ID: 1011050311

View in Genome Browser
Species Human (GRCh38)
Location 6:83140656-83140678
Sequence TCTTTACCACAGATTCCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 198}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011050308_1011050311 0 Left 1011050308 6:83140633-83140655 CCCAGTCCAATTTTTGAATATGT 0: 1
1: 0
2: 2
3: 33
4: 413
Right 1011050311 6:83140656-83140678 TCTTTACCACAGATTCCTCATGG 0: 1
1: 0
2: 2
3: 19
4: 198
1011050307_1011050311 1 Left 1011050307 6:83140632-83140654 CCCCAGTCCAATTTTTGAATATG 0: 1
1: 0
2: 3
3: 42
4: 336
Right 1011050311 6:83140656-83140678 TCTTTACCACAGATTCCTCATGG 0: 1
1: 0
2: 2
3: 19
4: 198
1011050310_1011050311 -6 Left 1011050310 6:83140639-83140661 CCAATTTTTGAATATGTTCTTTA 0: 1
1: 0
2: 6
3: 94
4: 988
Right 1011050311 6:83140656-83140678 TCTTTACCACAGATTCCTCATGG 0: 1
1: 0
2: 2
3: 19
4: 198
1011050309_1011050311 -1 Left 1011050309 6:83140634-83140656 CCAGTCCAATTTTTGAATATGTT 0: 1
1: 1
2: 2
3: 87
4: 2280
Right 1011050311 6:83140656-83140678 TCTTTACCACAGATTCCTCATGG 0: 1
1: 0
2: 2
3: 19
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011050311 Original CRISPR TCTTTACCACAGATTCCTCA TGG Intronic
901399736 1:9007512-9007534 TCTTGCCCACAGAGCCCTCAAGG - Intronic
904477993 1:30776895-30776917 TCTTGTCCCCAGACTCCTCAGGG + Intergenic
906296883 1:44654359-44654381 TGCTTACCACAGAATCCTAAGGG - Exonic
906372296 1:45264453-45264475 TCTGCACCTCAGTTTCCTCATGG + Intronic
907811364 1:57873721-57873743 TCTGTGCCTCAGTTTCCTCATGG + Intronic
908389303 1:63670506-63670528 TGTTTCTCACAGATGCCTCAAGG + Intergenic
908563621 1:65331854-65331876 TCTGTGCCTCAGTTTCCTCATGG - Intronic
908752382 1:67436656-67436678 TGTTTACCACAGAATCCTCAGGG - Intergenic
909333087 1:74438551-74438573 CCTGGACCTCAGATTCCTCAAGG - Intronic
909513573 1:76482618-76482640 TCTGAACCTCAGTTTCCTCATGG - Intronic
911483982 1:98482542-98482564 TATTTACCACAATTTCCTCCAGG - Intergenic
914926418 1:151892661-151892683 TCTGTGCCTCAGTTTCCTCATGG - Intronic
916295563 1:163215712-163215734 TCTTTCCCCCAGTTTCCTAAGGG + Intronic
916479453 1:165201972-165201994 TCTTTACCACAGAAACCTGTGGG + Exonic
918591205 1:186243672-186243694 TCTGTTCCACAGAGTCCTCAGGG + Intergenic
921061773 1:211591365-211591387 TCTGTGCCTCAGTTTCCTCACGG + Intergenic
922776094 1:228214815-228214837 CCTTTACCACAGGATCCACAGGG - Exonic
923286610 1:232502170-232502192 TCTTAACCTCAGAATCCTCCCGG + Intronic
923355330 1:233149496-233149518 TCTCTGCCTCAGATGCCTCAGGG - Intronic
923375660 1:233359485-233359507 TCTTGTCCACAGATTGCTTAAGG + Intronic
924150201 1:241122290-241122312 TGTGTACCACAGATACCACAGGG + Intronic
924544427 1:245012022-245012044 TGTTTAACACTCATTCCTCAAGG - Intronic
1063437549 10:6046796-6046818 TCTTTTCAACAGATACCTCAGGG + Intronic
1063557662 10:7096454-7096476 TCTTTTCCAGAGCCTCCTCAAGG - Intergenic
1066601886 10:37118027-37118049 TCTTTACCACTCATTACCCAGGG + Intergenic
1068047728 10:51909120-51909142 TATTTACAACAGAAACCTCAGGG - Intronic
1068960671 10:62863562-62863584 TCTTATCCAGAGATCCCTCAAGG + Intronic
1069767156 10:70871093-70871115 TCTACCCCACAGTTTCCTCATGG + Exonic
1072314347 10:94187610-94187632 GCTTGGCCACAGATTCCTCAAGG + Intronic
1072474324 10:95744924-95744946 TGATTACCAAAGATTCATCAGGG - Intronic
1075025580 10:118980804-118980826 TCTGTACCTCAGTTTCCTCATGG + Intergenic
1076052084 10:127343376-127343398 TCTCTGCCTCAGTTTCCTCATGG - Intronic
1078004383 11:7521722-7521744 TATCTACCACAGACTCCTCCTGG - Intronic
1078281809 11:9909692-9909714 TTTTTACCACAAAGTCGTCAGGG - Intronic
1079080333 11:17409381-17409403 TCCTGATCACTGATTCCTCAAGG + Intronic
1079426646 11:20349157-20349179 TATTTACCAAAGATTACCCAGGG - Intergenic
1080389770 11:31834248-31834270 TCTTTCCCACTCATTCTTCAAGG - Intronic
1080801835 11:35617523-35617545 TCTGTGCCTCAGTTTCCTCATGG + Intergenic
1081139361 11:39478328-39478350 TCTGTACCACAAATCCTTCAAGG + Intergenic
1081300980 11:41450917-41450939 TCCCAACCACAAATTCCTCAGGG + Intronic
1082867963 11:57917099-57917121 TCTGTGCCCCAGATTCCTAAGGG + Intergenic
1087833983 11:102851460-102851482 CCATTACCACAGATTTGTCAGGG - Intergenic
1087876278 11:103361831-103361853 TCCTAACTAAAGATTCCTCAAGG - Intronic
1091338015 11:134787058-134787080 TTTTTACCACATATGTCTCATGG + Intergenic
1093778132 12:23101098-23101120 TCTTTCCCCCATGTTCCTCATGG + Intergenic
1094011600 12:25815801-25815823 TCTTTCCTAGAGCTTCCTCATGG + Intergenic
1095240512 12:39853364-39853386 TCTTTATGACAGATTTCTCAGGG + Intronic
1095486029 12:42685554-42685576 CCTTTACAACAGATTCTTCAGGG - Intergenic
1095593931 12:43937795-43937817 TCTTTACCACTATGTCCTCATGG - Intronic
1095637231 12:44448857-44448879 TCTTGACCAGAGAATCCTGAAGG - Intergenic
1095862141 12:46929343-46929365 TCTTAAATACAGATACCTCAAGG + Intergenic
1096725540 12:53558861-53558883 TTTTTACCAAAGATGTCTCATGG - Intronic
1098850240 12:75587567-75587589 TTGTTGCAACAGATTCCTCAGGG - Intergenic
1098854322 12:75635000-75635022 TCTTTATCACAAATTACTAAAGG + Intergenic
1099649864 12:85412129-85412151 GCTTTACCAAATATTCCACAGGG + Intergenic
1100685238 12:96980375-96980397 TCTATGCCTCAGCTTCCTCATGG + Intergenic
1101508311 12:105369182-105369204 TCTCAACCACAGTTTTCTCATGG + Intronic
1103224805 12:119277536-119277558 TCATCACCACTGATTACTCAAGG - Intergenic
1103316615 12:120061188-120061210 TTTTTGCCACTCATTCCTCAAGG - Intronic
1105738260 13:23294754-23294776 TCTCTTCCTCAGCTTCCTCATGG + Intronic
1107613276 13:42138427-42138449 TCTTTACCACTGAATCCTCAAGG + Intronic
1107877463 13:44803390-44803412 TCATTAAAGCAGATTCCTCAAGG - Intergenic
1109597796 13:64579235-64579257 AGTTTACTTCAGATTCCTCAAGG - Intergenic
1109973076 13:69795881-69795903 TCTTCCCCACAGATTTTTCAAGG + Intronic
1110444783 13:75567252-75567274 TCATTGACACAGATTCCTCCAGG - Exonic
1110952327 13:81512052-81512074 ACATTACCACATATTCCTTAAGG - Intergenic
1111676664 13:91397057-91397079 TCTGTACCACAGAATAGTCAAGG + Intergenic
1112246782 13:97742611-97742633 TCTTAACCACAGATTCTTATTGG + Intergenic
1112578357 13:100657410-100657432 TCTTTCCCACATTTTCCACATGG + Intronic
1113445254 13:110361379-110361401 TCTTTCCCACAGCTTCCCCTGGG + Intronic
1117502497 14:56367387-56367409 CCTTTACAACAGATCCCACAGGG + Intergenic
1117718220 14:58602495-58602517 TTTTTACTACTCATTCCTCATGG - Intergenic
1117874826 14:60241228-60241250 TCTTTACCAAAGATGCCTTGGGG - Intergenic
1122010265 14:98740697-98740719 TCTTTAGCACAGATAACTCCTGG + Intergenic
1122815537 14:104310333-104310355 TCTCTCCCACAGATCACTCAGGG - Intergenic
1123454523 15:20408020-20408042 TCTTTCTAACAGTTTCCTCAAGG - Intergenic
1127613018 15:60655543-60655565 TGTATACCAAACATTCCTCAAGG - Intronic
1129048019 15:72754216-72754238 TCTAATCCACAGATTCCACAGGG + Intronic
1131585757 15:93690979-93691001 TCCATACCACATATTCATCACGG - Intergenic
1133404232 16:5510158-5510180 TCTGTGCCTCAGTTTCCTCATGG + Intergenic
1135148406 16:19983860-19983882 TATTTACCATAGACTCCCCAGGG - Intergenic
1135796425 16:25447506-25447528 TCTTTAGCAGATATTCTTCATGG - Intergenic
1136717610 16:32296525-32296547 TCTTTACCACTTATTACCCAAGG + Intergenic
1136835986 16:33502789-33502811 TCTTTACCACTTATTACCCAAGG + Intergenic
1137494860 16:48961868-48961890 TCTTTACAGCACCTTCCTCAAGG + Intergenic
1139258856 16:65572678-65572700 TCTATACCTCAGAATCCTCTGGG + Intergenic
1139496709 16:67325671-67325693 TCTTTCCCAAAGACTACTCAGGG + Intronic
1141629399 16:85278524-85278546 TGTTTACCCCAGATTTTTCAGGG + Intergenic
1203008818 16_KI270728v1_random:221249-221271 TCTTTACCACTTATTACCCAAGG - Intergenic
1203146163 16_KI270728v1_random:1803110-1803132 TCTTTACCACTTATTACCCAAGG + Intergenic
1144953006 17:19004159-19004181 TCTTTCCCGCAGATTGCTCATGG - Exonic
1154474445 18:14742418-14742440 TCTTTACCACTCATTACCCAGGG + Intronic
1155552183 18:26976263-26976285 TCTTCATATCAGATTCCTCAGGG - Intronic
1156047532 18:32893941-32893963 TCTTTACCACTGAGAGCTCAGGG + Intergenic
1160631413 18:80248398-80248420 ACTTCATCACAAATTCCTCAAGG - Intergenic
1161217082 19:3099925-3099947 TCTGTGCCTCAGTTTCCTCAGGG + Intronic
1162498755 19:11038864-11038886 TGTTTAAGACAGATTCCTCATGG - Intronic
1162940743 19:14007312-14007334 TCTGTGCCTCAGTTTCCTCAAGG + Intergenic
1164589427 19:29498219-29498241 GCTTTCCCATAGAGTCCTCATGG + Intergenic
1166650737 19:44572458-44572480 TCTTTGCCTCAGATTCTGCATGG + Intergenic
1167147611 19:47692536-47692558 TCTTCATCACAGATTCCTGGAGG + Intronic
1167375505 19:49108824-49108846 TCTCTGCCACACATTCCTCAGGG + Intergenic
1168694674 19:58397523-58397545 TCCTCACCACAGATTCCTGGGGG + Intergenic
926480826 2:13391573-13391595 TCTTTCTAACAGTTTCCTCAAGG + Intergenic
927390445 2:22588945-22588967 TCTTAACCACGGATTCCTTCAGG + Intergenic
928498811 2:31864922-31864944 TCTTTAACATACATTTCTCAAGG + Intergenic
929904316 2:46032909-46032931 TCTTTCCCAAAAATTCATCATGG + Intronic
932302514 2:70677160-70677182 TATTTAAAACAAATTCCTCAGGG - Intronic
933032176 2:77342558-77342580 TCTAGAACACAGATTCTTCATGG + Intronic
933283378 2:80357165-80357187 TCATCACCACAGATCCCTGAAGG + Intronic
937073164 2:119080670-119080692 TCCTTAGGACAGATTCCTAAAGG - Intergenic
938761177 2:134427515-134427537 TCTTTAGCATAGAAACCTCAAGG + Intronic
939754869 2:146097812-146097834 TCTTTTCCACAGATTGCAAAGGG + Intergenic
943534247 2:189127265-189127287 TCTGGACCACAGATTTCTGATGG + Intronic
945712052 2:213309201-213309223 TAGTTGCCACAGAGTCCTCATGG - Intronic
947118298 2:226794880-226794902 TCTTTCCCACTGCTTCCTCAGGG - Intronic
947408761 2:229811282-229811304 TCCTAACCCCAGATTCTTCAAGG + Intronic
948794627 2:240395982-240396004 TCTTTACAACAGATCCTTTAAGG - Intergenic
1171302177 20:24073041-24073063 TCTTTCCCACTGATCCCTGAGGG + Intergenic
1173315358 20:41938337-41938359 TCTGCAGCACAGATTCTTCACGG + Intergenic
1173860673 20:46281255-46281277 TGTTCACCACAGCCTCCTCAAGG - Intronic
1174410829 20:50334065-50334087 TGTTTCCCATAAATTCCTCATGG + Intergenic
1179472988 21:41624217-41624239 TCGTTTCCACAGAGGCCTCATGG + Intergenic
1182948164 22:34344590-34344612 CCCTTATCACAGAATCCTCATGG + Intergenic
1185096670 22:48810401-48810423 TTTTGACCACACATTCCTAATGG - Intronic
950330464 3:12152270-12152292 TCTTTGCCAGAGCTTCCCCAGGG + Intronic
951036482 3:17938504-17938526 GCTTTTCCACAGATTACTCTGGG + Intronic
952538750 3:34343791-34343813 TATTTAGCACAGATGCTTCAAGG - Intergenic
953101272 3:39830707-39830729 TCTCTACCACATGTTTCTCATGG + Intronic
953572060 3:44078992-44079014 GCCTAAACACAGATTCCTCAGGG - Intergenic
955145358 3:56312753-56312775 GATTTATCACAGACTCCTCATGG - Intronic
955831372 3:63007776-63007798 TCACTACCAGATATTCCTCAGGG - Intergenic
957827812 3:85471484-85471506 TCTTTGGCACAGATTGCTTATGG - Intronic
957874234 3:86124664-86124686 TGTTTGCCACAGATTCCTTGAGG + Intergenic
958725003 3:97894494-97894516 TACTTTCCCCAGATTCCTCAAGG - Intronic
959915823 3:111815843-111815865 TCTTTACAACAGCTTCCTGGAGG + Intronic
960525818 3:118708552-118708574 TCTTTCCCATAGATTCCTGAGGG - Intergenic
960836384 3:121910974-121910996 TCCTCACCACAGTTTCCTCAGGG - Intronic
963512449 3:146265070-146265092 TCTTTACTTCCGAATCCTCAAGG + Intergenic
964259335 3:154817512-154817534 TCTTTACTACAGATCTCTGAGGG - Intergenic
964954199 3:162332507-162332529 GCTTTACCACAGATTCCCCCAGG - Intergenic
965347139 3:167565571-167565593 TCTCTACAAATGATTCCTCAGGG - Intronic
965833214 3:172821032-172821054 TCTTTACCACAATTTTCCCATGG - Exonic
967436531 3:189453587-189453609 TCTTTAACTTAGATTCCTTATGG + Intergenic
969885687 4:10213308-10213330 TCAGTACCACAGATACCTAATGG + Intergenic
970505981 4:16730997-16731019 GCTTTCCCACACTTTCCTCAAGG + Intronic
970593021 4:17576085-17576107 CCTTGACCCCAAATTCCTCAGGG + Intergenic
970625064 4:17867980-17868002 TCTTTATTAAAAATTCCTCAGGG + Intronic
971029945 4:22625080-22625102 TCTTCATATCAGATTCCTCAGGG - Intergenic
971289160 4:25320555-25320577 TATTTACAACACATTCCCCAGGG - Intronic
972770780 4:42195012-42195034 TCTTTGCCACAAATTCATCTTGG - Intergenic
973528957 4:51815613-51815635 TGTTTACAACGAATTCCTCAAGG + Intergenic
974059128 4:57014301-57014323 TCTTTACCTCAGCCTCCTGAGGG + Intronic
974083628 4:57237177-57237199 TCTGTGCCTCAGATTCCTCAGGG - Intergenic
974881599 4:67765289-67765311 TCTTTACCTCAGTTTCCCCAAGG + Intergenic
975183086 4:71369445-71369467 TCTGAACCTCAGTTTCCTCATGG + Intronic
978185518 4:105852672-105852694 TGTGTACCACAAATTCCTCAAGG - Intronic
978629572 4:110728448-110728470 TCAGTTCCACAGAGTCCTCAGGG + Intergenic
980828281 4:138098177-138098199 TCTTTTCCACAGAATCTTCCAGG + Intergenic
983560316 4:169094952-169094974 TCCTTACCACAGTTTTCTCATGG - Exonic
986719579 5:10551465-10551487 TGTTTACCCCAAATTCCCCAGGG - Intergenic
993538381 5:89117188-89117210 TCTTTACCACAGTCAGCTCAGGG + Intergenic
995210608 5:109533426-109533448 TCTTCACCTCAGCTTCCTCAAGG + Intergenic
996308966 5:122080916-122080938 ACTTGACCACAGGTTCCTGAGGG + Intergenic
998620647 5:143790845-143790867 TCTTTCTCACAGCATCCTCAAGG - Intergenic
999422336 5:151455776-151455798 TTGTTACCACAGATTCTTAAAGG + Intronic
999561983 5:152813526-152813548 TCTGAACCTCAGGTTCCTCACGG + Intergenic
1000132794 5:158316049-158316071 TCTTGACCACAAATGCCTTAAGG - Intergenic
1001197829 5:169689493-169689515 TCTTTCCGAAAGCTTCCTCAAGG - Intronic
1004340860 6:14806262-14806284 TCTAGACCACAGACACCTCAGGG + Intergenic
1005007521 6:21303624-21303646 TCTTTACCAGAGATTCTTTCTGG - Intergenic
1008975689 6:57423644-57423666 ACTTCACCATAAATTCCTCAAGG - Intronic
1010399998 6:75437478-75437500 TCTTGGCCAGAGATGCCTCATGG + Intronic
1011050311 6:83140656-83140678 TCTTTACCACAGATTCCTCATGG + Intronic
1012530762 6:100232914-100232936 TCCTTCCCACAGATTCCTTTTGG - Intergenic
1013807052 6:114007776-114007798 TCTATACCACAGAGCCCTGAGGG + Intronic
1020118025 7:5487261-5487283 CCTGTACCACAGCTTCCTCGTGG - Intronic
1021929469 7:25565030-25565052 TCTTCTCCACATCTTCCTCATGG + Intergenic
1022320697 7:29285095-29285117 TGTTCCCCAGAGATTCCTCAAGG - Intronic
1022612638 7:31892319-31892341 TCTTTCCCAGGGTTTCCTCAAGG - Intronic
1023521523 7:41054631-41054653 TCTGTGCCTCAGCTTCCTCAAGG - Intergenic
1026347049 7:69483245-69483267 TCTTCATCTCAGTTTCCTCATGG - Intergenic
1026598493 7:71753882-71753904 CCTCTGCCACAGATTCCCCAGGG + Intergenic
1030057019 7:105592041-105592063 TCTCTGCCTCAGTTTCCTCATGG + Intronic
1030658977 7:112199373-112199395 TGATTACCATACATTCCTCAGGG + Intronic
1031272914 7:119676188-119676210 ACTTTACATCAGATTCCTCTAGG + Intergenic
1031685048 7:124723096-124723118 TATTTGCCACAGGATCCTCATGG + Intergenic
1031962455 7:128002387-128002409 TCTTTGTCTCTGATTCCTCATGG + Intronic
1032272031 7:130418046-130418068 TCTTTACCATGAATTCATCATGG + Intronic
1032844341 7:135739824-135739846 TCGATACCACAAGTTCCTCAAGG + Intronic
1039695211 8:39903225-39903247 TCATTACCACAGATGGCGCAGGG - Intronic
1041065890 8:54082700-54082722 TTTTTCACACAGATTTCTCATGG + Intronic
1042085544 8:65104552-65104574 TTTTTACTACAGATTCTACATGG + Intergenic
1043085779 8:75829657-75829679 TCTTTTCCACAAATTATTCATGG - Intergenic
1043509222 8:80933078-80933100 TATTTACCACATACTGCTCATGG + Intergenic
1044771723 8:95642783-95642805 TCTTTACTACAGATTCTTCCAGG + Intergenic
1044915423 8:97108235-97108257 TCTGTGCCTCAGTTTCCTCATGG - Intronic
1045603196 8:103742762-103742784 TCTTTAACAACGATGCCTCAAGG + Intronic
1045845230 8:106627173-106627195 GGTTTCTCACAGATTCCTCATGG + Intronic
1046164078 8:110406506-110406528 TGCTTCCCACAGATTTCTCAAGG + Intergenic
1046940670 8:119927999-119928021 TCTTTATCACAAATTGTTCAGGG - Intronic
1047487877 8:125348946-125348968 TTTGTACCTCAGTTTCCTCATGG - Intronic
1056719031 9:89057821-89057843 TCTTTTCCACAGGTTCCAGATGG - Intronic
1056891579 9:90499017-90499039 CCATTTCCAGAGATTCCTCATGG - Intergenic
1057919499 9:99085243-99085265 TCTTTACTCCAGCTCCCTCAGGG + Intergenic
1058125970 9:101195326-101195348 TGATTACCACAGTTCCCTCATGG + Intronic
1058713633 9:107703059-107703081 TCTTTACCACAGAGCCTGCAAGG + Intergenic
1058742694 9:107959579-107959601 TCTTAACCAAACATTCCACATGG + Intergenic
1059837305 9:118170350-118170372 TCTGTCCCAAAGATTCCTGAGGG - Intergenic
1059933766 9:119287016-119287038 TCTCTACCTTTGATTCCTCAAGG - Intronic
1061464395 9:130766364-130766386 TGTTTACCACTCTTTCCTCAGGG - Intronic
1062333899 9:136056573-136056595 TCTCTGCCACAGAGTCCTTAGGG - Intronic
1186124540 X:6398859-6398881 TTTTTACAACAGTTTCCTCTTGG + Intergenic
1186442509 X:9598429-9598451 TCTTAAAAAGAGATTCCTCAAGG - Intronic
1186553214 X:10529011-10529033 TCTGTGCCTCAGTTTCCTCATGG + Intronic
1190237896 X:48631487-48631509 GCTTTATCACAGATTGCTCTTGG + Intergenic
1196098297 X:111823138-111823160 TCTTTGCCACAAAATTCTCAGGG - Intronic
1196489311 X:116248294-116248316 ACTGTCCCACAGGTTCCTCAGGG - Intergenic
1199315763 X:146375959-146375981 TCTGTGCCTCAGTTTCCTCATGG - Intergenic
1201407024 Y:13659857-13659879 TCAGTCTCACAGATTCCTCAGGG + Intergenic