ID: 1011061952

View in Genome Browser
Species Human (GRCh38)
Location 6:83279997-83280019
Sequence CATGATGCAGAATTGTAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 222}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011061952_1011061954 -1 Left 1011061952 6:83279997-83280019 CCAACCTACAATTCTGCATCATG 0: 1
1: 0
2: 2
3: 24
4: 222
Right 1011061954 6:83280019-83280041 GTAATACACTGATATACTGTAGG 0: 1
1: 0
2: 0
3: 19
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011061952 Original CRISPR CATGATGCAGAATTGTAGGT TGG (reversed) Intronic
903631794 1:24779877-24779899 AATGATGAAGAATTGAAGCTGGG - Intronic
903636625 1:24822804-24822826 CATCATGCAGAATTGTTTCTAGG + Intronic
903916684 1:26769873-26769895 AAGGAGGCAGAACTGTAGGTTGG + Intronic
904967076 1:34382987-34383009 CTGGATACAGAATTCTAGGTCGG - Intergenic
905287910 1:36896003-36896025 CAGGATACAGAATTATAGGTTGG - Intronic
905514608 1:38553065-38553087 CATGTTGCTGTATTGTAGGTAGG - Intergenic
906017824 1:42598186-42598208 CAAGGTACAGAATTCTAGGTTGG - Intronic
907542833 1:55232099-55232121 CATGATGCAGAGTTGAAGATTGG + Intergenic
908699617 1:66884387-66884409 CATTATGGAAAACTGTAGGTAGG - Intronic
909629953 1:77760651-77760673 CATGATACAAAATTCTAGGTAGG + Intergenic
912706121 1:111914645-111914667 CTTGATGTAGAATTCTGGGTTGG - Intronic
913088800 1:115462122-115462144 CATCCAGCAGAATTGTAGGGAGG - Intergenic
915270942 1:154752937-154752959 CGTGATGCAGAACTGGAGGCAGG - Intronic
915955340 1:160215983-160216005 CAGGATACAGAATTCTTGGTTGG + Exonic
916800625 1:168212692-168212714 CAGGACACAGAATTCTAGGTTGG - Intergenic
919596880 1:199575333-199575355 CATCAACCACAATTGTAGGTTGG - Intergenic
922009479 1:221567352-221567374 GATGCCCCAGAATTGTAGGTAGG - Intergenic
922111894 1:222566831-222566853 CAGGATGTGGAATTGTTGGTAGG + Intronic
922430143 1:225543552-225543574 AATGGTGCAGAATGGTAGTTAGG - Intronic
922807851 1:228399778-228399800 GATGCTGCAGACTTGGAGGTGGG + Intronic
924146255 1:241077952-241077974 CATGATGCTGAATTACAGGGTGG + Intronic
924931439 1:248736204-248736226 CATGAGGCAGAATTGTTGCTGGG + Intronic
1065304269 10:24353966-24353988 CATGCTGCAGAGCTGTAGCTGGG + Intronic
1065549529 10:26856774-26856796 CAGGATGCAGATTGGTAGGTTGG - Intronic
1065603137 10:27390096-27390118 CAGGATACAAAATTCTAGGTTGG + Intergenic
1067392106 10:45873387-45873409 GATGATGCAGCATTTGAGGTAGG + Intergenic
1067402827 10:45993013-45993035 GATGATGCAGCATTTGAGGTAGG - Intronic
1067871177 10:49962658-49962680 GATGATGCAGCATTTCAGGTAGG - Intronic
1067975331 10:51018237-51018259 CTGGATGTAGAATTCTAGGTCGG + Intronic
1071143866 10:82544194-82544216 CATGATGCTGATTTGTATTTGGG + Intronic
1071576926 10:86734084-86734106 GATGATGCAGACCTGAAGGTGGG - Exonic
1071666245 10:87561735-87561757 TATGATGCAGAATTTTATGGGGG + Intergenic
1072120258 10:92399761-92399783 CAGAATACAGAATTGTAAGTTGG - Intergenic
1074521047 10:114224191-114224213 CTGGATGCAGAATTCTAGATTGG + Intronic
1077202923 11:1321365-1321387 CAGGATACAGAATTCTAGCTTGG - Intergenic
1084339879 11:68490194-68490216 CAGGGTGCAGAATTCTAGGTTGG + Intronic
1086085420 11:82949315-82949337 CTCGATGCAGAAGTCTAGGTTGG + Intronic
1086392539 11:86380213-86380235 CAGGATGCAGAATTTTAGGTTGG + Intronic
1087688756 11:101295768-101295790 AAAGATACAGAATTGCAGGTTGG - Intergenic
1088006759 11:104950346-104950368 TATGAGACAGAATTGTAGGGTGG - Intronic
1089095259 11:115914931-115914953 CAAGATGTAGACTTGTAGGCAGG + Intergenic
1093582955 12:20805249-20805271 TCTGATACAGAAGTGTAGGTTGG + Intergenic
1096187519 12:49591431-49591453 CTGGATGTAGAATTCTAGGTGGG - Intronic
1097965250 12:65572443-65572465 CAGAATGGAAAATTGTAGGTGGG - Intergenic
1098018637 12:66132612-66132634 CATGATGCAGAACAGTCAGTGGG + Intronic
1102335449 12:112075155-112075177 CATGGTGCTGAATTCTAGTTAGG - Intronic
1103988474 12:124782678-124782700 CAGGAAGCAAAACTGTAGGTGGG - Exonic
1104404529 12:128506527-128506549 GAGGATGCAGAAGTGTATGTGGG + Intronic
1105204549 13:18209629-18209651 CAGAATACAGAATTTTAGGTTGG - Intergenic
1105208320 13:18241825-18241847 GATGATGGGGATTTGTAGGTAGG - Intergenic
1105294969 13:19080149-19080171 CTGGATACAGAATTCTAGGTTGG - Intergenic
1105956049 13:25283905-25283927 CATGATTCATAAGTGTAGCTTGG + Intronic
1109552665 13:63924747-63924769 CATGAAGCAGCATTTTAGCTAGG - Intergenic
1110214826 13:73013903-73013925 CAGGGTACAGAATTTTAGGTTGG - Intronic
1112319306 13:98392565-98392587 CAAGATGCAGAATTATATATGGG - Intronic
1114029257 14:18561536-18561558 CAAGATGGACAAATGTAGGTTGG - Intergenic
1116355927 14:43929989-43930011 TATGGTACAGAATTCTAGGTTGG - Intergenic
1116728177 14:48588995-48589017 GATGATGAAGAAATGTAAGTGGG + Intergenic
1117206440 14:53448555-53448577 CATTCTGCAGAGTTGTAGGGAGG - Intergenic
1122377982 14:101279574-101279596 CTTGATACAGAATTCTGGGTTGG - Intergenic
1122876750 14:104670291-104670313 CTGGGTGTAGAATTGTAGGTTGG - Intergenic
1202847921 14_GL000009v2_random:198972-198994 GTTCATGCAGAATTTTAGGTGGG - Intergenic
1125239272 15:37554741-37554763 TTTGATGCAGAATTTTAGGTTGG - Intergenic
1126949125 15:53860408-53860430 CATGATTCTGAATTGTGGCTAGG - Intergenic
1127533402 15:59866876-59866898 CATGATGCAGAATTCGTGGCTGG + Intergenic
1128625872 15:69202577-69202599 CATGATACAGAATTGTAACCAGG - Intronic
1130157110 15:81360675-81360697 CATGCTGCAGAACTGCTGGTGGG - Intronic
1131185415 15:90269837-90269859 CAAGATGCAGGATTTTAGCTTGG - Intronic
1131671670 15:94626343-94626365 CCTGCTGCACAATTGTAGGATGG + Intergenic
1131892724 15:96991145-96991167 CTGGATACAGAATTCTAGGTTGG + Intergenic
1132022815 15:98378203-98378225 CAGGTTACAGAATTTTAGGTTGG - Intergenic
1132566211 16:624695-624717 CTGGTTGCAGAATTGTAGGGTGG + Intronic
1135904232 16:26496340-26496362 AATGATGCAGAATTAGATGTTGG - Intergenic
1137305536 16:47195988-47196010 CTGGATACAGAATTGTAGGTTGG + Intronic
1138904620 16:61315765-61315787 CAGGGTACAGAATTCTAGGTTGG - Intergenic
1139755666 16:69141346-69141368 CATGAGAAAGAATTCTAGGTTGG + Intronic
1139793976 16:69466954-69466976 CCTGATGCTGAATAGTGGGTAGG + Intergenic
1140658328 16:77163246-77163268 CATCATGGAGCATTCTAGGTGGG + Intergenic
1144048857 17:11480053-11480075 CAGGATACAGGATTCTAGGTTGG + Intronic
1149350311 17:55779937-55779959 CATGATGCAGATGTGTGGGAGGG - Intronic
1149727336 17:58909571-58909593 CAGGGTACAGAATTCTAGGTGGG + Intronic
1150195027 17:63288955-63288977 CAGGGTACAGAATTCTAGGTTGG + Intronic
1151536467 17:74741669-74741691 CCTGATGCAGATTTGTAAGATGG - Intronic
1153751619 18:8237811-8237833 CAGGACACAGAATTCTAGGTTGG + Intronic
1156089431 18:33448056-33448078 CAGGATACAGAATTCTAGGTTGG - Intergenic
1157073369 18:44436419-44436441 CAGGATACAGAATTCTAGGTTGG + Intergenic
1159102124 18:63969351-63969373 CATGGATCAGAACTGTAGGTAGG + Intronic
1160535918 18:79591379-79591401 CAGGGTACAGAATTGTAGGTTGG - Intergenic
1163198604 19:15745255-15745277 TAGGGTGCAGAATTCTAGGTTGG + Intergenic
1165141152 19:33700707-33700729 CATTATGCACAATTGGAGGTGGG + Intronic
1165431866 19:35777508-35777530 CATGAAGCAGGATGGCAGGTCGG - Intronic
1166496620 19:43307513-43307535 CATGGTGCAGGCTTGAAGGTGGG + Intergenic
1168551702 19:57301843-57301865 CATGTGGTAGAATTGGAGGTAGG + Intergenic
925091612 2:1161036-1161058 CATGCTGGTGAATTGGAGGTTGG + Intronic
928852296 2:35763594-35763616 CTGGATGGAGAATTCTAGGTTGG - Intergenic
929137254 2:38637034-38637056 TAAGATGCAGAATTGTAGCAGGG + Intergenic
930847883 2:55924509-55924531 CATGATGGAAAATTGTATGGAGG + Intergenic
931051411 2:58419064-58419086 CATGGTTCAAAATGGTAGGTGGG - Intergenic
931160183 2:59681061-59681083 CAGGATGCAGGTTTGTGGGTTGG - Intergenic
931489722 2:62731970-62731992 CTGGATACAGAATTCTAGGTTGG + Intronic
931495997 2:62807777-62807799 CAGGGTACAGAATTCTAGGTTGG + Intronic
933102669 2:78280601-78280623 CTGCATGCTGAATTGTAGGTTGG - Intergenic
933570640 2:84006841-84006863 CAGGGTGCAGAATTCTAGATTGG - Intergenic
933591975 2:84243123-84243145 CATGATGGAGAATTCTACTTAGG - Intergenic
933629804 2:84643139-84643161 CAGGGTACAGAATTCTAGGTTGG + Intronic
933885239 2:86713160-86713182 CAGGATACAGAATTCTACGTTGG - Intronic
933924935 2:87083523-87083545 CAGGATACAGAATTCTACGTTGG + Intergenic
935494059 2:103756453-103756475 CTTGATGGATAATTGTGGGTTGG - Intergenic
936942262 2:117897225-117897247 CAGGATATAGAATTCTAGGTTGG + Intergenic
937435601 2:121878267-121878289 CTGGATCCAGAATTCTAGGTTGG + Intergenic
937809876 2:126187347-126187369 CTTTCTGCAGAATTGTAGATAGG + Intergenic
938059807 2:128244073-128244095 CAGCATGAAGAATTCTAGGTTGG - Intronic
941169901 2:162124069-162124091 CCTGATGGAGAATTGAAGGGAGG + Intergenic
942105350 2:172628500-172628522 CATGGTGCAAAATTGTCAGTAGG + Intergenic
945328275 2:208509061-208509083 ATTAATGCAGAATTCTAGGTTGG + Intronic
945362274 2:208906480-208906502 CCTGATGCAGGAATGCAGGTGGG + Intergenic
947510439 2:230748277-230748299 TTTGATTCAGAATTGTAGTTGGG + Intronic
1169509520 20:6248725-6248747 CAGGGTACAGAATTCTAGGTTGG + Intergenic
1170022962 20:11856058-11856080 CAGGATACAGAATTCTAGGTTGG - Intergenic
1170721224 20:18880993-18881015 CAGGGTACAGAATTATAGGTTGG + Intergenic
1170903215 20:20486351-20486373 CTGGATACAGAATTCTAGGTTGG + Intronic
1171007976 20:21486435-21486457 CTGGATGTAGAATTCTAGGTTGG - Intergenic
1171155434 20:22868417-22868439 CTGGATGCAGAATTCTAGGTTGG - Intergenic
1173615706 20:44401584-44401606 AATGATACAAAATGGTAGGTTGG + Intronic
1173823846 20:46035067-46035089 CAGGATAATGAATTGTAGGTGGG - Intronic
1175437559 20:58964895-58964917 CAGGGTACAGAATTCTAGGTTGG - Intergenic
1175842934 20:62041933-62041955 TATGCTACAGAATTGTATGTGGG - Intronic
1176713428 21:10328459-10328481 CAGGATACAGAATTTTAGTTTGG + Intergenic
1180453373 22:15488599-15488621 CAAGATGGACAAATGTAGGTTGG - Intergenic
1180656089 22:17421973-17421995 CAGGGTACAGAATTCTAGGTTGG + Intronic
1180758890 22:18183722-18183744 GATGATGGGGATTTGTAGGTAGG - Intergenic
1180769177 22:18367513-18367535 GATGATGGGGATTTGTAGGTAGG - Intergenic
1180777135 22:18494882-18494904 GATGATGGGGATTTGTAGGTAGG + Intergenic
1180809855 22:18752191-18752213 GATGATGGGGATTTGTAGGTAGG + Intergenic
1180827049 22:18870742-18870764 GATGATGGGGATTTGTAGGTAGG - Intergenic
1180829810 22:18899042-18899064 CAGGATACAGAATTTTAGGTTGG + Intergenic
1181195998 22:21186443-21186465 GATGATGGGGATTTGTAGGTAGG + Intergenic
1181213530 22:21306681-21306703 GATGATGGGGATTTGTAGGTAGG - Intergenic
1203230801 22_KI270731v1_random:108398-108420 GATGATGGGGATTTGTAGGTAGG - Intergenic
1203277194 22_KI270734v1_random:96647-96669 GATGATGGGGATTTGTAGGTAGG - Intergenic
1203279901 22_KI270734v1_random:124315-124337 CAGGATACAGAATTTTAGGTTGG + Intergenic
950843775 3:15994799-15994821 CAGGGTGCAGAATTTTAGGTTGG + Intergenic
950850380 3:16056723-16056745 CATGATGCAAAAATGTAGGTAGG - Intergenic
951134066 3:19083128-19083150 CAGGGTACAGAATTCTAGGTTGG - Intergenic
957291197 3:78280562-78280584 CATGCAGCAGAATTTTAGATTGG - Intergenic
959753432 3:109866383-109866405 CAATATGCAGAACTATAGGTTGG - Intergenic
961197145 3:125012254-125012276 AGTGATGCAGGATTGTAGGGTGG - Intronic
961488393 3:127233532-127233554 CATGGTCCTGAAATGTAGGTGGG - Intergenic
962465508 3:135654482-135654504 CAAGGTTCAGAATTCTAGGTTGG - Intergenic
962899608 3:139748071-139748093 CAGGGTACAGAATTCTAGGTTGG - Intergenic
964156648 3:153592952-153592974 CCTGTTGCAAAATGGTAGGTTGG + Intergenic
967548106 3:190756705-190756727 CAGGAGACAGAATTGTAGCTTGG + Intergenic
967872008 3:194237815-194237837 CAGGGTACAGAATTCTAGGTTGG - Intergenic
968981970 4:3855152-3855174 AATCATGCATGATTGTAGGTAGG + Intergenic
969967821 4:11014875-11014897 CACAATGCAGAATTGTTGGATGG + Intergenic
971090544 4:23338578-23338600 CAGGATAAAGAATTCTAGGTTGG - Intergenic
971696850 4:29915893-29915915 CATAATGCAGATTTGTCAGTCGG - Intergenic
973313399 4:48733313-48733335 CAGGATACAGAATTCTAGGCTGG - Intronic
974220512 4:58963556-58963578 AATAATGCAGAACTGTAGTTGGG - Intergenic
978826842 4:113034742-113034764 CATGATGGGGAAATGTAGTTTGG + Intronic
980639328 4:135555039-135555061 CATTATACAGAATTGGAGGAAGG - Intergenic
980771325 4:137377341-137377363 CATTATGCAGATTAGTAAGTGGG + Intergenic
981797375 4:148611554-148611576 CATGCTGCAGAAGTGAAGTTTGG + Intergenic
981992300 4:150936768-150936790 AATGATGTACAATTGTATGTGGG - Intronic
984405624 4:179325914-179325936 CATGAGGCAGATTTGCAGGCTGG + Intergenic
985207667 4:187557314-187557336 CTGGATACAGAATTCTAGGTTGG + Intergenic
986191915 5:5504899-5504921 CAAGATGTGGAATTCTAGGTTGG - Intergenic
987301321 5:16600295-16600317 CATCATACAGATTTGTAGGCTGG - Intronic
988647967 5:33116652-33116674 CAGGATACAGCATTCTAGGTTGG + Intergenic
989462010 5:41711663-41711685 CAGGGTACAGAATTCTAGGTTGG + Intergenic
989554389 5:42775451-42775473 CAGGATGCAGAATTATTGGTTGG - Intronic
990080619 5:51909300-51909322 CATGCTGCAGAATTCCAGGAAGG - Intergenic
990902404 5:60766877-60766899 CAGAAAGCAGAATTGTAGCTGGG - Intronic
991119645 5:62996862-62996884 CAGGGTACAGAATTTTAGGTTGG + Intergenic
991542735 5:67747793-67747815 CAGGGTCCAGAATTCTAGGTAGG - Intergenic
992033528 5:72748373-72748395 AATTTTGCAGAATTTTAGGTTGG - Intergenic
992855790 5:80860409-80860431 CAAGGTACAGAATTCTAGGTTGG + Intronic
993203006 5:84843278-84843300 CAGGGTACAGAATTATAGGTTGG - Intergenic
994581023 5:101642059-101642081 CTTGCTGCAGAATTGTATTTAGG + Intergenic
994621904 5:102173426-102173448 GAAGAAGCAGAAATGTAGGTGGG + Intergenic
995906030 5:117124818-117124840 CAAGGTACAGAATTCTAGGTTGG + Intergenic
996809190 5:127495174-127495196 CTGGGTGCAGAATTCTAGGTTGG - Intergenic
997764426 5:136486052-136486074 CATGCTGCAGATATGTTGGTGGG - Intergenic
999845732 5:155477651-155477673 CTTGATGCAGAAGTCAAGGTAGG - Intergenic
1001499342 5:172217079-172217101 CAGCATACAGAATTATAGGTTGG - Intronic
1001768070 5:174270471-174270493 CATCATTCAGAATTGTAAGAAGG - Intergenic
1003250233 6:4421820-4421842 CTGGATACATAATTGTAGGTTGG - Intergenic
1004578142 6:16919581-16919603 TATTATGTAGAATTCTAGGTTGG + Intergenic
1004779598 6:18893913-18893935 CATAGTGCAGGATTGTAGCTAGG + Intergenic
1008970618 6:57363516-57363538 CTGGATGTAGAATTCTAGGTTGG + Intronic
1009159582 6:60265325-60265347 CTGGATGTAGAATTCTAGGTTGG + Intergenic
1009450100 6:63790574-63790596 CCTGATGCAGCATTGCAGGTGGG - Intronic
1011061952 6:83279997-83280019 CATGATGCAGAATTGTAGGTTGG - Intronic
1014971398 6:127819659-127819681 CTGGATGCAGAATTCTAGGTTGG - Intronic
1015354212 6:132258051-132258073 CAGGAAGCAGAATTATAGATGGG - Intergenic
1015361643 6:132346530-132346552 CTTCATGCAGAATTCTATGTTGG + Intronic
1015986599 6:138890824-138890846 CTGGATACAGAATTCTAGGTTGG + Intronic
1017921532 6:158876991-158877013 CTGGATACAGAATTCTAGGTTGG + Intronic
1018824514 6:167399016-167399038 TATGATGCAGAATTCTAGTGAGG + Intergenic
1022296390 7:29058657-29058679 CAAGGTGCAGAATTCTAAGTTGG + Intronic
1023877677 7:44296796-44296818 CTGGATACAGAATTCTAGGTTGG - Intronic
1028100149 7:86809345-86809367 CATGATCCACAATTGTATGATGG - Intronic
1028970753 7:96856425-96856447 CTGGATGTAGAATTCTAGGTTGG - Intergenic
1031493225 7:122415340-122415362 CGTGATGCAGCATTGTAAGACGG + Intronic
1031848804 7:126838496-126838518 CTTGATAAAGAATAGTAGGTGGG - Intronic
1033722891 7:144080613-144080635 CTGGATGTAGAATTCTAGGTTGG - Intergenic
1036666097 8:10741005-10741027 CTAGATACAGAATTCTAGGTTGG - Intronic
1037030556 8:14099164-14099186 CATGCTGCACAAATCTAGGTAGG - Intronic
1038476846 8:27874754-27874776 CATCAGACAGATTTGTAGGTGGG - Intronic
1038512290 8:28150472-28150494 TAGGATTCAGAATTCTAGGTTGG + Intronic
1040789345 8:51206810-51206832 CAGGATATAGAATTTTAGGTTGG + Intergenic
1041092994 8:54320204-54320226 CAGGGTACAGAATTCTAGGTTGG - Intergenic
1041892518 8:62886606-62886628 CAGGGTGCAGAATTTTAGGTTGG + Intronic
1041976848 8:63809228-63809250 CATGTTGAAGAGTTGTATGTAGG - Intergenic
1042358803 8:67859159-67859181 CTGGATACAGAATTCTAGGTTGG - Intergenic
1043066476 8:75577674-75577696 CATGATACAGAGTTATAGCTTGG - Intergenic
1043570923 8:81601555-81601577 CATGATGGAGTAATGGAGGTGGG - Intergenic
1045564161 8:103297039-103297061 CAAGGTACAGAATTATAGGTTGG - Intergenic
1046003826 8:108454840-108454862 CAGGATACAGAATTCTAAGTTGG + Intronic
1046502149 8:115092484-115092506 CAGGATACAGAAGTCTAGGTTGG + Intergenic
1048477508 8:134756666-134756688 GAGGAAGCAGAACTGTAGGTGGG - Intergenic
1049918738 9:343979-344001 AATGATCCAGAAATGTAGGAGGG + Intronic
1051814615 9:21090807-21090829 CAAGATACAGAATCCTAGGTTGG + Intergenic
1051981300 9:23022401-23022423 CAGGATACAGAATTCTATGTTGG + Intergenic
1053301388 9:36953107-36953129 CATGATATAAAATTCTAGGTGGG + Intronic
1054747823 9:68872741-68872763 CATGATGCAGAATGCTGTGTAGG - Intronic
1055906279 9:81296876-81296898 CAGGCTACAGAATTCTAGGTTGG - Intergenic
1056401918 9:86236213-86236235 CAGAATACAGAATTCTAGGTTGG - Intronic
1057239626 9:93397302-93397324 CAAGCTACAGAATTCTAGGTTGG + Intergenic
1057264860 9:93609531-93609553 CTGGATACAGAATTCTAGGTTGG + Intronic
1057628955 9:96703727-96703749 CAGGATACAGAATTCTCGGTTGG - Intergenic
1058429280 9:104903868-104903890 CATGATGCAGAGCTGTGTGTTGG - Intronic
1058803873 9:108570837-108570859 TATGATGCTGCATTTTAGGTTGG - Intergenic
1059310077 9:113382239-113382261 CATGAAGCAGAAGTGGGGGTGGG + Intergenic
1060803980 9:126563523-126563545 CAGGATGCAGAAGTGGAGGACGG + Intergenic
1061971503 9:134047793-134047815 GATGATACAGAATGGGAGGTAGG + Intronic
1188767606 X:34115402-34115424 CAGGATGCAGAATTCTAGGCTGG + Intergenic
1189635589 X:43004987-43005009 CATGATGCAGAATTAGAAATGGG + Intergenic
1189750361 X:44214491-44214513 CAGGATACAGAATTTTAGATTGG - Intronic
1190447438 X:50541646-50541668 AAGGATGCAGAACTCTAGGTTGG - Intergenic
1192399629 X:70821840-70821862 CATTATGCAAAATAGTAGGAAGG + Intronic
1192862354 X:75089061-75089083 CTAGGTGCAGAATTCTAGGTTGG - Intronic
1193483140 X:82052510-82052532 CATTATGAAGAATTGTATGGAGG - Intergenic
1193681357 X:84522921-84522943 CTTGATACAGAATTGTAAATTGG - Intergenic
1194519834 X:94905226-94905248 CATGATACAGAATTCTGGGTTGG + Intergenic
1195445911 X:104952111-104952133 CCTGATGCAAAATTATTGGTGGG + Intronic
1196213473 X:113022805-113022827 CTGGATACAGAATTCTAGGTTGG - Intergenic
1199110162 X:143922625-143922647 CAAGATATAGAATTCTAGGTTGG - Intergenic
1201509685 Y:14745336-14745358 TGTGATGCAGAAGTGTAGGATGG - Intronic