ID: 1011051083

View in Genome Browser
Species Human (GRCh38)
Location 6:83150291-83150313
Sequence GGGAATGTATGTACAGGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 254}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011051077_1011051083 12 Left 1011051077 6:83150256-83150278 CCCAGCTACACAGGAGTTGTCAT 0: 1
1: 0
2: 1
3: 9
4: 149
Right 1011051083 6:83150291-83150313 GGGAATGTATGTACAGGTGTTGG 0: 1
1: 0
2: 0
3: 29
4: 254
1011051078_1011051083 11 Left 1011051078 6:83150257-83150279 CCAGCTACACAGGAGTTGTCATA 0: 1
1: 0
2: 0
3: 5
4: 87
Right 1011051083 6:83150291-83150313 GGGAATGTATGTACAGGTGTTGG 0: 1
1: 0
2: 0
3: 29
4: 254
1011051076_1011051083 20 Left 1011051076 6:83150248-83150270 CCTGTAGTCCCAGCTACACAGGA 0: 417
1: 43725
2: 162627
3: 221718
4: 209862
Right 1011051083 6:83150291-83150313 GGGAATGTATGTACAGGTGTTGG 0: 1
1: 0
2: 0
3: 29
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011051083 Original CRISPR GGGAATGTATGTACAGGTGT TGG Intronic
900239887 1:1611087-1611109 GGGAATTTATGTACAGAGGGAGG + Intergenic
900556453 1:3283265-3283287 GGGAATGTCTGTCCAGGCCTTGG + Intronic
901723553 1:11220323-11220345 GGGATCGTATCTACAGTTGTAGG + Intronic
901723815 1:11223448-11223470 AGAAATGTATGTACATGTGTCGG + Intronic
902395921 1:16132510-16132532 GGGAAGGTGGGCACAGGTGTAGG + Intronic
902400888 1:16156086-16156108 GGGCATGAATGAACAGGAGTCGG - Exonic
903327506 1:22578761-22578783 GTGAATGTATGTGTACGTGTGGG + Intronic
904023770 1:27489608-27489630 GCAGATGTATGTACAGGAGTTGG - Intronic
904187934 1:28720528-28720550 AGGAATGTATGCTCAGGTTTGGG - Intergenic
905938483 1:41843737-41843759 CAGAATGTGTGTAAAGGTGTGGG - Intronic
906746511 1:48225683-48225705 GGGCATGTATGAACATGTGTGGG - Intronic
909337646 1:74494180-74494202 GTGTATGTATATGCAGGTGTGGG - Intronic
910838538 1:91539465-91539487 GAGAAGGTATTTGCAGGTGTGGG + Intergenic
911370254 1:96987636-96987658 GGAAATGTATATACGTGTGTTGG + Intergenic
912303489 1:108540805-108540827 GGGAGTGTGTGAATAGGTGTGGG - Intergenic
913372176 1:118112009-118112031 CAGAATGTTTGTACAGGTTTTGG - Intronic
917077564 1:171220924-171220946 GGCAATGTATGCGCAGGGGTGGG + Intergenic
917229632 1:172822248-172822270 GGGACAGCATGTACAGTTGTGGG - Intergenic
917767297 1:178235632-178235654 GGGTATGTATGTGCAAGTGAGGG + Intronic
918281498 1:183010612-183010634 GGGAGTGTGTGAATAGGTGTGGG + Intergenic
920665775 1:207961989-207962011 GGGAATGTAGGTACAGCCTTTGG + Intergenic
921737368 1:218643393-218643415 GGGAAGGTATTTACGGGTGTGGG - Intergenic
922547856 1:226471958-226471980 GGTAATATATGTAAAGTTGTTGG + Intergenic
923030639 1:230246706-230246728 GGTGATGTAGGCACAGGTGTTGG - Intronic
923191122 1:231621827-231621849 AGCTATGTATGTACAGCTGTTGG + Intronic
924168097 1:241306294-241306316 GGGTATATATGTACATGTGAGGG - Intronic
924731998 1:246720757-246720779 GGGAGTGTGTGAATAGGTGTGGG - Intergenic
1063192226 10:3706606-3706628 GGGAGTGAATGTAAAGGGGTGGG + Intergenic
1064645063 10:17452794-17452816 GGGAATGTAATGACAGGTATAGG + Intronic
1067709658 10:48637805-48637827 GGGAATGTAGGTGAAGGGGTAGG - Intronic
1067826479 10:49577561-49577583 GGGAAAGGCTGTACATGTGTTGG - Intergenic
1068043692 10:51859263-51859285 GGCCATGTTTGCACAGGTGTGGG - Intronic
1068274331 10:54773508-54773530 GAGAATGCATCTGCAGGTGTTGG - Intronic
1068298252 10:55104052-55104074 GTGTATGTATGTATATGTGTGGG - Intronic
1068515657 10:58022269-58022291 GGGAGTGTGTGAATAGGTGTGGG - Intergenic
1069064784 10:63930926-63930948 GGGAGAGTAAGTACAAGTGTAGG - Intergenic
1070354093 10:75622169-75622191 GGGAATGTATTTAGAGATGATGG + Intronic
1070713693 10:78702225-78702247 GTATATGTATGTACATGTGTGGG - Intergenic
1071432991 10:85620724-85620746 AGGCATGTGTGTACATGTGTAGG - Intronic
1072677330 10:97477848-97477870 GGAAGTGCATGTACAGGTGAGGG - Exonic
1073161522 10:101401194-101401216 GGGTATTTAAGTACAGGTATAGG + Intronic
1075669002 10:124250356-124250378 TGGCATGTATGTGCAGCTGTGGG - Intergenic
1076230041 10:128812472-128812494 AGGAATGTATTCACAAGTGTTGG - Intergenic
1076843510 10:133057956-133057978 GTGAGTGTATGTGCAGGTGAGGG + Intergenic
1077340376 11:2023765-2023787 GGGTGTGTGTGTGCAGGTGTGGG + Intergenic
1077442500 11:2575199-2575221 GCGGATGTTTGCACAGGTGTGGG - Intronic
1079503235 11:21126058-21126080 AGGAATCTATGTTAAGGTGTGGG + Intronic
1079783201 11:24636288-24636310 GGGAATGTTTTTACCAGTGTAGG - Intronic
1080424430 11:32143243-32143265 GAGAATTTATGTTCAGATGTTGG - Intergenic
1081004017 11:37711163-37711185 GGGTATGTGTGTGCAGGGGTAGG - Intergenic
1083144331 11:60747687-60747709 GTGAATGTGTGTGCACGTGTAGG - Intergenic
1083908870 11:65693436-65693458 GTGAATGTATGACCATGTGTGGG - Intergenic
1084092710 11:66889154-66889176 GGGAAAGTGGGTACATGTGTGGG + Intronic
1084495074 11:69498703-69498725 GTGAAGGTATGTGCAAGTGTGGG + Intergenic
1084792719 11:71484829-71484851 GTGAATGTATGCACAAGTGTGGG + Intronic
1085212973 11:74798640-74798662 GGGAGTGTGTGAATAGGTGTGGG - Intronic
1085812778 11:79700446-79700468 GTGAATGTGTGCACAGGTGCTGG + Intergenic
1087104586 11:94397165-94397187 GGAGAGGTATGAACAGGTGTGGG + Intronic
1087412714 11:97811999-97812021 GTGGATGTATGAACAGATGTTGG - Intergenic
1087726531 11:101723862-101723884 GGGACTGTTTGTAAAGGTTTAGG + Intronic
1088023557 11:105150440-105150462 GGTAATGTATTCACAGGTGCAGG + Intergenic
1089021933 11:115224914-115224936 GCGAATGTCTGTACAGGTGGTGG - Intronic
1090209959 11:124912044-124912066 GGGAATGGATATTAAGGTGTGGG - Intergenic
1090221904 11:125033865-125033887 GGGAATGGATATTAAGGTGTGGG - Intronic
1202823361 11_KI270721v1_random:78954-78976 GGGTGTGTGTGTGCAGGTGTGGG + Intergenic
1093418382 12:18946946-18946968 GGGAATCTATGTGCAGGAGGTGG - Intergenic
1093784596 12:23177549-23177571 GCAAATGTATGTATATGTGTAGG + Intergenic
1094360226 12:29622610-29622632 GGGAATGCATGTACAGTTAAAGG - Intronic
1096431185 12:51544519-51544541 GGGAGTGTGTGAATAGGTGTGGG - Intergenic
1100095788 12:91034348-91034370 TGGAATACATGTACAGATGTGGG - Intergenic
1100665436 12:96746864-96746886 GGAAATGTATTTGCATGTGTGGG - Intronic
1101343300 12:103862052-103862074 GGAAATGGATGAACAGGTATAGG + Intergenic
1104470371 12:129025179-129025201 GTGAATGTATGTGGGGGTGTGGG - Intergenic
1105637984 13:22234471-22234493 GGCAATGTCTGTACAGTAGTAGG - Intergenic
1105995916 13:25671847-25671869 GGGAGTGTGTGAATAGGTGTGGG - Intronic
1106746483 13:32714096-32714118 GGGAGTGTGTGAATAGGTGTGGG + Intronic
1106887918 13:34210012-34210034 GGGAAGCTATGTACAGGGATAGG + Intergenic
1108261937 13:48667266-48667288 GGGAATGTGTGTACACATGATGG + Intronic
1109167478 13:59053713-59053735 GGGAATGTCTGTCCAGGTTTTGG + Intergenic
1111150515 13:84247848-84247870 GGGAAAGACTGTACAAGTGTTGG + Intergenic
1111509605 13:89243396-89243418 GGGAGTGTATGAATAGGTGTGGG - Intergenic
1111611466 13:90613441-90613463 GGGAATGGATGCACAAGTGGCGG + Intergenic
1112045095 13:95588526-95588548 GGGAATGTATGAAGAGGGCTTGG - Intronic
1112913146 13:104514614-104514636 AGGAACTTGTGTACAGGTGTAGG - Intergenic
1114355566 14:21904169-21904191 GGGAGTGTATGAATAGGTGTGGG - Intergenic
1114426857 14:22631039-22631061 GGGAGTGTACGAATAGGTGTGGG + Intergenic
1114730348 14:24986467-24986489 GGGAATTAATGTGCTGGTGTTGG + Intronic
1114832359 14:26160434-26160456 GGGAATGTTTATACAGTTGGTGG - Intergenic
1115458808 14:33635875-33635897 AGGGATGTATGTACAGGTGCTGG - Intronic
1116288866 14:43006525-43006547 GGGATTGTCTGAACAGGTGAGGG - Intergenic
1116795834 14:49389241-49389263 GGGAGTGTGTGAATAGGTGTGGG + Intergenic
1121563169 14:94889037-94889059 GGGTATATATGTGCAGATGTGGG + Intergenic
1123964604 15:25442406-25442428 GAGAATTTATGAACAGGAGTGGG - Intergenic
1125851804 15:42911232-42911254 AGGAATGTATGTACGGGAATGGG - Intronic
1125865816 15:43047707-43047729 TGGAAAGCATGTACAGTTGTTGG - Intronic
1126142976 15:45452623-45452645 GGGAGTGTGTGAATAGGTGTGGG + Intergenic
1127072272 15:55298445-55298467 GGGAGTGTGTGAATAGGTGTGGG + Intronic
1128315882 15:66659095-66659117 ATGAGTGTATGTACATGTGTGGG + Intronic
1130809246 15:87359184-87359206 GAGAATGTCTTTACATGTGTAGG - Intergenic
1132574232 16:657287-657309 CGGCATGTGTGTCCAGGTGTGGG - Intronic
1135524911 16:23206736-23206758 GGGCATGTATGTGTAGGTATAGG - Intronic
1135568149 16:23527939-23527961 GGGACAGTATTCACAGGTGTGGG + Intronic
1135813478 16:25610788-25610810 GGGAGTGTACGAATAGGTGTGGG + Intergenic
1137672079 16:50284884-50284906 GTGAATGTGTGTGCAGGTGCCGG + Intronic
1140984268 16:80142679-80142701 GTGGATGTAGGTACAGTTGTAGG - Intergenic
1142631000 17:1226620-1226642 GTGCATGTATGTACATGTGAAGG + Intronic
1142921968 17:3196412-3196434 GGGAATGTTCCTACAGGAGTGGG + Intergenic
1146731870 17:35200065-35200087 GGGAGTGTACGAATAGGTGTGGG - Intergenic
1147123585 17:38351383-38351405 GGGAATGTATGCACATATATAGG - Intergenic
1147915620 17:43883501-43883523 AGGAATGCATGTGCACGTGTGGG - Intronic
1148769606 17:50059284-50059306 GGGAATGTCAGTGCAGGTGCTGG - Intronic
1148910422 17:50939632-50939654 GGCAATGGATGTACACCTGTGGG + Intergenic
1150697607 17:67419241-67419263 GGGAAAGTAGGTACATGTGGTGG + Intronic
1153127067 18:1806659-1806681 GTGAATGGATGTAAAGGTCTAGG + Intergenic
1153795972 18:8622512-8622534 GGGAGTGTGTGAACAGGTGTGGG + Intronic
1154047666 18:10922124-10922146 GGGAGTGTGTGAACAGGTGTGGG - Intronic
1154107606 18:11536285-11536307 GGGAGTGTGTGAATAGGTGTGGG + Intergenic
1154253863 18:12766458-12766480 GGGGAGATATGTACAGGTGTGGG - Intergenic
1155667838 18:28332755-28332777 GGGAAATTATGTACAGGAATTGG + Intergenic
1156649886 18:39213127-39213149 GGGAGTGTATGAATAGGTGTGGG + Intergenic
1158749306 18:60240500-60240522 GGGAGTGTGTGAATAGGTGTGGG - Intergenic
1158944157 18:62433861-62433883 AGGAATGTAGGTACCGATGTTGG + Intergenic
1159624825 18:70680472-70680494 GGGAAACGATGTACAGGTATAGG + Intergenic
1163750530 19:19074515-19074537 GGAAATGTTTGTACAAATGTTGG - Intronic
1164377704 19:27703659-27703681 GGGAGTATATGAATAGGTGTGGG + Intergenic
1165665443 19:37623559-37623581 GGGAGTGTGCGAACAGGTGTGGG - Intronic
1165898678 19:39158193-39158215 GTGCATGTATGTGCATGTGTGGG + Intronic
1166784185 19:45357901-45357923 GTGAAAGTTTGCACAGGTGTGGG - Intronic
1166912129 19:46166370-46166392 GGGAGTGTATGAATAGGTGTGGG + Intergenic
1168274660 19:55270824-55270846 GGGGATGTATGTATATGTGTGGG - Intronic
925767023 2:7246068-7246090 GTGTGTGTATGTACAGGTGAGGG + Intergenic
926484583 2:13438710-13438732 GGGAATATATCTACTGGTGAAGG + Intergenic
930846236 2:55907601-55907623 GTGAATGTATGTACAAGAGGAGG + Intronic
932919723 2:75897375-75897397 GTGCATGCATGTACAGGTCTAGG - Intergenic
934618993 2:95792678-95792700 GGGAATGGATGCACTGGTATTGG + Intergenic
934641898 2:96031879-96031901 GGGAATGGATGCACTGGTATTGG - Intronic
934886347 2:98028840-98028862 GGGAATATATGTACATTTATAGG - Intergenic
935120718 2:100181307-100181329 GTGTGTGTATGTACATGTGTTGG + Intergenic
935153762 2:100463867-100463889 AGTTATGTATGTACAGATGTAGG - Intergenic
935283012 2:101535603-101535625 GGTAATGGATGCACAGGCGTTGG - Intergenic
936986966 2:118320648-118320670 GGGTATGTATGTGTATGTGTTGG + Intergenic
937904156 2:127044317-127044339 GTGAATGTGTGTGAAGGTGTGGG - Intergenic
940976892 2:159956421-159956443 GGGAATGTTAGTATAGGTGGGGG + Intronic
941711884 2:168723243-168723265 GGGACTGTCTTTAGAGGTGTAGG - Intronic
942970689 2:181954334-181954356 GGGAATGTATGTGGAGGTCGGGG - Intronic
943606595 2:189983975-189983997 GGGAGTGTGTGAATAGGTGTGGG + Intronic
945066638 2:205953154-205953176 GGGAGTGTACGAATAGGTGTGGG + Intergenic
945818661 2:214636414-214636436 GTGAATAGATGTAAAGGTGTAGG + Intergenic
947348204 2:229215638-229215660 GGGTATGTATAGACAGGTGTAGG + Intronic
948810022 2:240469801-240469823 GTGCATGTGTGTACATGTGTAGG - Intergenic
949076815 2:242064741-242064763 GAGAGTGTATGTGCATGTGTGGG - Intergenic
1169065209 20:2691341-2691363 TGTAATGTGTGTACAGGTCTTGG + Intergenic
1172155112 20:32818959-32818981 GAGAATGTATGTACAGCCATTGG + Intergenic
1173647040 20:44639801-44639823 GGGAATGTAGGTAGGAGTGTGGG + Intronic
1174094097 20:48074143-48074165 GGAAATGTTTATAAAGGTGTGGG - Intergenic
1174587827 20:51622507-51622529 GGGAAAGGCTGTACAGGTGAGGG + Intronic
1178385078 21:32142464-32142486 GGGAATGGAAGAACAGGTGGTGG + Intergenic
1179184591 21:39075207-39075229 GGGAGTGTGTGAATAGGTGTGGG + Intergenic
1179660966 21:42874911-42874933 GGGAGTGTACGAATAGGTGTGGG - Intronic
1180155615 21:45975842-45975864 GGGAGTGTGTGAATAGGTGTGGG + Intergenic
1180756492 22:18165566-18165588 GGGAATGTCTGGAGAGGGGTAGG - Intronic
1181075277 22:20371868-20371890 GGGAATGTCTGGAGAGGGGTAGG + Intronic
1183196130 22:36354752-36354774 GGGAATGTATCTCAAGGTGGTGG - Intronic
1183625389 22:38998280-38998302 GGGAGTGTGTGAATAGGTGTGGG + Intergenic
950874881 3:16262763-16262785 GGGAATGTAACTATAGGTATAGG - Intronic
951381984 3:21995485-21995507 CTGAAGGTATGCACAGGTGTAGG + Intronic
951948252 3:28167021-28167043 TGGAATGTATGTATAGAAGTTGG - Intergenic
952977184 3:38706540-38706562 GGGAATGGATGAACAGGTTTGGG - Intronic
953391082 3:42534131-42534153 GGGAGTATATGCACTGGTGTGGG + Intronic
953928086 3:46992468-46992490 GGGACTGCAGGTACAGCTGTGGG - Exonic
956895440 3:73655225-73655247 CTGAATGTATGTAAAGGAGTTGG + Intergenic
957233198 3:77547742-77547764 GGGAATGTAAGGAAAGGTGATGG + Intronic
957469162 3:80636237-80636259 GGGAATGTACGAATAGGTGTGGG + Intergenic
960308429 3:116090786-116090808 GGGAATGTGTGAATAGGTGTGGG + Intronic
961702494 3:128757149-128757171 GGTGATGTATGTACAAGAGTGGG - Intronic
961909359 3:130299147-130299169 GGGAGTGTGTGAATAGGTGTGGG - Intergenic
962114970 3:132495161-132495183 GGGAGGGTATGTACTGCTGTTGG + Exonic
962896538 3:139720212-139720234 AAGAATGTATGTTCAGGGGTTGG - Intergenic
963664047 3:148159720-148159742 GGGAGTGTGTGAATAGGTGTGGG - Intergenic
965751123 3:171975981-171976003 GGGAAGGTAAGTGCAGGTATAGG + Intergenic
968742959 4:2340606-2340628 GGGCATGCATGCACAGGGGTGGG - Intronic
971001026 4:22322689-22322711 GGGAATGGATGGAAAGGTGAAGG - Intergenic
971342519 4:25783631-25783653 GTGCATGTATGTGCATGTGTGGG + Intronic
972408478 4:38768144-38768166 TTGAATAGATGTACAGGTGTAGG + Intergenic
972847469 4:43006762-43006784 GGGAGTGTGTGAATAGGTGTGGG - Intronic
973615365 4:52672465-52672487 GGGAGTGTGTGAATAGGTGTGGG + Intergenic
976673520 4:87679840-87679862 GGGAATCTATGCGCAGTTGTAGG - Intergenic
977140592 4:93366619-93366641 GGGAGTGTGTGAATAGGTGTGGG - Intronic
977362689 4:96026203-96026225 GAGAGTGAAGGTACAGGTGTAGG - Intergenic
977421225 4:96802292-96802314 AGGAAAGAATGTTCAGGTGTGGG + Intergenic
978263946 4:106799582-106799604 GGGAAAGTACGTATATGTGTTGG - Intergenic
978566224 4:110085153-110085175 GGCAATGTATGTGCATGCGTTGG + Intronic
981086824 4:140692139-140692161 GTGTATGTATGCACATGTGTAGG + Intronic
981754201 4:148123492-148123514 GGGGGTGTAAGAACAGGTGTAGG - Intronic
984150854 4:176128110-176128132 GAACATGTATGTACAGGTTTTGG + Intronic
985469262 5:28143-28165 GGGAGTGTGTGAATAGGTGTGGG - Intergenic
986033616 5:3917062-3917084 GTGTATGTATGTATATGTGTGGG - Intergenic
986426953 5:7642136-7642158 GGGAATGTATATACTGTTGGTGG - Intronic
988873869 5:35421986-35422008 GGGAATGCTTGTACATTTGTGGG + Intergenic
990395568 5:55375045-55375067 GGGAGTGTGTGAATAGGTGTGGG + Intronic
991725440 5:69531236-69531258 AGGTTTGTATGCACAGGTGTAGG + Intronic
992160258 5:73993968-73993990 GGGAGTGTGTGAATAGGTGTGGG + Intergenic
993548199 5:89239822-89239844 GGGAATGTATGTGCATATTTTGG + Intergenic
993914947 5:93732905-93732927 ATAAATGTATGTACAGGTATTGG - Intronic
994749072 5:103716166-103716188 TGGAATCTATGTAGAAGTGTGGG - Intergenic
996104246 5:119480490-119480512 GGGAGTGTGTGAATAGGTGTGGG + Intronic
996135073 5:119831694-119831716 AGGAATATGTGTACATGTGTGGG + Intergenic
998531871 5:142892526-142892548 GGTAATGTATGTACAGCTATGGG + Intronic
998585149 5:143419631-143419653 GGGAATGTACGAATAGGTGTGGG + Intronic
998977870 5:147668222-147668244 GGGAATGAATGGACAGGAGCAGG - Intronic
999566078 5:152863306-152863328 GGGAATATAAGTAGAGGTGAAGG + Intergenic
1000641209 5:163704337-163704359 GGGAATGTGTGCAAAGGTGGTGG - Intergenic
1001954709 5:175841225-175841247 GGGGATGTATGTGGTGGTGTGGG - Intronic
1002345993 5:178547750-178547772 GGGTATGTGGGTATAGGTGTGGG - Intronic
1002651616 5:180700782-180700804 GGGAGTGTACGAATAGGTGTGGG - Intergenic
1003893933 6:10589246-10589268 TGGTGTGTATGTACATGTGTGGG + Intronic
1005971417 6:30764748-30764770 GGGAGTGTGTGAATAGGTGTGGG + Intergenic
1006428012 6:33978218-33978240 GGCAATGTATGTACAGCACTCGG - Intergenic
1006496038 6:34424419-34424441 CTGGATGTTTGTACAGGTGTGGG + Intronic
1007746294 6:44045577-44045599 GTGAGTGTATATACATGTGTGGG - Intergenic
1008330988 6:50244214-50244236 AGGTGTGTATATACAGGTGTGGG + Intergenic
1009269751 6:61601870-61601892 GGGAATTTCTGGGCAGGTGTGGG - Intergenic
1009296166 6:61950904-61950926 GGAAATGTATGTACAAATTTGGG + Intronic
1010305035 6:74310039-74310061 GGGAGTGTGCGAACAGGTGTGGG + Intergenic
1010489761 6:76461327-76461349 GGGAGTGTGTGAATAGGTGTGGG + Intergenic
1011051083 6:83150291-83150313 GGGAATGTATGTACAGGTGTTGG + Intronic
1015863389 6:137703392-137703414 GGGAATGTGTGCAGAGGGGTAGG - Intergenic
1016254412 6:142087395-142087417 GGGAATGTTTGGATAGGGGTGGG - Intronic
1016533261 6:145082241-145082263 GTGAATGAATGTGAAGGTGTAGG - Intergenic
1018916409 6:168135137-168135159 GGGTGTGTATGTACAGGACTCGG + Intergenic
1019099909 6:169621629-169621651 GGGTATGTATATGCATGTGTGGG - Intronic
1019099913 6:169621677-169621699 GGGTATGTATATGCATGTGTGGG - Intronic
1019899251 7:4007202-4007224 GGGAATGTTTGCAGAGGTGCGGG + Intronic
1020048446 7:5062428-5062450 GGGAGTGTACAAACAGGTGTGGG + Intronic
1020387729 7:7626206-7626228 GGGAGTGTGTGAATAGGTGTGGG + Intergenic
1020680590 7:11232308-11232330 GGGAATGGATTTGCAGGGGTGGG + Intergenic
1021755080 7:23843656-23843678 GGGGATGTATGTTCAGAGGTAGG + Intergenic
1024497404 7:50064229-50064251 GGGAGTGTGTGAATAGGTGTGGG + Intronic
1025734787 7:64137407-64137429 GGGAGTGTACGAATAGGTGTGGG - Intronic
1026578731 7:71596479-71596501 TGGAATCTGAGTACAGGTGTAGG + Intronic
1031295074 7:119991583-119991605 GGGAGTGTGTGAATAGGTGTGGG + Intergenic
1034411265 7:150943438-150943460 GTGCATGTGTGTACATGTGTGGG + Intergenic
1035592605 8:828016-828038 GGGAGTATATGAATAGGTGTGGG + Intergenic
1036250584 8:7158981-7159003 GGGAGTATATGAATAGGTGTGGG + Intergenic
1036366900 8:8128472-8128494 GGGAGTATATGAATAGGTGTGGG - Intergenic
1036514491 8:9431152-9431174 GGGAGTATATGAATAGGTGTGGG - Intergenic
1036883980 8:12537189-12537211 GGGAGTATATGAATAGGTGTGGG + Intergenic
1038126274 8:24676226-24676248 GGGAATTTATGCTCAGGTTTAGG + Intergenic
1039364930 8:36919484-36919506 GGGAAGTTTTGTACAGGTGTTGG - Intronic
1041746617 8:61214272-61214294 GGGAGTGTGTGAATAGGTGTGGG - Intronic
1042056501 8:64769785-64769807 GGGAATGAAGGTGGAGGTGTGGG - Intronic
1042194739 8:66222469-66222491 GGGAATGGATGTACTGATGTGGG - Intergenic
1043422606 8:80114280-80114302 GGGAATGGGTGTATAGGTGGAGG - Intronic
1047111730 8:121797093-121797115 GGGTGTTTATGTACAGCTGTGGG + Intergenic
1048809658 8:138274375-138274397 GGGAATGTGTGAATAGGTGTGGG + Intronic
1050855287 9:10346772-10346794 GGAAAAGTTTGCACAGGTGTGGG + Intronic
1051227089 9:14910667-14910689 GAGAATGCATGCACATGTGTGGG - Intronic
1051549882 9:18316117-18316139 GGGAATGTGCGAATAGGTGTGGG + Intergenic
1054797744 9:69318209-69318231 GGAAATGTGTGTATAGGTATTGG + Intergenic
1057951854 9:99375570-99375592 GAGAATGTGTGTACATGTGGCGG - Intergenic
1059208886 9:112492548-112492570 AGGTATGTATGTACATATGTAGG - Intronic
1059386413 9:113968396-113968418 GGGAATGTATCTTCAGCTGGCGG + Intronic
1061139359 9:128755030-128755052 GTGAATGTACATACACGTGTGGG + Intronic
1061568590 9:131461323-131461345 GGGCATGCAGGTAGAGGTGTGGG - Intronic
1062104281 9:134744792-134744814 GCGAATGTGTGTACATGTGTGGG - Intronic
1185450176 X:277341-277363 GGGAACGTGGGGACAGGTGTGGG + Intronic
1185450377 X:277938-277960 GGGAACGTGGGGACAGGTGTGGG + Intronic
1185450408 X:278020-278042 GGGAATGTGGGGACAGGTGTGGG + Intronic
1187719393 X:22135495-22135517 GTGTGTGTATGTATAGGTGTTGG + Intronic
1188004320 X:25006777-25006799 GAGCAAATATGTACAGGTGTAGG - Intronic
1188890316 X:35603904-35603926 GGTAATGTATTCACAGGTGTTGG - Intergenic
1190002035 X:46698215-46698237 GGGAGTGTGTGAATAGGTGTGGG - Intronic
1190236276 X:48618071-48618093 GGGAATGAATGAACGGATGTTGG + Intergenic
1191671404 X:63751874-63751896 GGGAATGTATGTGTGTGTGTAGG - Intronic
1193025758 X:76844231-76844253 GGGAGTATATGAATAGGTGTGGG - Intergenic
1193146880 X:78085626-78085648 GGGAATCTATGTATATGTGAGGG + Intronic
1193611584 X:83637923-83637945 GTGAATGAATGTGAAGGTGTAGG + Intergenic
1194690168 X:96974357-96974379 GGGAATATATGGATAGGTGATGG + Intronic
1195785226 X:108512658-108512680 GGGAGTGTACGAATAGGTGTGGG + Intronic
1195806572 X:108778164-108778186 GAAAATGTATGTACAGTTGAAGG + Intergenic
1196346211 X:114662209-114662231 GAGAATGTTTATACAGGTATAGG + Intronic
1198135637 X:133747326-133747348 AGGAATGTTTGTGCAGGTGATGG - Intronic
1199950130 X:152700104-152700126 GGGAATGTATGGCCAGATGTGGG + Intronic
1199959545 X:152768357-152768379 GGGAATGTATGGCCAGATGTGGG - Intronic