ID: 1011058479

View in Genome Browser
Species Human (GRCh38)
Location 6:83234090-83234112
Sequence GAGTCCATGGATATAATACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 96}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011058479 Original CRISPR GAGTCCATGGATATAATACT TGG (reversed) Intronic
905877242 1:41440218-41440240 GAGTCCATTGAGCAAATACTGGG - Intergenic
911905345 1:103561160-103561182 AAGTCTATGGATTTCATACTAGG - Intronic
917219504 1:172713013-172713035 GATCCCATGGATAAAATACAAGG - Intergenic
917569747 1:176252629-176252651 GAGTCCATGTATGTAATCTTCGG - Intergenic
923359082 1:233189933-233189955 GAGTCCATTTATATGTTACTTGG + Intronic
1068694246 10:59948882-59948904 GTGTCTATGGATCTCATACTGGG + Intergenic
1070443414 10:76469026-76469048 GAGTCTCTGGATATTGTACTAGG + Intronic
1070642823 10:78181540-78181562 GAGGCCCTGGAGATAATACCTGG + Intergenic
1070729462 10:78815732-78815754 GAGTCCAAGGAGATAACACATGG - Intergenic
1071753164 10:88504325-88504347 GATTCCCAGGATATAATATTAGG + Intronic
1072811114 10:98462721-98462743 GAGTCCAGGGACAAAACACTAGG - Intronic
1081065299 11:38533622-38533644 GAGTCCATGGATGTTAGTCTTGG + Intergenic
1081905413 11:46666295-46666317 GACTCCAAGGATATAAATCTTGG - Intronic
1084303136 11:68264381-68264403 GAGTAGATGGATAGAATAGTGGG - Intronic
1084303177 11:68264557-68264579 GAGTAGATGGATAGAATAGTGGG - Intronic
1088800648 11:113303874-113303896 GGGTCCATGGATAGAATTCAGGG - Intergenic
1092092554 12:5814733-5814755 GAGTGAATGGATGTTATACTGGG + Intronic
1093036510 12:14336799-14336821 GAGTCCATGGATAGTAGTCTTGG - Intergenic
1093048776 12:14483951-14483973 GAGTCCATGGATAATAGTCTTGG + Intronic
1093049512 12:14489849-14489871 GAGTCCATGGATAGTAGTCTTGG + Intronic
1094107596 12:26831023-26831045 GGTTCCATGGACAGAATACTTGG - Intronic
1094409558 12:30154957-30154979 GATTCCAGGGATTGAATACTGGG - Intergenic
1094563810 12:31581335-31581357 AAGTCCATGTAGATAATAATTGG + Intronic
1096590901 12:52658665-52658687 GAGTTCATGGATATATTAATGGG - Intergenic
1097328467 12:58306140-58306162 GAGACAATGGATATAGTAATTGG - Intergenic
1100413323 12:94345470-94345492 CAGTCTTTGGTTATAATACTGGG + Intronic
1101404273 12:104414214-104414236 GAGTCCTTGCATATAATTCAGGG - Intergenic
1101534452 12:105604633-105604655 GAGTCCATGGATAGTAGTCTTGG + Intergenic
1108159633 13:47624947-47624969 GAGTTAATAGATATAACACTGGG - Intergenic
1108463832 13:50694753-50694775 GAGTCCGTGGAGATAAAAGTTGG - Intronic
1110177714 13:72577416-72577438 GTGTGAATGGATATAATATTTGG + Intergenic
1111847609 13:93531158-93531180 GACTCCATGAACAGAATACTTGG - Intronic
1114746269 14:25151244-25151266 GAGTCCATAGAAAAAATAATAGG + Intergenic
1125117192 15:36108411-36108433 GAGGCCATGGGTTTCATACTAGG + Intergenic
1127604425 15:60572079-60572101 AAGTCTATGGAAAAAATACTAGG + Intronic
1130403165 15:83575815-83575837 GAGTTTATGGCTATAATCCTCGG - Intronic
1131874912 15:96795273-96795295 GTGTCTATTGATATAAAACTAGG - Intergenic
1131926140 15:97385972-97385994 GAGTTGATGGAAACAATACTGGG + Intergenic
1137453812 16:48602689-48602711 GAATTCATAGATGTAATACTGGG - Intronic
1138218746 16:55230685-55230707 AAGTCCATGGATATGAATCTTGG + Intergenic
1139772179 16:69286914-69286936 GAGTCCATGTATCTAGTACTTGG - Intronic
1144375039 17:14630879-14630901 GAGTGCATGAATTAAATACTTGG + Intergenic
1150798879 17:68262853-68262875 CAGGGCATGGATATAAAACTAGG - Intronic
1151119392 17:71775604-71775626 AAGCCCATGGAAATAATACATGG + Intergenic
1155745450 18:29351484-29351506 GAGTCCCTGAAGATAAAACTTGG + Intergenic
1159424054 18:68260886-68260908 CATTGCATGGATTTAATACTTGG - Intergenic
927425441 2:22976204-22976226 GGGTCCATGGATAAAATTCAGGG + Intergenic
928456177 2:31424656-31424678 GAGTCCATTGTAATAAAACTAGG - Intergenic
931113983 2:59144747-59144769 GAGGCCATGGATATGAGGCTGGG - Intergenic
1173599416 20:44282589-44282611 AAGTCCATGGATATAGTGGTCGG + Intergenic
1176675677 21:9775178-9775200 GAGTCCATGGATAAACTTTTGGG + Intergenic
1177462252 21:21428048-21428070 GAGTCCATGGATTCAAGACCTGG - Intronic
1177479240 21:21664764-21664786 GGGTACATGGATATAATCATAGG + Intergenic
1177811224 21:25926704-25926726 GAGGACATGGCTATATTACTTGG + Intronic
1185133430 22:49054001-49054023 GAATCAATGGATATATTAATTGG - Intergenic
1185142006 22:49107789-49107811 GAGGCCATGGATTTTATTCTGGG - Intergenic
949370778 3:3332606-3332628 GTGTCCATGCATATACAACTTGG + Intergenic
951162016 3:19435070-19435092 GAGTTCATGGATATGTTACTGGG + Intronic
962509276 3:136082827-136082849 GAGTCCTTGAAAATAAAACTTGG - Intronic
963486237 3:145937330-145937352 GTGTCTCTGGAAATAATACTAGG + Intergenic
963972586 3:151446064-151446086 GAGTCTTTGCTTATAATACTAGG + Exonic
966027897 3:175308480-175308502 TAGTCCACTGAAATAATACTCGG + Intronic
967716900 3:192772831-192772853 TAGGCGATGGATATAATAGTAGG + Intergenic
973208964 4:47593615-47593637 GAGAGCAATGATATAATACTTGG - Intergenic
977393216 4:96439855-96439877 GAGTCCAAAGATCTAATAATAGG - Intergenic
980827000 4:138085874-138085896 GAGACTATGGACATAAAACTTGG + Intergenic
981897998 4:149827196-149827218 GATGACATGGATAAAATACTAGG + Intergenic
985399863 4:189583510-189583532 GAGTCCATGGATAAACTTCTGGG - Intergenic
988441896 5:31243108-31243130 GAGTCTAAGGGTATTATACTAGG - Intronic
989378415 5:40789813-40789835 GAGGAGATGGATATACTACTTGG + Intronic
989479752 5:41916616-41916638 GTGTCCATGGATGTAATTCAGGG + Intronic
1007730499 6:43942592-43942614 GAGTCCATGGCTACATTCCTGGG - Intergenic
1011058479 6:83234090-83234112 GAGTCCATGGATATAATACTTGG - Intronic
1011095343 6:83655837-83655859 GAGTCCATGGGTATAATTTGAGG - Intronic
1011999850 6:93640259-93640281 AAGTACATTGATATAAAACTAGG + Intergenic
1012290580 6:97451024-97451046 GAGGCCATTTATATAATTCTGGG + Intergenic
1013755305 6:113454735-113454757 AAATCCATGCACATAATACTAGG + Intergenic
1020354927 7:7265625-7265647 AAGCCCATGGAGATAACACTGGG - Intergenic
1020618909 7:10495497-10495519 GAGTACATGGATATAAAGATGGG - Intergenic
1021711374 7:23419203-23419225 GAGTCCATGGATAAAATTCAGGG + Intronic
1022023480 7:26423878-26423900 GAGTCCAGGGAAATTAGACTGGG - Intergenic
1022719516 7:32930477-32930499 GAGTACATGGATGTTATGCTAGG - Intergenic
1024409315 7:49021156-49021178 GAGTCCATTCATATAAAACCAGG - Intergenic
1024667579 7:51562140-51562162 GATGCCATGGTTATAATCCTCGG + Intergenic
1034648351 7:152668758-152668780 GAGTCAATAGATTTGATACTTGG + Intronic
1041424972 8:57710501-57710523 GATTCCTTGTATATAATAGTTGG + Intergenic
1046548021 8:115675830-115675852 GAGTCCAAGCAGATAATACAAGG - Intronic
1046995388 8:120514929-120514951 GAGTCCATGGATTTAAATCCAGG - Intronic
1047311793 8:123698287-123698309 CAGTCCATGGATAGAATGCTGGG + Intronic
1047898889 8:129397867-129397889 GAGTCCTTGGGCATCATACTTGG - Intergenic
1050024740 9:1322195-1322217 AAGTCCATTCATATAAAACTAGG - Intergenic
1050235156 9:3570054-3570076 GAGCCCATGGAGTTATTACTCGG - Intergenic
1050260400 9:3835410-3835432 GACTCCTTGGAAATAATGCTGGG + Intronic
1056744813 9:89291323-89291345 GAGTTCATGGATAGAATCCAAGG - Intergenic
1057096463 9:92314781-92314803 TCTTCCATGGATATGATACTGGG + Exonic
1057706046 9:97395904-97395926 GAGTCCTTGTATACAAAACTGGG + Intergenic
1061199761 9:129130779-129130801 GAATCCATGGGTAAAAAACTTGG - Intronic
1062602648 9:137325295-137325317 GAGTCCTTGGATGTGACACTTGG - Intronic
1187996161 X:24929177-24929199 GGATCCTTGGATCTAATACTTGG + Intronic
1189103307 X:38212828-38212850 GAGTCCAAGGATTCAAGACTTGG - Intronic
1191807110 X:65147636-65147658 GAGTCCATGGAGGCAATGCTGGG + Intergenic
1192456351 X:71279339-71279361 GAGGACATGGATATAACCCTGGG - Intergenic
1193124187 X:77853947-77853969 GCTTCCATGGATATAATTCTAGG + Exonic
1193509526 X:82382645-82382667 TAGTCCCTGGATATTATTCTGGG + Intergenic