ID: 1011054843

View in Genome Browser
Species Human (GRCh38)
Location 6:83193655-83193677
Sequence CCCACAGTGAGCGCCGCCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 63}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011054834_1011054843 10 Left 1011054834 6:83193622-83193644 CCCCGTCGCTGGGCCTCGGACAG 0: 1
1: 0
2: 0
3: 5
4: 86
Right 1011054843 6:83193655-83193677 CCCACAGTGAGCGCCGCCGGCGG 0: 1
1: 0
2: 1
3: 4
4: 63
1011054835_1011054843 9 Left 1011054835 6:83193623-83193645 CCCGTCGCTGGGCCTCGGACAGG 0: 1
1: 0
2: 0
3: 10
4: 118
Right 1011054843 6:83193655-83193677 CCCACAGTGAGCGCCGCCGGCGG 0: 1
1: 0
2: 1
3: 4
4: 63
1011054837_1011054843 8 Left 1011054837 6:83193624-83193646 CCGTCGCTGGGCCTCGGACAGGG 0: 1
1: 0
2: 1
3: 11
4: 160
Right 1011054843 6:83193655-83193677 CCCACAGTGAGCGCCGCCGGCGG 0: 1
1: 0
2: 1
3: 4
4: 63
1011054839_1011054843 -3 Left 1011054839 6:83193635-83193657 CCTCGGACAGGGCGACCTCGCCC 0: 1
1: 0
2: 1
3: 5
4: 64
Right 1011054843 6:83193655-83193677 CCCACAGTGAGCGCCGCCGGCGG 0: 1
1: 0
2: 1
3: 4
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011054843 Original CRISPR CCCACAGTGAGCGCCGCCGG CGG Intronic
903769523 1:25755056-25755078 CCCACAGCGAGCCCTGCCGGGGG - Intronic
907490420 1:54805746-54805768 CCCACAGAGAGGGCCGCCTTGGG - Intergenic
914911425 1:151790489-151790511 ACCACAGTGAGCCCCGCCGGCGG + Intronic
917533967 1:175861301-175861323 CTCACGGTGAGCTCCGCAGGAGG - Intergenic
922739598 1:228007731-228007753 CCCCCAGTGCGCCCCGCCGCCGG - Intronic
1063096784 10:2915591-2915613 CACACAAGGAGCGCTGCCGGGGG - Intergenic
1069832459 10:71289627-71289649 CCCCCAGTGAGCTCGGCCGAGGG - Intronic
1070941964 10:80356442-80356464 ACCACACTGAGCGCCCCGGGAGG - Intronic
1080758104 11:35221537-35221559 ACCACAGTCAGCGCTGCAGGGGG - Intronic
1081622853 11:44629133-44629155 CCCACAGAGAGGGCGGCAGGAGG - Intergenic
1084958103 11:72702189-72702211 CCCACGGTCAGCGCCGTGGGGGG + Intronic
1089432367 11:118435376-118435398 CGCACAGAGCTCGCCGCCGGCGG + Intergenic
1091764113 12:3107166-3107188 CCCACGGAGGGGGCCGCCGGCGG - Intronic
1097925495 12:65121886-65121908 CCTTCAGTGAGCGCCGGAGGAGG - Intergenic
1100464535 12:94833633-94833655 CCCAGAGAGAACGCCGCCGTGGG + Intergenic
1101150432 12:101877966-101877988 ACCACAGGGAGCGCTGCCGACGG + Intronic
1103954052 12:124566987-124567009 CCCACAGTGTGCGCCGGCTCTGG - Intronic
1103977577 12:124713475-124713497 TCCACCCTGAGCACCGCCGGGGG + Intergenic
1104237869 12:126956840-126956862 CCCACAGTGAGCCAGGCAGGTGG + Intergenic
1112570463 13:100588822-100588844 CCTGCAGGGGGCGCCGCCGGGGG - Intronic
1115175655 14:30559077-30559099 CCCACAGCCAGCGCCTCCGCGGG + Intergenic
1118693654 14:68363576-68363598 CACAGAGTGGGCGCCGCCGCAGG - Intronic
1125677870 15:41512098-41512120 CCCGGAGTGAGCGCAGCCAGTGG - Exonic
1128322291 15:66702271-66702293 CGCACACTGAGGGCCCCCGGAGG - Exonic
1129331662 15:74831015-74831037 CCCACAGTGGCAGCCGCTGGAGG - Exonic
1129446291 15:75620914-75620936 AGCAGAGTGAGCGCCGCCGGAGG - Exonic
1131264154 15:90905927-90905949 CCCAGAGGAAGCGCCGCCGGGGG - Exonic
1147957697 17:44146027-44146049 CACACAGTGGGGGCTGCCGGGGG - Intronic
1150599867 17:66641401-66641423 CCCACAGTGATCGCAGAAGGTGG - Exonic
1161175962 19:2842100-2842122 CCCCCAGAGACCGCGGCCGGAGG - Intronic
1162141108 19:8586105-8586127 TCCAGAGTGAGTGCCGCCAGGGG - Exonic
1162371825 19:10284370-10284392 CACACAGTGAGCCCCGCCCCGGG - Intronic
1164952170 19:32345811-32345833 CCCGCTGTTAGCGCCGCCGCCGG + Intronic
1167269651 19:48499734-48499756 CACACAGTGCGCCCCGCCCGGGG - Exonic
926714479 2:15913417-15913439 CCCACACTGAGCCCTGCTGGCGG + Intergenic
936855950 2:116957467-116957489 CCCACAGTGAGAGTGGCCTGAGG - Intergenic
937119533 2:119432009-119432031 CCCACCGCGAGCGCCGGCGTCGG + Intronic
945225833 2:207530366-207530388 CCCGCCATGAGCGCCGCCGCTGG - Intronic
948553974 2:238794777-238794799 CCCACAGGGAGAGCCGGCTGTGG + Intergenic
948554003 2:238794907-238794929 CCCACAGGGAGAGCCGGCTGTGG + Intergenic
948554074 2:238795227-238795249 CCCACAGGGAGAGCCGGCCGTGG + Intergenic
1173649051 20:44651558-44651580 CCCAAAGTGAGCGCGCGCGGGGG - Exonic
1175479422 20:59300843-59300865 CTCACAGTGACCTCCGCCGCAGG + Exonic
1178981163 21:37266888-37266910 CCCTCAGTGAGCGCTGAGGGCGG - Intronic
1179731907 21:43372787-43372809 CCCACAGTGCGGGCAGCCTGTGG + Intergenic
1179731916 21:43372834-43372856 CCCACAGTGCGGGCAGCCTGTGG + Intergenic
1179731925 21:43372881-43372903 CCCACAGTGCGGGCAGCCTGTGG + Intergenic
1180246847 21:46554286-46554308 CCCACAGTGAGCCCACCTGGTGG - Exonic
1184819051 22:46894910-46894932 CAGACAGTGGGCGCAGCCGGAGG + Intronic
1185161702 22:49233896-49233918 CACACAGTGAGCACCGCTGGAGG + Intergenic
954803150 3:53199041-53199063 CCCACAGTGAGCCCAGCACGTGG + Intergenic
977810031 4:101347378-101347400 TCCACACAGAGCGCCGCCGCTGG + Exonic
985733898 5:1566258-1566280 CCCACAGTGTGGGCCGCCCCTGG - Intergenic
997990754 5:138542973-138542995 CACAGAGTTAGCGCCGCCGCTGG + Intronic
1002156057 5:177280706-177280728 CCCACAGTGTGTCCTGCCGGAGG + Exonic
1011054843 6:83193655-83193677 CCCACAGTGAGCGCCGCCGGCGG + Intronic
1013441908 6:110179588-110179610 GCCACAGGGAACGCCGCCTGGGG + Exonic
1019666617 7:2255076-2255098 CCCACCGTGCTCCCCGCCGGAGG - Exonic
1019748714 7:2715302-2715324 CCCACAGTGAACGCCGAGTGGGG - Exonic
1028569114 7:92266609-92266631 CCCCCAGTGAGTTCCGCTGGTGG - Intronic
1028622185 7:92836653-92836675 CCCCCAGCGAGCGGCGCGGGCGG - Intergenic
1034275990 7:149824079-149824101 CCCACAGTGAATGCCGGCGTGGG + Intergenic
1035725622 8:1823656-1823678 CCCGAAGTGAGCGCGGCCCGGGG + Intergenic
1039665581 8:39522985-39523007 CCCACAGTGGGCTGCACCGGAGG + Intergenic
1056797229 9:89666854-89666876 CCCACGGTGAGCGCTGACGCAGG - Intergenic
1061029005 9:128068423-128068445 CCCGCAGATAGCGCCGCCGCAGG - Exonic
1187464464 X:19515183-19515205 CCCTCAGTGCCCGCCGCCGCCGG - Exonic
1189478780 X:41377189-41377211 CCCACAGTGAGGGCCACTGATGG - Intergenic
1190106568 X:47565134-47565156 CCAACAGTGAGCCCAGCCTGGGG + Exonic