ID: 1011057915

View in Genome Browser
Species Human (GRCh38)
Location 6:83226048-83226070
Sequence CTGTAGGCACAGGTGAAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 1, 2: 0, 3: 16, 4: 191}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011057915_1011057918 4 Left 1011057915 6:83226048-83226070 CCTATCTTCACCTGTGCCTACAG 0: 1
1: 1
2: 0
3: 16
4: 191
Right 1011057918 6:83226075-83226097 AGAAACTCACATCCAGCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011057915 Original CRISPR CTGTAGGCACAGGTGAAGAT AGG (reversed) Intronic
900432481 1:2609420-2609442 CTGTGGGCACAGGAAAAGGTTGG + Intronic
900963878 1:5944207-5944229 CTGTAAGCACAGCTGAAAACAGG - Intronic
902554715 1:17240152-17240174 CTGTGGGAACAGGTGAAGCAAGG + Intronic
902687102 1:18085311-18085333 CTGCAGGCTCAGCTGAGGATTGG + Intergenic
903533684 1:24052251-24052273 CTGGAGGCCCAGGTGAAAAGAGG + Intergenic
904317004 1:29672079-29672101 CTGGAGGCAGAGGAGAAAATTGG - Intergenic
904442093 1:30538640-30538662 CTGGAGGCAGAGGAGAAAATTGG + Intergenic
906810704 1:48824378-48824400 CTGAAGGCACAGGAATAGATAGG + Intronic
908323135 1:62997492-62997514 CTCTAGGCACAGGGCAAGAAGGG - Intergenic
908758432 1:67490349-67490371 ATGTGGGCACAGTTGGAGATAGG - Intergenic
908760430 1:67506755-67506777 CACCAGGTACAGGTGAAGATGGG + Intergenic
909866334 1:80677176-80677198 TTGTAGGCACAGGTGTATTTTGG - Intergenic
915538403 1:156551694-156551716 CAGAAGGCCCAGGTGAAGTTAGG - Exonic
915557442 1:156668476-156668498 CTGTGGGCAGAGATGATGATGGG + Intergenic
915927991 1:160038893-160038915 CGGTAGGCACAGGTGTAAAAAGG - Exonic
919772242 1:201169955-201169977 CAGGAGTCACAGCTGAAGATTGG - Intronic
1064564833 10:16629345-16629367 CTCTTGGCACAGGTAGAGATTGG - Intronic
1064577851 10:16763887-16763909 CTTTATGCAAAGGTGAAGAGAGG - Intronic
1066162552 10:32749118-32749140 CTGGAGAAACAGGTAAAGATAGG - Intronic
1067311249 10:45115434-45115456 CTTTATGCAAAGGTGAAGAGAGG - Intergenic
1073023850 10:100471286-100471308 CTGTAGGCAGAGGTGGGGAGGGG - Intronic
1074121921 10:110499150-110499172 CTGTAGGCTCAGCTCAGGATGGG - Intronic
1075489993 10:122858595-122858617 CTGTGGGCACAGGTGTGTATGGG - Intronic
1076238912 10:128887443-128887465 GTGTGGGCACAGGTGTGGATTGG - Intergenic
1076445724 10:130512541-130512563 TTGTGGGCACAGGTGGAGTTAGG + Intergenic
1077024313 11:432545-432567 CTGTAGGCACAGGGGGAGGCTGG - Intronic
1077374418 11:2198834-2198856 CTGCAGGCACAGGTGACTTTTGG - Intergenic
1078772335 11:14362500-14362522 CTGAAGACACAGGAGAATATGGG + Intronic
1079896575 11:26126760-26126782 CAGAAGGCAAAGGTGAAGAAAGG + Intergenic
1081742337 11:45449378-45449400 GTGTAAGCACAGGTGAGGGTGGG + Intergenic
1084429815 11:69104923-69104945 CTGGCAGCACAGGTGAAGCTGGG + Intergenic
1084667331 11:70583437-70583459 CTGTAGGCACAGGGCAGGACTGG - Intronic
1085065163 11:73488607-73488629 CTGTGGGTACAGGTGCAGTTTGG - Intronic
1085749394 11:79147602-79147624 CTTTAGCCAGAGGAGAAGATAGG - Intronic
1085837936 11:79976225-79976247 CTGCAGACACAGATGGAGATGGG + Intergenic
1087528184 11:99345389-99345411 CTGTGTACAAAGGTGAAGATAGG - Intronic
1088995746 11:114995054-114995076 ATGTACGCACAGATGAGGATAGG - Intergenic
1093827970 12:23718396-23718418 CTGTATGCAAAGATTAAGATAGG - Intronic
1093934647 12:24987840-24987862 GTGTGGGCACAGGTGCAGATGGG - Intergenic
1097360702 12:58655644-58655666 CTGCAGGCACTGGGGAAGCTTGG + Intronic
1101440238 12:104698480-104698502 CTGAAGAGACAGGTGATGATAGG - Intronic
1103049078 12:117763657-117763679 CTGTGGGCTAAGGTGCAGATTGG + Intronic
1104747642 12:131220029-131220051 CTGTAGGCACAGGGGGTGTTTGG + Intergenic
1107177874 13:37420840-37420862 TTGTAGGTATAGGTGAAGTTGGG + Intergenic
1108292633 13:48976349-48976371 CTGTGGGCAGAGGTGCAGAGGGG + Intronic
1113351610 13:109535036-109535058 CTGAAGCCAGAGGTGAAGGTGGG - Intergenic
1114301892 14:21385789-21385811 CGGTAGTCACTGGTGAAGAGGGG + Exonic
1115509327 14:34124430-34124452 CCGCAGCCACAGGGGAAGATGGG - Intronic
1117471498 14:56050727-56050749 CTCTAGGCACCTGTGAAGGTGGG + Intergenic
1118584134 14:67335979-67336001 CTGTTGGCACAGGTATAGGTAGG + Intronic
1118588773 14:67383951-67383973 CTGTAGGAGCAGGTGAATAAAGG + Exonic
1119578339 14:75750184-75750206 CTGTAGGCACAGGTTATGAGAGG + Intronic
1120863205 14:89273520-89273542 CTGTAGCCACTGGGGAAGAAGGG + Intronic
1121325637 14:93018134-93018156 CTGGAGGCACAGCAGAAGATGGG + Intronic
1124571142 15:30865122-30865144 CTGTAGTCCCAGGTGCAGATTGG + Intergenic
1124898198 15:33797215-33797237 CTGTAGGCAGAGAAGAAGGTTGG - Intronic
1131344617 15:91634419-91634441 GTGTAGGCACATGTGAATATTGG - Intergenic
1132106982 15:99070084-99070106 CTGTAGCCACACATGAACATGGG - Intergenic
1132302825 15:100787109-100787131 CTCTAGACCCAGGTGAGGATCGG + Intergenic
1133214236 16:4281651-4281673 CTGTAGATACAGATGAAGCTTGG + Intergenic
1134071158 16:11260596-11260618 TAGCAGGCACAGGTGAAGAAAGG + Intronic
1134555165 16:15158154-15158176 CTGGAGGCAGAGGTGGAGACAGG + Intergenic
1139412833 16:66779153-66779175 TTATATGCACAGGTAAAGATTGG - Intronic
1139906262 16:70368248-70368270 CTTTTGGCACAAGTGGAGATAGG - Intronic
1141742799 16:85905211-85905233 CTGAAGGCACAGTTGCAGGTTGG + Intronic
1142278670 16:89136720-89136742 CTGTAGGCACAGAGGCAGGTGGG - Intronic
1144742205 17:17590313-17590335 CAGGAGGCACAGGAGGAGATGGG - Intronic
1144807167 17:17975771-17975793 CGGAAGGCACAGGTGGAGAAGGG + Intronic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1146937869 17:36823877-36823899 CTGTGGGTACAGGGGAAGGTGGG + Intergenic
1148528754 17:48368747-48368769 TTGGAGGCATAAGTGAAGATGGG - Intronic
1149327579 17:55547913-55547935 CTGGAGGCATCTGTGAAGATAGG + Intergenic
1149403829 17:56326738-56326760 CTGTTGGGTCAGGTAAAGATGGG + Intronic
1152163353 17:78683645-78683667 CTCTAGGCCCAGTTGAAGGTGGG - Intronic
1154369231 18:13743530-13743552 CTGTAGACACAGGAAAAGCTGGG + Intronic
1155252484 18:23965679-23965701 CTCTAGGCTCAGGGGAAGAGGGG - Intergenic
1156648533 18:39197154-39197176 CTATAAGCACAGATGAAGCTTGG + Intergenic
1158479175 18:57805088-57805110 ATCTAGGTACAGGTGTAGATTGG - Intergenic
1159148860 18:64493963-64493985 CTCCAGGCACAGTTGAAGACAGG + Intergenic
1159628409 18:70720855-70720877 CTGTTGGCACAGCTGGAGCTTGG + Intergenic
1161000721 19:1909489-1909511 CTGCTGGCACAGGTGAGGACAGG - Intronic
1161884485 19:6983279-6983301 GTGAAGACAGAGGTGAAGATTGG - Intergenic
1162760346 19:12885250-12885272 CTGTAGTTACAGGGGAAGAAGGG - Intronic
1165181938 19:33979059-33979081 CTGTATGCTAATGTGAAGATAGG - Intergenic
1165743813 19:38218725-38218747 CTCTGGGCAAAGGTGGAGATTGG + Intronic
1166230752 19:41424827-41424849 CTGTAACAACAGGTGAAGAGGGG - Exonic
1167276079 19:48540492-48540514 CAGTAGGCACAGGTGGGGAAGGG - Intergenic
1168255939 19:55165378-55165400 CTGGAGGAACCGGAGAAGATGGG - Exonic
925158586 2:1665211-1665233 CAGAGGGCACAGGAGAAGATGGG + Intronic
925496665 2:4457860-4457882 CTGAAGGCCAAGGTGAAAATTGG + Intergenic
928983633 2:37159393-37159415 GTGAAGGCACAGGTAGAGATAGG - Intergenic
929891746 2:45924110-45924132 TTTAAGGCACAGGAGAAGATGGG - Intronic
930321180 2:49856680-49856702 CTGTAAGCCCAGATGAAGGTAGG + Intergenic
931097150 2:58954014-58954036 CTGGAAGGACAGGTGAAGATGGG - Intergenic
931961655 2:67489498-67489520 CTGTAAGCACAGGAGAGGAAGGG + Intergenic
933616991 2:84492247-84492269 CAGTAGGCACATTTGAAGGTGGG - Intergenic
934884973 2:98016454-98016476 CTGGAGGTACATGTGAGGATGGG + Intergenic
936346795 2:111681628-111681650 CTGGAGGCAGAGGTGAGGACTGG - Intergenic
937851338 2:126638906-126638928 CCGTAGGCAGAGTTGAAGCTGGG + Intergenic
938233064 2:129678502-129678524 CTGCTGGCACGGGTGAGGATGGG + Intergenic
939677021 2:145085147-145085169 CTATAGGCAAAGGGGAAAATGGG + Intergenic
942516189 2:176755705-176755727 CAGTAAGCACAGCTGTAGATAGG - Intergenic
944342674 2:198621741-198621763 CTGGAGGCTCAGGGGCAGATGGG - Intergenic
946509990 2:220345638-220345660 CTGTGGGAAAAGGTGAAGAGAGG - Intergenic
946629425 2:221649974-221649996 CTGGAGGCAAAAGTGAAGATAGG + Intergenic
947470077 2:230393248-230393270 CTAGAAGCACAGGTGAAGACAGG + Intronic
948337407 2:237221346-237221368 ATATAAGTACAGGTGAAGATAGG - Intergenic
1169921190 20:10735802-10735824 CTCTAGGCACATGGGAAAATTGG - Intergenic
1171425366 20:25045403-25045425 CCTTAGGCACAGGTGACGCTGGG - Intronic
1173776075 20:45707417-45707439 CTGTAGGCACTGGTCACGAGAGG + Intronic
1174293512 20:49526432-49526454 CTGTAGGCACAGGGGAAAAGTGG - Intronic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1176375642 21:6085776-6085798 CTGTGGACACCGGTGAAGAGGGG + Intergenic
1178064069 21:28884681-28884703 CTGTAGCCACATGTGAGGACTGG + Intronic
1178449167 21:32677562-32677584 ATGTAGGCACAGGTGGAAAGAGG + Intronic
1179747832 21:43452468-43452490 CTGTGGACACCGGTGAAGAGGGG - Intergenic
1180831483 22:18909193-18909215 CTGTAGGCACAGCTGGAGCCAGG + Intronic
1183113918 22:35674963-35674985 CTGTAGGCAAATGAGAAAATTGG - Intergenic
1183732566 22:39627042-39627064 CTGTAGGGTCAGGTGAACACGGG - Intronic
1184015083 22:41779957-41779979 CTGTAGCCACAGGTGAAGATGGG + Intronic
1184286048 22:43472057-43472079 CGGTAGGGACAGGTGGGGATTGG + Intronic
1184783655 22:46661509-46661531 CTGTAGGCCCAGGTTAACAATGG + Intronic
1184826666 22:46957183-46957205 CTGTATGCCCAGGTGAAGAGGGG - Intronic
950526645 3:13528350-13528372 CTGAAGGCACAGCTGAAGTAGGG + Intergenic
950825395 3:15813677-15813699 CTGCAGGCACTAGTGAAGATAGG - Intronic
951261240 3:20512123-20512145 CTGTAGGAAAGGATGAAGATAGG + Intergenic
954107363 3:48416452-48416474 CTGTAGGCACAGGGCAGGCTAGG + Intronic
954380019 3:50214379-50214401 CTGTAGGCACAGGTCAGGGTGGG - Intronic
962898611 3:139737539-139737561 CCCTAGGCACTGGTGAAGAGGGG + Intergenic
963255529 3:143140824-143140846 CTGAAGGCAAAGGTGAAGCAAGG - Intergenic
969122056 4:4918136-4918158 CTGTGGGGACAGGTAAAGACGGG - Intergenic
969391895 4:6896946-6896968 CTGGGGGCACAGGAGATGATTGG - Intergenic
971068940 4:23068233-23068255 GTGCAAGCTCAGGTGAAGATTGG + Intergenic
973889806 4:55357517-55357539 CAGTAGCCACAGGTGGCGATTGG + Intronic
974270530 4:59646024-59646046 TTTTAGGCACAGGAGAAGACAGG - Intergenic
975589528 4:75986486-75986508 ATATGGGCACAGGAGAAGATAGG - Intronic
976471175 4:85430705-85430727 CTGCAGGAACATGTGATGATAGG + Intergenic
976495279 4:85722013-85722035 GTGTTGGTAAAGGTGAAGATGGG + Intronic
981806419 4:148720773-148720795 CTGAAGGCACAAGTTAAGTTTGG - Intergenic
985200999 4:187485488-187485510 CTGTTGGCACAGGTGGATATAGG + Intergenic
985639183 5:1055599-1055621 CTGTAGGGTCAGGAGAAGGTGGG - Intronic
985873220 5:2575456-2575478 TTGTAAGCTCAGGTGAAGCTGGG - Intergenic
986029190 5:3879918-3879940 CTGAAAGCACAGGAGAAGATGGG - Intergenic
987233187 5:15916273-15916295 CACTAGGCACAGGTGACTATTGG - Intronic
989001534 5:36765842-36765864 CTGTAGGCTGAGGTGCAGAGTGG - Intergenic
991932692 5:71769443-71769465 TTGCAGGCAAAGGTGAAGCTTGG + Intergenic
991986152 5:72288919-72288941 CTGTAGGAAAAGGGGAAGGTGGG - Intronic
992501710 5:77350008-77350030 CTGGAGGAACAGGTGCAGCTGGG - Intronic
994211293 5:97089822-97089844 CTGCAGGCCCTGGTGAAAATAGG + Intronic
994764368 5:103898853-103898875 TTGGAAGAACAGGTGAAGATGGG - Intergenic
997061768 5:130513753-130513775 TTGAACGCACAGGTGAAAATGGG - Intergenic
997883522 5:137611479-137611501 CGGGAGGCCCAGGTGGAGATGGG - Intergenic
998191658 5:140030477-140030499 CTGTGGGCATAGGTGAAGCAGGG + Intronic
999128757 5:149266587-149266609 CTGCAGCCACAGATGAAGCTAGG + Intergenic
999594978 5:153192945-153192967 CTGTGGGCACAGGTGAATAGTGG - Intergenic
1001466801 5:171974577-171974599 CTGTAGGCATAGGTTATGCTCGG - Intronic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1006989341 6:38199906-38199928 CTGTAGGCAGGGGTGACCATGGG + Intronic
1008452195 6:51665923-51665945 GTGTAAGCACAGGTGGAGGTGGG + Intronic
1011057915 6:83226048-83226070 CTGTAGGCACAGGTGAAGATAGG - Intronic
1012806635 6:103903108-103903130 CTGGAGGCACAAATGAAGAAAGG + Intergenic
1015840673 6:137473594-137473616 CTGTAGAATCAGGTGATGATTGG + Intergenic
1015842277 6:137488627-137488649 GTGTTGGCGCAGGTGATGATGGG + Intergenic
1016794316 6:148101571-148101593 CTGAAGGCACAGATGATCATTGG + Intergenic
1017384286 6:153865128-153865150 CAGTAGGCACACGTGACTATTGG - Intergenic
1018512575 6:164541076-164541098 GTGAAGACACAGGTGGAGATTGG - Intergenic
1020643018 7:10779651-10779673 GAGAAGGCTCAGGTGAAGATGGG - Intergenic
1020853842 7:13391883-13391905 CTATAGACACACGTGAAGAAAGG + Intergenic
1024586103 7:50843348-50843370 CTGTAGGACCTGGAGAAGATGGG - Intergenic
1029392537 7:100285219-100285241 ATTTAGGAACAGGGGAAGATAGG + Intergenic
1030322803 7:108187220-108187242 CTGTAGGCCACTGTGAAGATGGG - Intronic
1030492040 7:110249448-110249470 CTGTAGGCACCACTGAAGCTTGG - Intergenic
1031250690 7:119376468-119376490 CTAGAGGCACACATGAAGATTGG + Intergenic
1032538157 7:132681827-132681849 CTCTGGGTAGAGGTGAAGATGGG + Intronic
1032864783 7:135914673-135914695 CTGGAAGCACAGGTAATGATGGG + Intergenic
1034454866 7:151163460-151163482 CAGTAGCCACAGGTGAACAGTGG - Intronic
1035055228 7:156030847-156030869 CGGTGAGCACAGGTGAAGACAGG + Intergenic
1036675768 8:10831295-10831317 ATGTAGGAACAGCTAAAGATTGG + Intronic
1037365400 8:18116542-18116564 CTTTAGGTGCAGGTGCAGATGGG - Intergenic
1037491001 8:19397125-19397147 CTGTAGGCACAGGGGGGTATTGG - Intergenic
1037640197 8:20735335-20735357 TTCTAGGCACAAGTGAAGTTTGG + Intergenic
1038461772 8:27723126-27723148 ATGTATGGACAGGTGAAAATGGG - Intergenic
1038723079 8:30055494-30055516 CTGTAGGCAAAGGTTAATAGTGG - Intergenic
1039251856 8:35674723-35674745 CACCAGGCAGAGGTGAAGATGGG - Intronic
1042237145 8:66624697-66624719 CTGTAAGCACAATTTAAGATAGG + Intergenic
1044259395 8:90099878-90099900 CTGAAGGCTCAGGTGATCATTGG - Intergenic
1047705402 8:127494365-127494387 TTGCAGGCACAGGGGAAAATAGG - Intergenic
1048446435 8:134496812-134496834 CTCCAGGCAGTGGTGAAGATGGG - Intronic
1049425097 8:142534410-142534432 CAGCTGGCACAGCTGAAGATGGG + Intronic
1049539023 8:143198214-143198236 CTGTCGGCACTGCTGAGGATCGG - Intergenic
1050073097 9:1837156-1837178 CTGAAGGCAAAGGTGAGGTTGGG - Intergenic
1050119192 9:2290673-2290695 TTGTAGGCAGGGGTGAAGATGGG + Intergenic
1051154765 9:14129220-14129242 CTTTAGAGACAGGTGAAGAACGG + Intronic
1053144818 9:35705289-35705311 CTGTAGGCCCAGATGAGGGTCGG + Intronic
1054861088 9:69954252-69954274 CTGTAGGCACATGGGATGGTTGG - Intergenic
1055719139 9:79152215-79152237 CTGGAGGCACACGTTAAGATAGG + Intergenic
1059625835 9:116065026-116065048 CTGAAGGCACAGGTTCAAATGGG + Intergenic
1059708169 9:116842909-116842931 GTGTAGGCAGAGGTGAAGCAGGG - Intronic
1186835166 X:13430326-13430348 CTCTAGACACAGGGGAAGCTGGG + Intergenic
1187843071 X:23508871-23508893 TTGGAGGCACAGAAGAAGATAGG + Intergenic
1189303559 X:39970017-39970039 TTGTAGGCTGAAGTGAAGATGGG + Intergenic
1191104019 X:56761159-56761181 TTGGAAGCACAGGTGAAGACAGG - Intergenic
1191108198 X:56785392-56785414 ATGGAAGCACAGATGAAGATGGG - Intergenic
1192316518 X:70055984-70056006 CTGTAAGCCCAGGACAAGATGGG + Intergenic
1197405734 X:126046802-126046824 GTGTAGGCAGAGGTGGGGATTGG + Intergenic
1197726884 X:129782311-129782333 CTGTAGGCATGGGTGGGGATAGG + Intronic
1199330676 X:146554697-146554719 CTGCAGGCAGTGGTGAAGAGGGG - Intergenic
1199838624 X:151620384-151620406 CTCTAGGCACAGGAACAGATAGG + Intronic