ID: 1011060347

View in Genome Browser
Species Human (GRCh38)
Location 6:83259008-83259030
Sequence GGAAATATATGAACAGATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011060345_1011060347 -5 Left 1011060345 6:83258990-83259012 CCAGGTCCTTTTATTATAGGAAA 0: 1
1: 0
2: 1
3: 11
4: 183
Right 1011060347 6:83259008-83259030 GGAAATATATGAACAGATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011060347 Original CRISPR GGAAATATATGAACAGATAT TGG Intronic
No off target data available for this crispr