergenic
1093412250 12:18880676-18880698 TCTCTTCATCTGGTAGTGTTAGG + Intergenic
1093606285 12:21093338-21093360 TCTCTTCAACAAATGGTGTTAGG - Intronic
1093618394 12:21256631-21256653 TCTCTTCAACAAATGGTGTTAGG - Intergenic
1094330668 12:29289450-29289472 CCTCTTCAATAAATGGTGTTGGG + Intronic
1095121213 12:38422050-38422072 CCTATTCAACAAATGGTGTTGGG + Intergenic
1095247671 12:39941942-39941964 CCTTTTCAACAGATGGTGTTGGG - Intronic
1095667932 12:44824481-44824503 TCTCTTCAATAAATAGTGTTGGG - Intronic
1095852069 12:46821392-46821414 CCTCTTCAACAAATGGTGTTGGG - Intronic
1095995303 12:48077492-48077514 TCTCTTCACTAAATGGTGTTGGG - Intronic
1096026620 12:48369938-48369960 CCTCTTCAATAAACAGTGTTAGG + Intergenic
1096344380 12:50832803-50832825 CCTATTCAACAAATAGTGCTGGG + Intergenic
1096411802 12:51382431-51382453 CCTACTCGCCAGTTAGTGTTCGG - Intronic
1098022022 12:66166139-66166161 TCTCTTCAACAAATGGTGTTGGG - Intronic
1098656187 12:73032926-73032948 CCTATTCAACAAATAGTGCTAGG - Intergenic
1098786088 12:74757586-74757608 CCTATTCAACAAATAGTGCTGGG - Intergenic
1100024938 12:90116685-90116707 CCTCTTCAATAAATAGTGCTAGG - Intergenic
1100360382 12:93872638-93872660 TCTCTTCAACAAATGGTGTTAGG - Intronic
1100937390 12:99684835-99684857 CCTATTCAACAAATAGTGCTGGG + Intronic
1100945088 12:99773911-99773933 TCTCTTCAATAAATAGTGTTGGG + Intronic
1100948952 12:99823820-99823842 CCTCTTCAATAAATAGTGCTAGG - Intronic
1100952834 12:99871151-99871173 CCTATTCAACAAATAGTGCTGGG - Intronic
1100989482 12:100236915-100236937 CCTCTTCAACAAATGGTGCTAGG - Intronic
1103669660 12:122602689-122602711 CCTTTTCACCTGATATTCTTTGG + Exonic
1104031290 12:125066963-125066985 CCTCCTCACCAAACAGTGGTTGG + Intronic
1104501251 12:129287779-129287801 TCTCTTCACCAAATGGTGCTAGG - Intronic
1105404639 13:20123239-20123261 TCTTTTCAACAAATAGTGTTAGG - Intergenic
1105711697 13:23015799-23015821 CCTCTTCAATAAATGGTGTTGGG - Intergenic
1105774785 13:23647812-23647834 CCTCTTCAAAAAATGGTGTTAGG - Intronic
1106279114 13:28247658-28247680 CCTCTTCAATAAATGGTGTTTGG - Intronic
1106358349 13:29006242-29006264 ACTCTGCACCAGATGCTGTTAGG + Intronic
1106457393 13:29939132-29939154 CCTCTTCACCTGACAGAGGTGGG + Intergenic
1106819566 13:33449335-33449357 TCTCTTCAATAAATAGTGTTAGG - Intergenic
1106958969 13:34975369-34975391 CCTATTCAACAGATGGTGCTGGG + Intronic
1106979815 13:35265618-35265640 ACTCTTCAATAAATAGTGTTGGG + Intronic
1107514932 13:41119812-41119834 TCTCTTCAGCAGATGGTGCTGGG - Intergenic
1108103250 13:46980903-46980925 TCTCTTCAACAAATAGTGTTGGG + Intergenic
1108480283 13:50862875-50862897 CCTCTTCAACAAATAGTGTTGGG + Intergenic
1108744760 13:53381082-53381104 TCTCTTCAACAAAGAGTGTTGGG - Intergenic
1108850624 13:54723773-54723795 TCTCTTCAACAAATAGTGATGGG - Intergenic
1109357110 13:61245745-61245767 CCTCTTCAATAAATAGTGCTGGG - Intergenic
1109382192 13:61577444-61577466 TCTATTCACTAAATAGTGTTGGG + Intergenic
1109457886 13:62617089-62617111 ACTCTTCAGCAAATAGTCTTGGG - Intergenic
1109881935 13:68489838-68489860 CCTCTTCAATAAATAGTGCTAGG + Intergenic
1109907285 13:68861209-68861231 CCTCTTCAATAAATTGTGTTGGG - Intergenic
1110458882 13:75721965-75721987 CCTATTCAACAAATGGTGTTGGG + Intronic
1110600702 13:77369508-77369530 CCTATTCAACAGATGGTGTTGGG + Intergenic
1110886686 13:80646570-80646592 CCTCTTCAATAAATAGTGCTGGG - Intergenic
1111208647 13:85047273-85047295 TCTCTTCAACAAATAGTGCTGGG + Intergenic
1113217905 13:108063718-108063740 TCTCTTCAATAAATAGTGTTGGG + Intergenic
1113710334 13:112459720-112459742 CCTCTTCAATATATGGTGTTGGG - Intergenic
1114205354 14:20566210-20566232 CCTCTTCAATAAATAGTGCTGGG + Intergenic
1114248766 14:20939146-20939168 TCTCTCCTCCAGACAGTGTTGGG - Intergenic
1114328939 14:21617032-21617054 CCTATTCAACAAATAGTGCTGGG - Intergenic
1114374429 14:22128983-22129005 CCTATTCAACAAATGGTGTTGGG - Intergenic
1114421058 14:22583043-22583065 CCTCTTCACCAGTTAGTACGTGG - Intronic
1114507016 14:23224510-23224532 TCTCTTCAGCAAATAGTGCTGGG + Intronic
1115482809 14:33878576-33878598 CCTCTTCAACAAATGGTGCTGGG + Intergenic
1115791598 14:36885195-36885217 TCTCTTCAATAAATAGTGTTGGG - Intronic
1115966414 14:38894441-38894463 CCTCTTCAACAAATGGTTTTAGG + Intergenic
1115990832 14:39147695-39147717 TCTCTTCAACAAATAGTGTTGGG - Intergenic
1116064314 14:39963197-39963219 CCTATTCAACAAATGGTGTTGGG + Intergenic
1116082626 14:40194914-40194936 CCTCTTCAATAAATTGTGTTCGG + Intergenic
1116333591 14:43627688-43627710 TCTCTTCAACAAGTAGTGTTGGG + Intergenic
1116545042 14:46154778-46154800 CCCCATCACCAGATAATTTTAGG + Intergenic
1116584421 14:46684661-46684683 CCTCTTCAATAAATAGTGCTGGG - Intergenic
1116712786 14:48390537-48390559 CCTCTTTAGCAGATAGTTCTTGG - Intergenic
1117232292 14:53732861-53732883 TCTCTTCAACAAATGGTGTTAGG + Intergenic
1117749649 14:58907557-58907579 CCTCTTCACTAAATGGTGCTGGG + Intergenic
1119310567 14:73642988-73643010 CCTGTTCACCAGAGAATGTGTGG - Intergenic
1119858582 14:77920333-77920355 CCTCTTCAACAAATGGTGCTGGG - Intronic
1120428561 14:84383341-84383363 TCTCTTCAACAAATAGTGGTAGG + Intergenic
1120575037 14:86171365-86171387 CCTATTCAACAAATGGTGTTGGG + Intergenic
1122440689 14:101729696-101729718 CCTCTACTCCAGATTGTGTCTGG - Intergenic
1202841944 14_GL000009v2_random:129783-129805 TCTCTTCACCAAATTGTGCTGGG + Intergenic
1202911335 14_GL000194v1_random:120017-120039 TCTCTTCACCAAATCGTGCTGGG + Intergenic
1123674567 15:22696552-22696574 TCTATTAAGCAGATAGTGTTGGG - Intergenic
1123803631 15:23849343-23849365 TCTCTTCAACAAACAGTGTTAGG - Intergenic
1124326582 15:28769543-28769565 TCTATTAAGCAGATAGTGTTGGG - Intergenic
1124387116 15:29218724-29218746 CCTCTTCAATAAATGGTGTTGGG + Intronic
1124427703 15:29576240-29576262 TCTCTTCAACAGATGGTGCTGGG + Intergenic
1124792522 15:32742784-32742806 TCTCTTCAACAAATGGTGTTGGG + Exonic
1124810361 15:32930924-32930946 TCTCTCCAACAGATAGTGCTAGG - Intronic
1127014875 15:54673221-54673243 CCTATTCAACAAATAGTGCTGGG + Intergenic
1127022695 15:54767244-54767266 TCTCTTCAATAGATGGTGTTGGG + Intergenic
1127050825 15:55081662-55081684 CCTCTTCAACAAATGATGTTAGG + Intergenic
1127814404 15:62594566-62594588 TCTCTTCAATAAATAGTGTTGGG + Intronic
1129046710 15:72741683-72741705 CCTATTCAACAGATGGTGCTGGG + Intergenic
1129564901 15:76611171-76611193 TCTCTTCAACAAATGGTGTTAGG + Intronic
1130405799 15:83600422-83600444 CCTATTCAACAAATGGTGTTGGG - Intronic
1130419594 15:83731006-83731028 TCTCTTCAATAAATAGTGTTTGG - Intronic
1131734900 15:95321671-95321693 TCTTTTCAACAAATAGTGTTGGG - Intergenic
1132159217 15:99521933-99521955 CCTCTTCAATAAATGGTGTTGGG + Intergenic
1133374822 16:5275943-5275965 CCTATTCAACAAATAGTGCTGGG + Intergenic
1135096506 16:19568894-19568916 CCTCAGCACCACAAAGTGTTGGG + Intronic
1135487061 16:22874868-22874890 CCTCTGCAGCTGAGAGTGTTTGG + Intronic
1137828412 16:51520209-51520231 CTTCTTCCCCACATAGTCTTGGG - Intergenic
1138871586 16:60894439-60894461 TCTCTTCAACAAACAGTGTTGGG - Intergenic
1139113127 16:63916932-63916954 TCTCTTCACCAATTAGTGATAGG + Intergenic
1139343142 16:66284360-66284382 TCTCTTCAACAAATGGTGTTGGG + Intergenic
1139987498 16:70911344-70911366 CCTTTTCAACAAATAGTGCTGGG - Intronic
1140950576 16:79812976-79812998 CTTCTTCACCCAATAGTGATCGG + Intergenic
1143414735 17:6738015-6738037 CCTTTTCAACAAATAGTGCTGGG + Intergenic
1144616512 17:16780014-16780036 CCTATTCAACAAATAGTGCTGGG + Intronic
1144896185 17:18535645-18535667 CCTATTCAACAAATAGTGCTGGG - Intergenic
1145136029 17:20408575-20408597 CCTATTCAACACATAGTGCTGGG + Intergenic
1147150656 17:38511721-38511743 CCTGTTCCCCAGACAGTTTTTGG + Exonic
1147291214 17:39444918-39444940 CTTCTTCACTGGATAGGGTTAGG - Intronic
1148992730 17:51680568-51680590 CCTGTTCCCCAGGGAGTGTTTGG + Intronic
1149108941 17:53002973-53002995 TCTCTTCAATAGATAGTGCTGGG + Intergenic
1149125015 17:53218586-53218608 CCTCTTCACAAAATAGTTTTTGG - Intergenic
1150027722 17:61695223-61695245 TCTTTTCAACAGATGGTGTTGGG - Intronic
1155805728 18:30168858-30168880 TCTCTTCAGTAAATAGTGTTGGG - Intergenic
1155889924 18:31255246-31255268 CCTCTTCAATAAATGGTGTTGGG - Intergenic
1156060526 18:33069435-33069457 CCTCTTCAATAAATAGTGCTGGG + Intronic
1156710097 18:39933211-39933233 CCTCTTCAATAAATAGTTTTGGG + Intergenic
1157601980 18:48898884-48898906 TCTTTTCAACAGATGGTGTTGGG + Intergenic
1157821426 18:50773671-50773693 CCTCTTCAACAAATGGTGCTGGG + Intergenic
1158794161 18:60821949-60821971 CCTATTCAACAAATAGTGCTGGG - Intergenic
1158811689 18:61045504-61045526 CCTATTCAACAAATAGTGCTGGG + Intergenic
1158893767 18:61894878-61894900 CCTCGTCACCGGATACTTTTTGG + Intergenic
1159132681 18:64297879-64297901 TCTCTTCAACAAATGGTGTTAGG + Intergenic
1159876554 18:73817992-73818014 TCTCTTCAACAAATGGTGTTGGG + Intergenic
1160570220 18:79811481-79811503 TCTCTTCAGCAGATGGTGCTGGG + Intergenic
1163060497 19:14757614-14757636 TCTCTTCAACAAATAGTGCTGGG + Intronic
1165911132 19:39228616-39228638 CCTTTTCAACAAATGGTGTTTGG + Intergenic
1168485379 19:56757852-56757874 TCTCTTCAACATATTGTGTTGGG + Intergenic
925002154 2:412302-412324 TCTCTTCAATAGATGGTGTTGGG - Intergenic
925335137 2:3092748-3092770 TCTCTTCAACAGATAGTGTCAGG + Intergenic
925446801 2:3933356-3933378 CCTATTCAACAAATAGTGCTGGG - Intergenic
926083009 2:10004028-10004050 CATCTTCCCCAGACAGCGTTAGG + Intergenic
927403164 2:22737409-22737431 TCTCTTCAACAGACAGTGTTGGG + Intergenic
928255880 2:29722084-29722106 CCTGGTCACCACATAGTCTTTGG + Intronic
928386693 2:30875162-30875184 CCTATTCAACAAATGGTGTTGGG - Intergenic
928800867 2:35089819-35089841 CCTCTTCACTAAATGGTGTTTGG + Intergenic
928810893 2:35224416-35224438 GCTCTTCAAAAAATAGTGTTTGG - Intergenic
929618297 2:43329718-43329740 ACTTTTCACCTGATTGTGTTTGG - Intronic
929963707 2:46517242-46517264 CCTCTTCAATAAATGGTGTTGGG + Intronic
931549697 2:63429080-63429102 CCTATTCAATAAATAGTGTTAGG + Intronic
931993278 2:67812466-67812488 CCTTTTCAACAGATGGTGCTGGG + Intergenic
932100153 2:68891539-68891561 CCTTTTCAACAAATAGTGCTAGG - Intergenic
932651228 2:73559789-73559811 TCTCTTCAACAAATGGTGTTGGG + Intronic
934550558 2:95258787-95258809 CCTCATCACCAGAAACTGTAGGG + Intronic
934885261 2:98018970-98018992 TCTTTTCAACAGATAGTGCTGGG - Intergenic
935533668 2:104266707-104266729 TCTCTTCAACAAACAGTGTTGGG + Intergenic
936579310 2:113683213-113683235 CCTATTCAACAAATAGTGCTGGG + Intergenic
937220758 2:120342117-120342139 CATCCTCAACAGATAGTGATGGG + Intergenic
937449296 2:121988095-121988117 TCTCTTCAACAAATGGTGTTGGG + Intergenic
937709157 2:124959112-124959134 TCTCTTCAACAAATGGTGTTGGG + Intergenic
938037605 2:128048494-128048516 CCTTTTCAACAAATAGTGCTGGG - Intergenic
938136235 2:128759300-128759322 TCTCCTCAGCAAATAGTGTTCGG - Intergenic
938394494 2:130932858-130932880 TCTCTTCAACACATGGTGTTTGG - Intronic
938953024 2:136274201-136274223 TCTCTTCAACAAATGGTGTTGGG + Intergenic
938999317 2:136715496-136715518 CCTATTCAATAAATAGTGTTGGG + Intergenic
940636702 2:156306510-156306532 TCTCTTCAACAAATGGTGTTAGG + Intergenic
941152733 2:161935118-161935140 TCTCTTCAACAAATGGTGTTGGG - Intronic
941702516 2:168619121-168619143 CCTATTCAACAAATAGTGCTGGG + Intronic
941743327 2:169059822-169059844 CCTATTCAATAAATAGTGTTGGG + Intergenic
941876614 2:170440089-170440111 TCTCTTCAACAAACAGTGTTAGG - Intronic
942336577 2:174893884-174893906 TCTCTTCAACAAACAGTGTTGGG + Intronic
942814580 2:180036381-180036403 TTTCTTCAACAAATAGTGTTGGG + Intergenic
942856327 2:180553904-180553926 CCCCTTCAGCAAATACTGTTGGG + Intergenic
942881397 2:180865508-180865530 TCTCTTCAACAAATAGTGTTGGG - Intergenic
943074976 2:183183370-183183392 TCTCTTCAACAAATAGTGTTGGG - Intergenic
943257491 2:185614527-185614549 CTTCTTCAACAAATGGTGTTTGG - Intergenic
943328287 2:186527883-186527905 TCTCTTCAACAAATGGTGTTGGG - Intergenic
943813378 2:192219227-192219249 CATCATGACCACATAGTGTTTGG - Intergenic
944196175 2:197055663-197055685 TCTTTTCACCAAATAGTGCTAGG - Intronic
944304142 2:198159138-198159160 CTTCTTCACAACATAGTGGTTGG + Intronic
944389303 2:199200809-199200831 CCTCTCCATCTGATAGGGTTTGG + Intergenic
944595804 2:201259504-201259526 ACTCTTCACCAGAGAGGGCTAGG - Intronic
944771996 2:202923884-202923906 CCTATTCAACAGATGGTGCTGGG + Intronic
945595516 2:211785651-211785673 TCTCTTCAACAAATGGTGTTGGG - Intronic
946454006 2:219806982-219807004 TCTCTTCAATAAATAGTGTTGGG - Intergenic
948043547 2:234924931-234924953 CCTATTCACTAAATAGTGCTGGG - Intergenic
1168737199 20:151234-151256 TCACTTCAACAGATGGTGTTGGG + Intergenic
1168870993 20:1128262-1128284 CCTTTTCAGCAGATAGAGCTAGG + Intronic
1169335683 20:4754374-4754396 CCTTTTCAACAAATGGTGTTGGG - Intergenic
1169600922 20:7259916-7259938 CCTCTTTACCTGGTAGTCTTGGG - Intergenic
1170629968 20:18057608-18057630 CCTCTTCACCAGGAAGACTTTGG + Exonic
1170748927 20:19126948-19126970 TCTCTTCAATAAATAGTGTTAGG - Intergenic
1171000567 20:21411194-21411216 CCTCTTCACTAAATGGTGCTGGG - Intergenic
1171751427 20:29053569-29053591 GCTCTTGACCAAATGGTGTTAGG - Intergenic
1171856803 20:30352525-30352547 GCTCTTGACCAAATGGTGTTAGG - Intergenic
1172761055 20:37322406-37322428 CCTCTTCAATAAATGGTGTTGGG - Intergenic
1174101851 20:48132885-48132907 CCTCTTCAATAAATAGTGGTGGG - Intergenic
1174341305 20:49897984-49898006 TCTCTTCACCAGATAGTGTTGGG + Intergenic
1174411072 20:50336179-50336201 CCTTTTCAACAGATCGTGCTGGG + Intergenic
1174622017 20:51882806-51882828 TCTCTTCAACAAATGGTGTTGGG + Intergenic
1175170634 20:57078132-57078154 TCTCTTCAACAAATTGTGTTGGG - Intergenic
1176313350 21:5217375-5217397 GCTCTTGACCAAATGGTGTTAGG + Intergenic
1176630690 21:9134685-9134707 TCTCTTCACCAAATTGTGCTGGG + Intergenic
1177128081 21:17221038-17221060 CCTATTCAACAAATGGTGTTGGG + Intergenic
1178324559 21:31633364-31633386 TCTCCTCAACAGATAGTGTCGGG - Intergenic
1178346902 21:31837170-31837192 TCTCTTCAACAGATGGTGCTGGG - Intergenic
1179948065 21:44693117-44693139 TCTCTTCAACAAATGGTGTTAGG + Intronic
1182682607 22:32093034-32093056 CCTATTCAACAAATAGTGCTGGG - Intronic
1183394854 22:37565988-37566010 CCTCTTCAGCTGCTAATGTTTGG + Intronic
949528082 3:4925909-4925931 CCTTTTCAACAAATGGTGTTGGG + Intergenic
949799584 3:7888888-7888910 CCTATTCAACAAATGGTGTTGGG + Intergenic
951334444 3:21404776-21404798 CCTCTTCAAAAAATAGTGCTGGG + Intergenic
952024327 3:29060259-29060281 CCTCTTCAACAAATAGTGCTGGG + Intergenic
952601881 3:35093483-35093505 CCTATTCAACAAATGGTGTTGGG + Intergenic
952624513 3:35388080-35388102 CCTCTTCAACTGAAAGAGTTTGG + Intergenic
952677197 3:36047373-36047395 CCTCTTCAACTAATGGTGTTGGG - Intergenic
952941340 3:38446677-38446699 CCTCTTCAATAAATAGTGCTGGG + Intergenic
953104655 3:39865061-39865083 CCTATTCAATAAATAGTGTTGGG + Intronic
953539874 3:43808229-43808251 CCTTTTCAACAAATGGTGTTGGG + Intergenic
953588273 3:44225531-44225553 TCTCTTCAGCAGACAGTGCTAGG - Intergenic
953615871 3:44490143-44490165 CCCATTCACCAGGTAATGTTAGG + Intergenic
955079201 3:55642166-55642188 CCTCTTTGCCTGATAGTGTAAGG - Intronic
955751887 3:62191757-62191779 CATGTTCACCAGACAGTGTGAGG - Intronic
956024327 3:64966316-64966338 TCTCTTCAACAGATGGTGCTAGG - Intergenic
956260962 3:67340837-67340859 CCTATTCAGTAAATAGTGTTGGG + Intergenic
957599363 3:82313291-82313313 CCTCTTCAATAAATAGTTTTGGG - Intergenic
958087922 3:88836444-88836466 CGTTTTCAACAGATGGTGTTGGG - Intergenic
958186511 3:90127295-90127317 TCTCTTCAACAAATGGTGTTGGG - Intergenic
958441490 3:94161556-94161578 CCTCTTCACTAGGCAGTATTTGG + Intergenic
958597704 3:96250737-96250759 CTTCTTCAACAAATAGTGTCAGG - Intergenic
958775255 3:98474948-98474970 CCTATTCAACAAATGGTGTTGGG - Intergenic
959955116 3:112228308-112228330 TCTCTTCAATAAATAGTGTTGGG + Intronic
960677297 3:120208085-120208107 CCTCTTCAATAAATGGTGTTGGG - Intronic
961053750 3:123768800-123768822 CCTGTTCACCAGACAGTGTATGG - Intronic
961956839 3:130813403-130813425 CCTCTTCAACAAATGGTGCTGGG + Intergenic
962030438 3:131594457-131594479 GCTCTTCAACAAATTGTGTTGGG + Intronic
962517204 3:136163382-136163404 CCTCTTCAGTGGATAGTGCTAGG - Intronic
962707175 3:138055320-138055342 TCTCTTCAACACATGGTGTTAGG + Intergenic
963176657 3:142304716-142304738 CCTATTCAACAAATAGTGCTGGG + Intergenic
963185066 3:142406262-142406284 CCTCTTCAATAAATGGTGTTGGG + Intronic
963436962 3:145283495-145283517 CCTCTTCAATACATGGTGTTAGG - Intergenic
964332110 3:155614692-155614714 CCTATTCAACAAATAGTGCTGGG + Intronic
964644237 3:158941327-158941349 CCTTTTCAACAAATAGTGCTGGG + Intergenic
964868005 3:161282746-161282768 GCTATTCAACAAATAGTGTTGGG + Intergenic
965124608 3:164609631-164609653 CCTCTTCAACAAATAATGCTCGG + Intergenic
965228182 3:166018749-166018771 CCTATTCAACAAATGGTGTTGGG - Intergenic
965274373 3:166662346-166662368 TCTCTTCAATAAATAGTGTTAGG - Intergenic
966091106 3:176137648-176137670 CCTATTCAACAAATAGTGCTGGG - Intergenic
966579837 3:181548216-181548238 TCTCTTCAACAGATGGTGTTGGG - Intergenic
966964343 3:184974789-184974811 CCTCTTCAGTAAATGGTGTTGGG - Intronic
967537626 3:190625103-190625125 CCTCTTCGCCATCCAGTGTTTGG + Intronic
967698167 3:192558860-192558882 TCTCTTTAACAAATAGTGTTGGG + Intronic
968740347 4:2326288-2326310 CCTCTTCAATAAATGGTGTTGGG - Intronic
969881398 4:10177164-10177186 CCTCTTCACCACCGAGTCTTGGG + Intergenic
972180141 4:36454658-36454680 CCTTTTCAACAAATAATGTTGGG - Intergenic
972873679 4:43331103-43331125 CTTCTACAGCAGATAGTGTTAGG - Intergenic
974372711 4:61038413-61038435 CCTATTCAACAAATGGTGTTGGG - Intergenic
974979848 4:68941398-68941420 CCTCTTCACTAAATGGTGCTAGG + Intronic
975234744 4:71979501-71979523 TCTCTTCAACAAATAGTGCTGGG - Intergenic
975301269 4:72794032-72794054 CCTCTGCAACAGATGGTGCTGGG + Intergenic
975308162 4:72872750-72872772 CCTATTTAACAGATGGTGTTGGG + Intergenic
975510159 4:75185824-75185846 CCTATTCAACAAATAGTGCTGGG + Intergenic
975790098 4:77939774-77939796 CCTATTCAACAAATAGTGCTGGG - Intronic
975833418 4:78394431-78394453 TCTCTTCAATAAATAGTGTTGGG - Intronic
975982067 4:80172323-80172345 CCTTTTTACAAGAAAGTGTTGGG + Intergenic
976013604 4:80522729-80522751 CTTCTTCAACAAATAGTGCTGGG - Intronic
976464334 4:85350640-85350662 CCTATTCAACAAATAGTGCTGGG - Intergenic
976804418 4:89029943-89029965 CCTGTTAACCAGGTAGTGCTGGG - Intronic
976869970 4:89779700-89779722 CCTATTCAACAAATGGTGTTGGG + Intronic
977304743 4:95309190-95309212 TCTCTTCAATAAATAGTGTTGGG + Intronic
977474319 4:97485951-97485973 CCTTTTCAACAAATTGTGTTGGG + Intronic
977697009 4:99976748-99976770 CCTATTCAACAAATGGTGTTGGG + Intergenic
977829111 4:101569371-101569393 CCTATTCAACAAATGGTGTTGGG + Intronic
977912851 4:102557882-102557904 CCTTTTTACCAGATACTGTAGGG + Intronic
978110464 4:104958348-104958370 CCTCTTCAATAAATGGTGTTGGG - Intergenic
978202436 4:106037910-106037932 ACTCTTAACATGATAGTGTTGGG + Intergenic
978391590 4:108232181-108232203 CCTATTCAACAGATAGTGCTGGG - Intergenic
978397775 4:108300280-108300302 CCTATTCAACAAATAGTGCTGGG - Intergenic
978655130 4:111056754-111056776 CCTCTTCAATAAATAGTGCTTGG + Intergenic
978724130 4:111950409-111950431 CCTATTCAATAAATAGTGTTGGG - Intergenic
978948902 4:114533127-114533149 CCTCTTCAATAAATGGTGTTGGG + Intergenic
978990275 4:115072596-115072618 TCTCTTCAATAAATAGTGTTAGG + Intronic
979131083 4:117045574-117045596 TCTCTTGAACAAATAGTGTTGGG - Intergenic
979141402 4:117180615-117180637 CCTATTTACCAAATGGTGTTGGG - Intergenic
979498753 4:121414553-121414575 CCTCTTCAACAAATGGTGCTGGG - Intergenic
980005525 4:127538024-127538046 ACTCTTCAACAAATGGTGTTGGG + Intergenic
980025281 4:127758703-127758725 CCTATTCAACAAATAGTGCTGGG - Intronic
982525218 4:156469121-156469143 TCTCTTCAACAAATGGTGTTGGG + Intergenic
982640758 4:157956953-157956975 CCTATTCAACAGATGGTGCTGGG + Intergenic
982656299 4:158153764-158153786 CCTATTCAACAAATGGTGTTGGG + Intronic
982958045 4:161795689-161795711 TCTCTTCAACAAATAGTGCTGGG - Intronic
984337566 4:178412694-178412716 TCTTTTCAGCAAATAGTGTTAGG + Intergenic
985483302 5:132625-132647 CCTATTCAACAGATAGTGCTGGG - Intergenic
985826773 5:2197905-2197927 CCTCTTCATCAGAGACTGTGGGG - Intergenic
986097004 5:4567857-4567879 CCTCTTCAGCAAATGGTGCTGGG + Intergenic
986788123 5:11133959-11133981 CCCCTTCCCCAGTTAGTATTTGG - Intronic
987185533 5:15413862-15413884 CCTTTTCAACAGATAGTGCTGGG + Intergenic
988239005 5:28583969-28583991 CCTCTTCAACAAATGATGTTAGG + Intergenic
988955775 5:36316861-36316883 TCTCTTCAACAAACAGTGTTGGG - Intergenic
989958483 5:50382532-50382554 TCTCTTCCACAAATAGTGTTAGG + Intergenic
990593437 5:57289757-57289779 TCTCTTCAATACATAGTGTTGGG + Intergenic
991541565 5:67735319-67735341 TCTCTTCAACAAATAGTGTTGGG + Intergenic
992026783 5:72677881-72677903 CCTCTTCAACAAATAGTGCTGGG - Intergenic
992308773 5:75472184-75472206 TCTCTTTAACAAATAGTGTTAGG + Intronic
992545139 5:77806671-77806693 CCTCTTCAGTAAATAGTGCTGGG - Intronic
992630352 5:78674358-78674380 CCTTTTCAGCAAATAGTGCTGGG - Intronic
993337074 5:86673304-86673326 TCTCTTCAGCAAATGGTGTTGGG + Intergenic
993419911 5:87688209-87688231 TCTCTTCAACAAATGGTGTTGGG - Intergenic
994377953 5:99037088-99037110 CATTTTCACCAAATAGTTTTTGG - Intergenic
994555325 5:101292358-101292380 CCTATTCAACAGATGGTGCTGGG + Intergenic
994625218 5:102209848-102209870 TCTCTTCAATAAATAGTGTTTGG + Intergenic
994656752 5:102603706-102603728 CCTATTCAATAAATAGTGTTGGG - Intergenic
995087422 5:108129430-108129452 ACTTTTCAACAGATAGTGGTAGG - Intronic
995301066 5:110583402-110583424 TCTCTTCAACAAATGGTGTTGGG + Intronic
995386255 5:111592966-111592988 CCTATTCAATAAATAGTGTTGGG + Intergenic
995421426 5:111971632-111971654 CCTCTTCAGTAAACAGTGTTGGG + Intronic
995935698 5:117510321-117510343 TCTCTTCAACAAATGGTGTTGGG + Intergenic
996123649 5:119700590-119700612 CCTATTCAACAAATGGTGTTGGG - Intergenic
996438692 5:123464578-123464600 TCTCTTCAACAAATGGTGTTAGG - Intergenic
996495514 5:124150444-124150466 CCTATTCACCAAATGGTGCTAGG + Intergenic
996597185 5:125218676-125218698 TCTCTTCAACAAATGGTGTTGGG + Intergenic
996614479 5:125424196-125424218 CCTTATCACCAAATAGAGTTAGG + Intergenic
996782610 5:127204251-127204273 TCTCTTCAACAAATGGTGTTGGG + Intergenic
997003663 5:129793142-129793164 CCTATTCAACAAATAGTGCTTGG - Intergenic
997017290 5:129951150-129951172 CCTCTTTAATAAATAGTGTTAGG + Intronic
997577347 5:134991555-134991577 TCTCTTCAACAAATAGTATTTGG + Intronic
997842259 5:137252660-137252682 CCTCTTCATCTGAGAGTGGTAGG + Intronic
999362660 5:150998920-150998942 ACTCATCAACAGATACTGTTTGG - Intergenic
1000432877 5:161171364-161171386 CCTCTTCAATAAATAGTGTTGGG - Intergenic
1000511222 5:162185729-162185751 CCTGTTCAACAAATAGTGCTTGG - Intergenic
1000592814 5:163179070-163179092 CCTTTTCACCAAATGGTGTTGGG - Intergenic
1001461393 5:171918051-171918073 TCTCTTCACCAAATACTTTTGGG + Intronic
1001878595 5:175222650-175222672 CATCTTCACCACAAAGTGCTTGG + Intergenic
1003466781 6:6387982-6388004 TCTCTTCAACAAATGGTGTTGGG - Intergenic
1004593033 6:17071943-17071965 CCTATTCAACAAATGGTGTTGGG - Intergenic
1005193131 6:23251261-23251283 CCTTTTCAAAAAATAGTGTTAGG - Intergenic
1005558891 6:27017616-27017638 CCTCTTCAATAAATGGTGTTGGG + Intergenic
1006274485 6:32991425-32991447 CCTATTCAATAGATAGTGCTGGG - Intergenic
1007896098 6:45360688-45360710 CTTCTTCTCCTGAGAGTGTTTGG - Intronic
1009395508 6:63194706-63194728 CCTTTTCAACAAATAGTGTTGGG - Intergenic
1009871183 6:69453570-69453592 CTTCTTCAACAAATGGTGTTGGG - Intergenic
1010050315 6:71496552-71496574 CCTCTAAACCACATAGAGTTTGG + Intergenic
1010471954 6:76239036-76239058 TCTCTTTAACAAATAGTGTTGGG + Intergenic
1010598396 6:77793014-77793036 TCTCTTCAATAAATAGTGTTGGG - Intronic
1010632280 6:78212418-78212440 TCTTTTCACCAAATGGTGTTAGG - Intergenic
1010878855 6:81143031-81143053 CCTATTCAATAAATAGTGTTGGG + Intergenic
1010923261 6:81711147-81711169 CCTATTCACCAAATGGTGCTGGG + Intronic
1010998082 6:82556442-82556464 CCTCTTCCCTGGATATTGTTTGG - Intergenic
1011045342 6:83075752-83075774 CCTCTTCACCAGATAGTGTTGGG + Intronic
1012189567 6:96262557-96262579 CCTCTTCAATAAATAGTGCTGGG + Intergenic
1012923149 6:105240488-105240510 CCTTTTCAACAGATGGTGCTGGG + Intergenic
1013345238 6:109253770-109253792 CCTCTTCAGCAGTTAGTGTCTGG + Intergenic
1013568947 6:111400970-111400992 CCTTTTCAACAAATAGTGCTGGG - Intronic
1014059668 6:117056554-117056576 CTTCTTCAACAGATAGTACTGGG - Intergenic
1016218317 6:141631076-141631098 TCTCTTCAGCAAATGGTGTTGGG + Intergenic
1016349895 6:143155757-143155779 CCTCTTCACCAGACTATGTGTGG - Intronic
1017181634 6:151558625-151558647 CCTCTTCAATAAATGGTGTTGGG - Intronic
1017534872 6:155336298-155336320 CCTTTTCAACAAATGGTGTTGGG - Intergenic
1021756034 7:23853763-23853785 TCTTTTCAACAAATAGTGTTGGG + Intergenic
1021768554 7:23974156-23974178 TCTCTTCAATAAATAGTGTTGGG - Intergenic
1021778492 7:24077912-24077934 CCTTTTCAACAAATAGTGCTGGG - Intergenic
1021779506 7:24088929-24088951 CCTTTTCAACAAATAGTGCTGGG - Intergenic
1022467739 7:30662688-30662710 CCTCTTCATCGGATGGTGTGAGG - Exonic
1023115071 7:36854844-36854866 CCTCCTCACCAGCTAGTCTGGGG - Exonic
1023144810 7:37139975-37139997 CCTATTCAACAAATGGTGTTGGG + Intronic
1024144194 7:46495015-46495037 TCTTTTCAGCAAATAGTGTTGGG + Intergenic
1024327610 7:48122799-48122821 CCTATTCAACAAATAGTGCTGGG - Intergenic
1024450625 7:49538449-49538471 TCTCTTCAATAAATAGTGTTGGG + Intergenic
1024765256 7:52650106-52650128 CCTATTCACTAGATGGTGCTGGG + Intergenic
1026811425 7:73469532-73469554 CCTCATCACCAGAGACTGTGTGG + Exonic
1027147697 7:75708583-75708605 TTTTTTCACCAGATAGTGCTGGG - Intronic
1027328568 7:77066936-77066958 CCTTTTCAACAAATAGTGCTGGG - Intergenic
1027455298 7:78383826-78383848 CCTCTTCAATACATAGTGCTGGG - Intronic
1027550220 7:79583689-79583711 ACTCTTCAACAAATGGTGTTGGG - Intergenic
1027818080 7:83004413-83004435 TCTCTTCAACAGGTGGTGTTGGG + Intronic
1028672317 7:93416691-93416713 CCTCTTCAACAAATGGTGTTGGG - Intergenic
1029595848 7:101537360-101537382 CCTCTGCACCAGAGACTGCTGGG - Intronic
1029787197 7:102804441-102804463 CCTTTTCAACAAATAGTGCTGGG + Intronic
1030425775 7:109375401-109375423 CCTATTCAACAAATAGTGCTGGG + Intergenic
1030443637 7:109621212-109621234 GCTCTTTGCCAGATAGTGCTTGG - Intergenic
1030546635 7:110904482-110904504 TCTCTTCAACAAATGGTGTTGGG - Intronic
1031079536 7:117244859-117244881 TCTCTTCAACAAATGGTGTTGGG + Intergenic
1031139393 7:117925160-117925182 CCTATTCAACAAATAGTGCTGGG + Intergenic
1031651186 7:124291772-124291794 TCTCCTCAACAAATAGTGTTGGG - Intergenic
1031654930 7:124343149-124343171 CCTCTTCACCACACACTGTGGGG + Intergenic
1031825973 7:126565944-126565966 TCTTTTCAACAAATAGTGTTGGG + Intronic
1033608429 7:142943873-142943895 CCTCTTCCCCAGATACAGCTTGG - Exonic
1034110581 7:148533871-148533893 CCTATTCAACAAATAGTGCTGGG + Intergenic
1035943158 8:3927414-3927436 CCTCGGCACCACAAAGTGTTGGG - Intronic
1036044788 8:5127639-5127661 CCTCTTCAATAAATGGTGTTGGG - Intergenic
1036072778 8:5460205-5460227 CCTCTTCACCACATATGGTAAGG + Intergenic
1036985829 8:13529885-13529907 GCTCTTCACAGTATAGTGTTAGG - Intergenic
1037025339 8:14028590-14028612 CCTCTTCAATAAATAGTGCTGGG + Intergenic
1037320426 8:17636349-17636371 CCTATTCACCAAATGGTGCTGGG - Intronic
1038121632 8:24623204-24623226 CCTATTCAACACATGGTGTTGGG + Intergenic
1039398878 8:37251046-37251068 TCTCTTCAACAGATGGTGCTAGG + Intergenic
1039656493 8:39414134-39414156 TCTCTTTAACAAATAGTGTTGGG + Intergenic
1039749883 8:40468419-40468441 CCTTTTCAACAAATAGTGCTTGG + Intergenic
1040035048 8:42861822-42861844 CATCTTCACCAAATACTGTTAGG + Exonic
1040583896 8:48721709-48721731 TCTCTTCACAAAATGGTGTTGGG + Intronic
1040711349 8:50192882-50192904 CCTTTTCAACAAATAGTGCTGGG - Intronic
1041069122 8:54109601-54109623 TCTCTTCAGTAAATAGTGTTGGG - Intergenic
1041266034 8:56065821-56065843 TCTCTTCAACAAATAGTGTTGGG + Intergenic
1041305820 8:56458185-56458207 TCTCTCCAACAGATGGTGTTGGG - Intergenic
1041879021 8:62725584-62725606 TCTCTTCAACAAATTGTGTTGGG - Intronic
1042122375 8:65502309-65502331 CCTTTTCAACAAATAGTGCTGGG - Intergenic
1042469644 8:69170227-69170249 TCTCTTCAACAAATAGTGTTGGG - Intergenic
1042493892 8:69434607-69434629 CCTCTTCAATAAATAGTATTGGG + Intergenic
1042637035 8:70888686-70888708 CCTCTTCAAAAAATAGTGCTGGG - Intergenic
1043794042 8:84512760-84512782 CCTCTTCAACAAATGGTGCTGGG - Intronic
1044036130 8:87305663-87305685 CCTCTTCAACAAATGGTGTTGGG + Intronic
1044156074 8:88848921-88848943 CCTCTTTAATAAATAGTGTTGGG + Intergenic
1044174571 8:89102764-89102786 TCTCTTCAACAAATGGTGTTGGG + Intergenic
1044426081 8:92051987-92052009 CCTCTTCACCAGATGGTGCCAGG + Intronic
1045057121 8:98378849-98378871 TCTCTTCACCAGATGGGCTTTGG + Intergenic
1045122642 8:99054808-99054830 ACTCTTCAACAAATAGTGCTTGG - Intronic
1045846727 8:106645696-106645718 CATCTTTCCCAGATTGTGTTTGG + Intronic
1046640465 8:116724215-116724237 TCTCTTCAACAGATGGTGCTAGG + Intronic
1047271606 8:123365677-123365699 CCTATTCATCAGATGGTGCTGGG + Intronic
1047558461 8:125960101-125960123 CCTCTTCAACAAATGGTGCTGGG - Intergenic
1048041860 8:130738038-130738060 CCTATTCAATAAATAGTGTTGGG + Intergenic
1048658060 8:136564757-136564779 GCTTTTCACTAAATAGTGTTGGG + Intergenic
1049862206 8:144907167-144907189 CCTCTTCCCCACAAAGTGCTGGG + Intergenic
1050503208 9:6320407-6320429 CCTTTTCAACAAATAGTGCTGGG + Intergenic
1051764160 9:20503453-20503475 CCTCTTCAATAAATGGTGTTAGG + Intronic
1052186132 9:25596520-25596542 TTTCTTCAACAGATAGTGTTGGG - Intergenic
1052478009 9:28986089-28986111 CCTCTTCAATAAATGGTGTTGGG - Intergenic
1052549905 9:29934747-29934769 CCTTTTCAACAAATAGTGCTGGG - Intergenic
1052723118 9:32196689-32196711 CCTCTTCATTAAATAGTGATAGG - Intergenic
1053722911 9:40966058-40966080 GCTCTTGACCAAATGGTGTTAGG - Intergenic
1054343057 9:63885941-63885963 GCTCTTGACCAAATGGTGTTAGG + Intergenic
1054914306 9:70481739-70481761 CTGCTTCACCAGTGAGTGTTTGG - Intergenic
1055855690 9:80684887-80684909 CCTCTTCAACAAATGATGTTGGG + Intergenic
1056130334 9:83579541-83579563 CCTCTTCAACAAATGGTGCTGGG + Intergenic
1056219358 9:84435918-84435940 CCTCATCTCCTGATTGTGTTGGG + Intergenic
1056948507 9:91022550-91022572 CCTATTCACCAAATAGTGCTGGG + Intergenic
1057242729 9:93426483-93426505 CTTCTACACAACATAGTGTTAGG - Intergenic
1057579751 9:96276664-96276686 TCTCTTCAACAAATGGTGTTGGG + Intronic
1057959668 9:99442210-99442232 CCTATTCAACAAATGGTGTTGGG + Intergenic
1059866895 9:118524711-118524733 TCTCTTCAACAAACAGTGTTGGG + Intergenic
1059979141 9:119750439-119750461 TCTCTTCAACAAATAGTGTGGGG - Intergenic
1060560783 9:124540883-124540905 TCTCTTCAACAAATAGTGCTGGG + Intronic
1060907899 9:127324389-127324411 GCTCTTCCCCAGAGAGTCTTGGG + Intronic
1061525225 9:131155711-131155733 CCTATTCAACAAATAGTGCTGGG - Intronic
1061668934 9:132177531-132177553 GCTCTTCAACAAATAGTGTTGGG - Intronic
1061688391 9:132303541-132303563 GCTCTTCAAAAGATACTGTTAGG + Intronic
1203753520 Un_GL000218v1:102384-102406 TCTCTTCACCAAATTGTGCTGGG + Intergenic
1203452249 Un_GL000219v1:129920-129942 GCTCTTGACCAAATGGTGTTAGG + Intergenic
1186195138 X:7103316-7103338 TCTCTTCAACAAACAGTGTTGGG + Intronic
1186716342 X:12256002-12256024 CCTGTGCACCTGATAATGTTAGG - Intronic
1187118671 X:16381436-16381458 TCTCTTCAACAAATAGTGTTGGG + Intergenic
1187214219 X:17260274-17260296 CCTCTTCAATAAATAGTGCTGGG + Intergenic
1187375673 X:18751421-18751443 TCTCTTCAACAGATGGTGCTGGG - Intronic
1187794170 X:22983359-22983381 TCTCTTCAACAAACAGTGTTGGG + Intergenic
1188921409 X:35982690-35982712 CCTATTCAACAAATAGTGCTAGG - Intronic
1189192131 X:39119401-39119423 CCTCTTCACCAGCTATGCTTGGG - Intergenic
1189210961 X:39281750-39281772 CCTATTCAATACATAGTGTTAGG + Intergenic
1189957445 X:46289759-46289781 TCTCTTCAACAAATAGTGTTGGG - Intergenic
1190428602 X:50356126-50356148 CCTATTCAACAAATGGTGTTGGG - Intergenic
1190724937 X:53183066-53183088 TCTCTTCAACAGATGGTGCTGGG - Intergenic
1191640425 X:63425591-63425613 CCTCTTAATCAGATAGTGAAAGG + Intergenic
1192068706 X:67914273-67914295 CCTTTTCAACAAATAGTGCTGGG - Intergenic
1192254600 X:69444613-69444635 TGTCTTCAACAAATAGTGTTGGG + Intergenic
1192607398 X:72533094-72533116 CCTCTTCAACAAATGGTGCTGGG - Intronic
1192664533 X:73074684-73074706 CCTCTTCAATAAATGGTGTTGGG - Intergenic
1192671678 X:73150774-73150796 CCTATTCAACAAATAGTGCTGGG - Intergenic
1192749394 X:73972988-73973010 CCTCTTCAGTAAATGGTGTTGGG - Intergenic
1192820642 X:74641593-74641615 CCTTTTCAACAAATGGTGTTGGG + Intergenic
1193305090 X:79940164-79940186 TCTCTTCAATAAATAGTGTTGGG - Intergenic
1193462246 X:81805480-81805502 CCTCTTCAATAAATAGTGCTGGG - Intergenic
1193782893 X:85724427-85724449 CCTCTTCAATAGATGGTGCTGGG - Intergenic
1193784969 X:85749853-85749875 CCTTTTCAACAAATGGTGTTGGG - Intergenic
1193825522 X:86221292-86221314 TCTCTTCAACAAATAATGTTGGG - Intronic
1193827893 X:86248963-86248985 CCTATTCAATAAATAGTGTTGGG + Intronic
1194094921 X:89627529-89627551 CCTATTCAACAAATGGTGTTGGG - Intergenic
1194601728 X:95929475-95929497 CCTATTCAACAGATGGTGCTGGG + Intergenic
1194791155 X:98151703-98151725 TCTCTTCAACAAATAGTGTTGGG - Intergenic
1194982777 X:100457534-100457556 CCTATTCAACAAATAGTGCTGGG + Intergenic
1195464658 X:105167226-105167248 TCTCTTCATCACAGAGTGTTGGG - Intronic
1195556517 X:106231647-106231669 CCTATTCAACAAATAGTGCTGGG + Intergenic
1195686703 X:107593627-107593649 CCTTTTCAACAAATGGTGTTGGG - Intronic
1195999446 X:110765534-110765556 CCTTTTCAACAAATAGTGCTGGG - Intronic
1196297016 X:114009785-114009807 TCTCTTCAACAAATAGTGATGGG - Intergenic
1197418891 X:126212127-126212149 TCTCTTCAACAAATGGTGTTGGG + Intergenic
1197571755 X:128158431-128158453 CCTATTCAACAAATGGTGTTGGG - Intergenic
1198171698 X:134112552-134112574 TCTCTTCAAAAAATAGTGTTGGG - Intergenic
1198222517 X:134615807-134615829 TCTCTTCAACAAATGGTGTTGGG - Intronic
1198515932 X:137406776-137406798 CCTCTTCAACAAATAGTTCTAGG - Intergenic
1198583286 X:138091171-138091193 CCTATTCAACAAATGGTGTTGGG + Intergenic
1198584224 X:138102012-138102034 CCTCTTCACTACATGGTGCTGGG + Intergenic
1198781815 X:140246110-140246132 CCTTTTCAACAAATAGTGCTGGG - Intergenic
1199264331 X:145812805-145812827 CCTCTTCACCTGATTATGGTAGG - Intergenic
1199896289 X:152130687-152130709 CCTCTACCCCAGACAGTGTCTGG + Intergenic
1200447553 Y:3283682-3283704 CCTATTCAACAAATGGTGTTGGG - Intergenic
1200948880 Y:8872761-8872783 CCTCTTTAACAAATGGTGTTGGG - Intergenic
1200957941 Y:8970368-8970390 CCTGTGCACCAGAGAGTGTCTGG - Intergenic
1201167164 Y:11219946-11219968 TCTCTTCACCAAATTGTGCTGGG + Intergenic
1201384838 Y:13428419-13428441 CCTATTCAATAAATAGTGTTGGG - Intronic
1201708278 Y:16960726-16960748 CCTGTTTAACAAATAGTGTTGGG + Intergenic
1201924377 Y:19268720-19268742 CCTCTTCATAAGAAAGTATTTGG + Intergenic
1202012185 Y:20355319-20355341 CCTCTTCAATAAATGGTGTTAGG + Intergenic