ID: 1011066527

View in Genome Browser
Species Human (GRCh38)
Location 6:83332742-83332764
Sequence CTGGAGACTCAGATGGGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 844
Summary {0: 1, 1: 3, 2: 23, 3: 130, 4: 687}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011066527 Original CRISPR CTGGAGACTCAGATGGGAGG AGG Intronic
901285565 1:8075922-8075944 CTGGAGCTCCAGGTGGGAGGTGG + Intergenic
901349490 1:8580940-8580962 TGGGAGCCTGAGATGGGAGGAGG - Intronic
901748283 1:11389129-11389151 CTGCAGACTCAGAGGGGGGAAGG - Intergenic
901752157 1:11416949-11416971 CTGGAGACTGGGATGGGATGAGG - Intergenic
901879050 1:12183197-12183219 CTGTGGACCCAGATGGGAGGCGG + Intronic
902077013 1:13795379-13795401 CTGAAGTCACAGATGGTAGGAGG + Intronic
902236999 1:15063913-15063935 CTGGAGTCTCAGGTGGGCTGGGG + Intronic
902376498 1:16032432-16032454 CTGGAGACACTGCTGGGAGTGGG - Exonic
902718101 1:18286598-18286620 TTGGAGCCTCACATCGGAGGTGG + Intronic
902845803 1:19109969-19109991 CTGGAGCCTCTCAGGGGAGGTGG + Intronic
903214103 1:21833668-21833690 CCTGAGGCACAGATGGGAGGTGG - Intronic
903281109 1:22250485-22250507 CTGGTGACTCAGATGGGGAGGGG + Intergenic
903386442 1:22930178-22930200 CGGGAGGCTCAGGTAGGAGGAGG + Intergenic
903419833 1:23210730-23210752 GTGGAAACTCAGATGAGAGCTGG - Intergenic
903751949 1:25628749-25628771 TTGGAGACTCAGAAGGGGGAGGG - Intronic
904684205 1:32248779-32248801 CTGCTGACCCAGCTGGGAGGGGG + Exonic
904805460 1:33128266-33128288 CTGGAGGCTGAGGTGGGAGGAGG + Intergenic
905386179 1:37605886-37605908 CAGGACACTGAGATGGGAAGAGG - Intergenic
905390336 1:37632315-37632337 CTGGTGATTCAGGTGGGAGTGGG - Exonic
905807472 1:40887268-40887290 CTGGAGAATGAGGTGGGAGGTGG + Intergenic
905868943 1:41391951-41391973 GTGGAAACCCAGATGGGAGTTGG - Intergenic
905888127 1:41502667-41502689 CTGGAGACTCCGGTGGGGTGTGG - Intergenic
905975074 1:42168610-42168632 CTGGAGGTTCAGAGGGGAGGGGG - Intergenic
906312237 1:44762163-44762185 CTGGAGAGTCAGCTGGGTGAGGG + Intronic
906668664 1:47639221-47639243 CTGGAAGCTCTGCTGGGAGGGGG - Intergenic
906676190 1:47695122-47695144 CCCGAGACCCAGAGGGGAGGAGG - Intergenic
906733356 1:48101916-48101938 GTGGTCACTCAGATGGCAGGGGG + Intergenic
906736161 1:48130938-48130960 ATGGAGACTCAGAAGGGTGAGGG - Intergenic
906882199 1:49603719-49603741 CTGGAGACTCAGAATGGGGGAGG - Intronic
907960361 1:59274148-59274170 TTAGAGACTCAGAAGGCAGGGGG + Intergenic
907977919 1:59450512-59450534 CTGTATACTCATATAGGAGGAGG - Intronic
908169587 1:61491499-61491521 CTAGAGATACTGATGGGAGGTGG - Intergenic
908335414 1:63118138-63118160 TTGGAGACACAGATGTGAAGGGG + Intergenic
908336164 1:63126126-63126148 CTGAAGAGTCAGATAGGAGGAGG - Intergenic
908857463 1:68446633-68446655 GTGAAAACTCACATGGGAGGAGG + Intronic
908959377 1:69676936-69676958 CTGGAGACTCAGAAGGGAAAGGG - Intronic
909702737 1:78545326-78545348 CAGGAGACTGAGGTGGGAGATGG - Intergenic
910393244 1:86765689-86765711 CTGGAGACTAATATAGGGGGAGG - Intergenic
911052031 1:93680002-93680024 CTGGAGAGTCAGATGGAGAGAGG + Intronic
912236691 1:107859174-107859196 CAGGAGGCTGAGGTGGGAGGAGG - Intronic
912897194 1:113604807-113604829 TTGAAGATTCAGAAGGGAGGAGG + Intronic
913024959 1:114828940-114828962 CAGGAGACTGAGCTGGGAGGAGG - Intergenic
913054720 1:115147768-115147790 ATGGAGACTCAGAGGGTAAGGGG + Intergenic
916453244 1:164941860-164941882 TTGGAGACTCTGAAGGGAGGAGG - Intergenic
916577736 1:166082217-166082239 CTAGAGAGCCAGAAGGGAGGGGG - Intronic
916823957 1:168426738-168426760 CTTGAGAATCACCTGGGAGGAGG + Intergenic
917953395 1:180065190-180065212 CTGGAGATTGAAATGGGAGAAGG - Exonic
918091315 1:181297479-181297501 CTGAAGCATCAGAAGGGAGGGGG + Intergenic
918566880 1:185944302-185944324 TTGAAGACTCAGAAGGGAGAGGG + Intronic
919211611 1:194494144-194494166 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
919590908 1:199500824-199500846 ATGGAAACTCAGAGGGGTGGGGG + Intergenic
920414995 1:205793211-205793233 CAGGACACACAGCTGGGAGGAGG + Intronic
920430278 1:205914447-205914469 CCAGAGACTCAGAGGGGAAGAGG - Exonic
920611143 1:207438966-207438988 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
921007634 1:211110951-211110973 CTGGTGAGTAGGATGGGAGGAGG + Intronic
922162713 1:223090157-223090179 CTGGAGAGCCAGATGAGGGGAGG - Intergenic
922202162 1:223413835-223413857 CAGGAGACTCAAAAGTGAGGAGG + Intergenic
922461459 1:225817167-225817189 CTGGAGACTCAGGATGGAAGAGG - Intronic
922575711 1:226659513-226659535 GTGGATACACAGAAGGGAGGAGG - Intronic
922575749 1:226659668-226659690 GTGGATACGCAGAAGGGAGGAGG + Intronic
922599723 1:226840676-226840698 CAGGAGGCTGAGCTGGGAGGTGG + Intergenic
922647199 1:227300658-227300680 GTGGAGACTCAGAAGGGAGAAGG + Intronic
923033278 1:230266546-230266568 CTGGACACTCACTTGGGAGGAGG - Intronic
923304772 1:232678387-232678409 CTGAACACTGACATGGGAGGTGG - Intergenic
923561108 1:235042745-235042767 GTGAAGACTCAGAACGGAGGCGG - Intergenic
923684490 1:236144307-236144329 CAGGAGGCTGAGGTGGGAGGCGG + Intronic
923806999 1:237268542-237268564 CTGGAGGGTCAGTTAGGAGGTGG + Intronic
924108113 1:240669712-240669734 ATGGAGACTCAGAAGGGTGAAGG - Intergenic
924165857 1:241282147-241282169 CTGGGGACTCCTAGGGGAGGAGG - Intronic
1063150920 10:3335643-3335665 CTGGGGACCCAGATTTGAGGAGG + Intergenic
1063216440 10:3930049-3930071 CTGGAGGCTGAGCTGGAAGGGGG + Intergenic
1063427496 10:5961491-5961513 CTGGAGGCTCAGCTGAGAGCAGG + Intronic
1064020086 10:11801977-11801999 CTGGAGACTCAGAAGGAGGGAGG + Intergenic
1064358991 10:14646342-14646364 CTGGAGACTCAGGAGGAGGGAGG - Intronic
1064594216 10:16926984-16927006 TTGGAGACTCAGAAGTGGGGAGG - Intronic
1064759965 10:18608528-18608550 CAGGAGGCTGAGGTGGGAGGAGG + Intronic
1064955500 10:20903856-20903878 ATGGAGACTCAGAAGGGAGAAGG + Intronic
1065330525 10:24592673-24592695 CCGGAGGCTGAGGTGGGAGGAGG + Intronic
1065423677 10:25576202-25576224 CTGGAGACTCAGAAGGGGTTAGG - Intronic
1065567114 10:27023221-27023243 CAGGAGGCTGAGTTGGGAGGCGG + Intronic
1065796352 10:29311870-29311892 CGGGAGGCTGAGGTGGGAGGTGG + Intronic
1066173198 10:32874439-32874461 CTGGAGGCTCAGAAGGGGAGAGG - Intronic
1066418405 10:35242147-35242169 GGGGAGGCTCAGGTGGGAGGGGG - Intergenic
1066444499 10:35469654-35469676 ATGGAGAGTCAGACGGGAGATGG + Intronic
1066597788 10:37071062-37071084 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
1066687482 10:37994497-37994519 ATGGAGTCACAGATGGGAGTGGG + Intergenic
1066704011 10:38157741-38157763 CTGGGGACGCACATGGGAGATGG + Intergenic
1067935266 10:50605904-50605926 ATGGAGACTCAGAAGGGTGAAGG - Intronic
1068011534 10:51457412-51457434 TTGGGGACTCAGTGGGGAGGGGG + Intronic
1068120569 10:52779278-52779300 AGGGAGACAGAGATGGGAGGAGG - Intergenic
1068520635 10:58073468-58073490 CCGGAGACTCAGAAGGAGGGAGG - Intergenic
1068640260 10:59396956-59396978 ATGGAGACTCAGAAGGGTGAGGG - Intergenic
1068833615 10:61526666-61526688 CTGGAGACTCAGGAGGGTGCAGG + Intergenic
1069129692 10:64683333-64683355 CAGGAGAATCACCTGGGAGGTGG - Intergenic
1070027441 10:72645520-72645542 TGGGAGGCTGAGATGGGAGGAGG + Intergenic
1070337685 10:75469762-75469784 CTGGAGACTGGTATGGGATGAGG + Intronic
1070715191 10:78715289-78715311 ATGGAGACTTAGATGTGTGGAGG - Intergenic
1070846278 10:79524680-79524702 CAGGAGGCTGAGATGGGAGAAGG + Intergenic
1070927521 10:80235630-80235652 CAGGAGGCTGAGATGGGAGAAGG - Intergenic
1071249043 10:83797130-83797152 CTGGAGACTCAGAGGGCATGAGG - Intergenic
1071299595 10:84246386-84246408 CTGGAGACTCAGAAGGGGAAGGG - Intronic
1071936314 10:90534767-90534789 CTGGGGACTCATATGGCAGTTGG - Intergenic
1072223104 10:93344405-93344427 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1072234847 10:93444882-93444904 CTTGAGCCTCAGAGGGGTGGAGG - Intronic
1072699927 10:97633319-97633341 CTGGAGGCGCAGGAGGGAGGGGG - Intronic
1073248784 10:102109190-102109212 ACGGAGACTCAGATGGGAGAGGG + Intronic
1074164777 10:110865499-110865521 CTGCAGACATAGAGGGGAGGGGG + Intergenic
1074210448 10:111328269-111328291 CTGGAGACTCCGAAGGGAGTGGG + Intergenic
1074519837 10:114209111-114209133 CAGGAGGCTGAGGTGGGAGGAGG + Intronic
1074543975 10:114388158-114388180 GTGGCCACTCAGATGGGTGGCGG + Intronic
1075093709 10:119457608-119457630 CTGGGGACTCAGTAGGGAGAAGG - Intronic
1075453247 10:122568041-122568063 CTGAGGATTCAGCTGGGAGGAGG + Intronic
1075642552 10:124075284-124075306 ATGGAGCCTCAGATGTGTGGAGG - Intronic
1075971656 10:126659410-126659432 CTGGCTACTCTGCTGGGAGGTGG + Intronic
1075987653 10:126801404-126801426 CTGGAGACTCAGAAGGGTGGGGG - Intergenic
1076221746 10:128739461-128739483 CTGGAGACAATGATGGGAGATGG + Intergenic
1076648792 10:131972822-131972844 CTGGACACTCAGCTGAGCGGGGG - Intronic
1077227974 11:1446651-1446673 CTGGAGCCTCTGCTGGGTGGGGG + Intronic
1077439828 11:2562624-2562646 CTGGAGACTCTGAAGAGGGGTGG - Intronic
1079186392 11:18241736-18241758 CTGGAGACTCAGAAAGATGGAGG + Intronic
1079239891 11:18714810-18714832 CTGGAGCAACACATGGGAGGGGG + Intronic
1079402354 11:20115805-20115827 CAGGAGGCTGAGGTGGGAGGAGG + Intronic
1080510706 11:32967310-32967332 TTGGAGACTCAGAAGGGGAGAGG + Intronic
1080609292 11:33890128-33890150 CTGGAGACTCAGAAGGGTGGGGG + Intronic
1081405808 11:42696267-42696289 CTGGAGACTCAGAAGAGGGGAGG + Intergenic
1082255027 11:50024529-50024551 CTGGAGACTCAGAAGCGGGAAGG - Intergenic
1082811243 11:57480369-57480391 CTGGAGTCTGAGATCTGAGGAGG - Intergenic
1082901510 11:58258474-58258496 TTGGAGACTCAGAGGGGAAGAGG - Intergenic
1083132662 11:60640300-60640322 CTGGAGACTCAGAAGCGGGAGGG + Intergenic
1083269592 11:61565095-61565117 TTGCAGAATCAGGTGGGAGGAGG - Intronic
1084096586 11:66915443-66915465 CTGGAGACACAGCAGGGAGAAGG - Intronic
1084461823 11:69300437-69300459 CTGGAGACAGAGAGGGGTGGAGG + Intronic
1084711063 11:70844040-70844062 TTGGGGACTCAGATGGGACAGGG - Intronic
1084739047 11:71126811-71126833 CAGGAGGCTGAGGTGGGAGGCGG - Intronic
1084740527 11:71136475-71136497 CAGGAGACTCAGAAGGGTGGTGG + Intronic
1085699594 11:78734330-78734352 CTGATGCATCAGATGGGAGGGGG - Intronic
1085761061 11:79241882-79241904 CTGGAGTCTTATATGGAAGGTGG + Intronic
1085810345 11:79674968-79674990 CTGGAGACTCACGTGGTAGGAGG - Intergenic
1085886334 11:80526724-80526746 CTGGAGACCCAGAAGAGGGGAGG + Intergenic
1086155470 11:83660823-83660845 AGGGAGACCAAGATGGGAGGAGG - Intronic
1086402157 11:86469748-86469770 CTGGGGACTCAGCTGGGAAATGG + Intronic
1086772469 11:90784499-90784521 CTGGAGACTCAGGTTGAATGAGG + Intergenic
1088554126 11:111044332-111044354 AAGGAGACTCAGAAGGGTGGGGG - Intergenic
1088706762 11:112470937-112470959 CTGGAGCCACAGATGAGAAGAGG - Intergenic
1088824523 11:113482675-113482697 CTGGAGAGTCAGGTGGGAGCTGG + Intergenic
1089138697 11:116269737-116269759 TTGGAGAGGCAGAGGGGAGGAGG - Intergenic
1089813606 11:121152564-121152586 CTGGAGATTCAGATGGGCGGTGG + Intronic
1089931166 11:122313934-122313956 CAGGAGGCTGAGGTGGGAGGAGG + Intergenic
1089993714 11:122884903-122884925 CGGGAGACTGCGGTGGGAGGAGG - Intronic
1090399694 11:126441144-126441166 CCTGAGACACAGGTGGGAGGAGG - Intronic
1090733677 11:129592919-129592941 CTGGAGACTCACAGAGCAGGAGG - Intergenic
1091004089 11:131936478-131936500 TTGGAGACTCAGAAGGAGGGTGG + Intronic
1091306423 11:134539129-134539151 CTGCAGACTAAGAGGGGAGCAGG - Intergenic
1091584525 12:1808622-1808644 CTGGACACTGGGATGGGAGGTGG - Intronic
1091701675 12:2667392-2667414 GAGGAAACTCAGATGGCAGGAGG + Intronic
1092027761 12:5257380-5257402 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1092165428 12:6339623-6339645 CTGGAGCACCAGTTGGGAGGAGG - Intronic
1092210481 12:6643147-6643169 CGGGAGGCTGAGATGAGAGGAGG + Intronic
1092915453 12:13185208-13185230 CTGGAGACTCAGAAGGCGGAGGG + Intergenic
1093017803 12:14171985-14172007 CTGGAGATTAAGATATGAGGAGG - Intergenic
1093456649 12:19371465-19371487 TTGGAGACTCAGAAGGGAGAGGG - Intronic
1093622142 12:21304825-21304847 CTGAACACTGAGTTGGGAGGAGG - Intronic
1093977971 12:25443907-25443929 TTGGAGACTCAGAAGGGGGAAGG - Intronic
1094166377 12:27447650-27447672 CGGGAGGCTAAGGTGGGAGGAGG + Intergenic
1094415903 12:30214547-30214569 TTGGAAACTCAGAAGGGTGGTGG - Intergenic
1094619895 12:32069979-32070001 ATGGGGACTCAGAAGGGTGGCGG - Intergenic
1095184613 12:39187047-39187069 CTGGGGACCCAGAAGGGAGATGG - Intergenic
1095776425 12:46015516-46015538 TTGGGGACTCAGTGGGGAGGGGG - Intergenic
1095825307 12:46524800-46524822 CTGGGGATGGAGATGGGAGGAGG + Intergenic
1096370723 12:51066933-51066955 CAAGAGGCTGAGATGGGAGGAGG - Intronic
1096451056 12:51741795-51741817 CTGGAGAATCACTTAGGAGGTGG - Intronic
1096487387 12:51992720-51992742 CCAGAAACTCAGAAGGGAGGAGG + Intronic
1096773122 12:53949188-53949210 CTGGAGACTAAGATGTGGGTGGG - Intergenic
1097226490 12:57479443-57479465 CTGGAGACCCAGAAGGGAATAGG + Intronic
1098081607 12:66791834-66791856 CTGGAGACTCAGAAGCAGGGAGG - Intronic
1098480314 12:70950286-70950308 TTGGAGACTCAGAAGGGATGAGG - Intergenic
1098992733 12:77082433-77082455 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
1099735350 12:86561658-86561680 CTTGATACTCAGATTGTAGGTGG + Intronic
1100339027 12:93660398-93660420 CAGGAGGCTGAGGTGGGAGGAGG - Intergenic
1100762555 12:97825327-97825349 TTGGAGAATCAGAAGGGAGTGGG - Intergenic
1100893853 12:99157643-99157665 CTGGAGACTCAGAAAGGGGGAGG + Intronic
1101464474 12:104933906-104933928 CTGGAGACTCAGAAAGGGGGAGG + Intronic
1102412496 12:112732265-112732287 TTAGAGACTCAGTTTGGAGGTGG + Intronic
1102897308 12:116608953-116608975 CTGGAGACTCAGAAGCGGGGCGG + Intergenic
1104082555 12:125443221-125443243 CAGGAGACCCAGGTGTGAGGTGG + Intronic
1104483460 12:129128755-129128777 CTGGAGACTCCCAAGGGTGGGGG - Intronic
1104712027 12:130993996-130994018 CTGGCCACTGAGATGTGAGGGGG - Intronic
1105516935 13:21099189-21099211 CCGGAGGCTGAGGTGGGAGGCGG + Intergenic
1105592263 13:21803604-21803626 CTGGAGACTCAGAAGTGGGGAGG - Intergenic
1105686378 13:22786455-22786477 CAGGAGGCTGAGATGGGAGATGG - Intergenic
1105747205 13:23388716-23388738 CTGGAGACTCAGAAGCAGGGAGG + Intronic
1105758560 13:23492365-23492387 CAGGAGGCTGAGGTGGGAGGAGG + Intergenic
1106065062 13:26339314-26339336 CTGTACATTCACATGGGAGGGGG - Intronic
1107913375 13:45125652-45125674 CTAGAGATTCAGAGGTGAGGTGG + Intronic
1108008025 13:45972429-45972451 TTGGAGACTCAGAAGGGGGAGGG + Intronic
1108096691 13:46909118-46909140 CTGGAGACTCAGAAGTGAGGAGG - Intergenic
1108456815 13:50624054-50624076 CTGGAAACTCAGAAAGGAGAGGG - Intronic
1108822425 13:54369604-54369626 TTGGAGGCTCAGAAGGGAGAGGG - Intergenic
1108875948 13:55051301-55051323 CTGGAGATTCAGAAGAGAGAAGG + Intergenic
1109483629 13:62990278-62990300 TTGGAAACTCAGAAGGGAGAGGG - Intergenic
1110707329 13:78609777-78609799 CTGGGGACTCCGAGAGGAGGCGG + Intergenic
1110901031 13:80824859-80824881 CTGGAGACTCAGAGTGGAGAGGG - Intergenic
1111668710 13:91301750-91301772 CAGGAGGCTGAGATGGGAGATGG - Intergenic
1111935007 13:94549296-94549318 CCCGAGGCTCCGATGGGAGGAGG - Intergenic
1112019429 13:95358898-95358920 CTGGGGCTTCTGATGGGAGGTGG - Intergenic
1112221359 13:97494476-97494498 GTGGAGAGGCAGATGGGAGTTGG + Intergenic
1112559610 13:100501371-100501393 ATGGAGACTCAGAAGGGTGACGG - Intronic
1112688935 13:101867003-101867025 CTGGAGAATCAGAAGGAAGAAGG + Intronic
1113116954 13:106884707-106884729 CTGGACACCCAGAGTGGAGGAGG - Intergenic
1113786913 13:113006815-113006837 CTGGAGCCTCACATGTGCGGAGG + Intronic
1114010926 14:18367635-18367657 CTGTAGACTCAGAAGGGTGAGGG + Intergenic
1114615155 14:24064414-24064436 ATGGAGACTCCCATGGGAGCTGG - Intronic
1114648809 14:24270325-24270347 CTGGAGACTCAGAAGTGCGTAGG - Exonic
1114661987 14:24352609-24352631 TTGGAGACTCAGATGTGGGAAGG + Intergenic
1115193580 14:30772762-30772784 CTGAAGACTTAGATGGAAAGAGG - Intergenic
1115441616 14:33442329-33442351 CAGGAGACTGAGGTGGGAGGAGG + Intronic
1116042001 14:39697407-39697429 TTGGAGACTCAGAAGGGGGGAGG - Intergenic
1116099272 14:40411408-40411430 CTGGAGACTCAACTGGCAGCTGG + Intergenic
1116422464 14:44748793-44748815 CTAGAGACTAAGAAGGGTGGGGG + Intergenic
1116630985 14:47332812-47332834 TTGGAAACTCAAATGGTAGGAGG - Intronic
1116693851 14:48147220-48147242 CTGGAGACTCAGAAGGGCAGAGG + Intergenic
1116754774 14:48933362-48933384 TTGGAGACTCAGAAGAGGGGAGG + Intergenic
1116762786 14:49035343-49035365 CTGGAGATTCAGAAGGGTGGGGG + Intergenic
1117491912 14:56256328-56256350 CTGGAGGCTGAGGTGGGAGAAGG + Intronic
1118918136 14:70125330-70125352 TTGGAGACTCGGAAGGGTGGGGG - Intronic
1119417472 14:74482869-74482891 CAGGAGCCGCAGCTGGGAGGAGG + Intronic
1120131716 14:80815941-80815963 CTGGAGACCCAGAGGGTGGGAGG + Intronic
1120139588 14:80913755-80913777 GTGGAGACTCAGAAGGGAGGAGG + Intronic
1121045652 14:90785714-90785736 CTGGCGTCACAGTTGGGAGGGGG - Intronic
1121085866 14:91145639-91145661 CTGGAGATGCAGGTGTGAGGAGG - Intronic
1121922001 14:97890568-97890590 CTTGAGACTTAGCTGGGAGAGGG + Intergenic
1122059732 14:99128993-99129015 CTGGAGGCTCAGGTGGGTGAAGG + Intergenic
1122246946 14:100410088-100410110 CTGGAAACTCAGATGGGGTTTGG - Intronic
1123038723 14:105481774-105481796 CTGGAGGCTCCCAAGGGAGGGGG - Intergenic
1124117713 15:26862915-26862937 CTGGAGACTTAGAAGGGAGAAGG + Intronic
1125416308 15:39457142-39457164 CTTGAGGCTCAGCTGGGAAGAGG + Intergenic
1126325531 15:47473135-47473157 CTGGGGACATAGATGAGAGGAGG + Intronic
1127023994 15:54782125-54782147 CGGGAGACGGAGATGGGAGACGG + Intergenic
1127176003 15:56358266-56358288 CTGGAGAATGAGATGTCAGGAGG + Intronic
1127456398 15:59159475-59159497 CTGGAGTGTCAGGAGGGAGGTGG + Intronic
1127714545 15:61636719-61636741 TTGGGGACTCAGAAGGGAGGTGG + Intergenic
1127978632 15:64017611-64017633 CTGGAGACACAGCTAGGAAGAGG - Intronic
1128651625 15:69419388-69419410 GTGGAGAGACAGATGGGAGACGG - Intronic
1128744446 15:70103641-70103663 CTGGAGCCTGAAATGGGAGTCGG - Intergenic
1129253877 15:74323054-74323076 CTGGAGACTTAGAAGGTAAGAGG - Intronic
1129443268 15:75598021-75598043 CAGGGGACTGAGATGGGAAGGGG + Intergenic
1129475394 15:75781596-75781618 GTGGGGACACAGATAGGAGGGGG - Intergenic
1129698260 15:77752914-77752936 CTAGAGAGGCAGAAGGGAGGGGG - Intronic
1130043073 15:80421240-80421262 TTGGAGACTCAGAAGGGTGGAGG + Intronic
1130303735 15:82699401-82699423 CTGGAGGCTCTGAGGGGAGGAGG - Intronic
1130361063 15:83186717-83186739 CTGGAGATTCAGAAGGGAAGAGG + Intronic
1130374418 15:83315522-83315544 TTGGAGACTCAGAAGCGGGGAGG + Intergenic
1130427319 15:83814256-83814278 CTGGAGACAGACATGAGAGGGGG - Intronic
1130825469 15:87540572-87540594 CTGGAGACTCAGAAGGTAGGAGG + Intergenic
1130884461 15:88081641-88081663 CTGGGGGCTCAGAAGGAAGGGGG - Intronic
1131299718 15:91186696-91186718 CTGGAGACTCAGAAGGCTGTGGG + Intronic
1131329377 15:91482519-91482541 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
1132586733 16:708837-708859 CTGGAGACTGATATGGGAGGCGG + Intronic
1132730956 16:1361849-1361871 CTGGGGACACAGATGGCATGAGG - Intronic
1132932186 16:2464406-2464428 CTGGAGCCTCAGAAGGAGGGAGG + Intronic
1133020489 16:2964772-2964794 CTGGGGACCCAGGCGGGAGGTGG + Intronic
1133696258 16:8265838-8265860 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1133886942 16:9838894-9838916 CTGGAGACTCAGAAAGGGAGAGG + Intronic
1134079856 16:11317206-11317228 CAGGAGACACAGCTGGAAGGAGG + Intronic
1134241825 16:12512265-12512287 CTGGAGAGGCAGGTGGGAGCTGG + Intronic
1134428330 16:14175319-14175341 CTAGAGACTGAGATGGAAAGAGG - Intronic
1134657034 16:15954897-15954919 CTGGAGACTGACATGGGAAGAGG - Intronic
1134740667 16:16540914-16540936 CTGGAGACTCAGAAGAGGAGAGG - Intergenic
1134926835 16:18171266-18171288 CTGGAGACTCAGAAGAGGAGAGG + Intergenic
1135194772 16:20385571-20385593 TTGGAGACTCAGATGCGGGGAGG + Intronic
1135200129 16:20430030-20430052 TTGGAGACTCAGAAGGAAGAAGG + Intronic
1135398169 16:22146982-22147004 CTGGAGATGCAGATGGTAAGGGG + Intronic
1135487841 16:22881451-22881473 CTGGAGACTGAGAGGAGATGAGG - Intronic
1135723239 16:24834486-24834508 GGGGAGACTCAGCTGGGAGCTGG + Intergenic
1135831061 16:25773802-25773824 CGGGAGACTCAGAAGAGAGGAGG - Intronic
1135973013 16:27086005-27086027 CTGGAGACTCAGAAGGTGGAGGG + Intergenic
1136073125 16:27800726-27800748 GTGGCTTCTCAGATGGGAGGTGG + Intronic
1136113966 16:28082963-28082985 CTGGAGCCTCCGGAGGGAGGTGG - Intergenic
1137354809 16:47750839-47750861 TGGGAGGCTGAGATGGGAGGTGG + Intergenic
1137442302 16:48507775-48507797 CTGGAGACTGGGATGGGTTGAGG + Intergenic
1137565866 16:49532224-49532246 CTGGAGACTCTGACGGTGGGTGG + Intronic
1137819445 16:51429786-51429808 CTGGAGACTCTTAGGGCAGGTGG + Intergenic
1137957911 16:52852173-52852195 CTGGAGACTAGGATGCCAGGTGG + Intergenic
1137971708 16:52991915-52991937 CTGGAGACTCAGAATGGGGAGGG + Intergenic
1138057753 16:53853477-53853499 CTGGAGATTCAGAAGAGAGGAGG - Intronic
1138300809 16:55928404-55928426 CTGGAGACTCAGAAGGTGGAAGG + Intronic
1138719673 16:59064883-59064905 CTGGAGACTCAGAAGGGTGGGGG - Intergenic
1139305913 16:65986243-65986265 TTGGAGACTCAGAAGGGAAAAGG + Intergenic
1139484914 16:67249951-67249973 CTGGCTGCTCAGAAGGGAGGAGG - Intronic
1140126556 16:72123249-72123271 CTGGATCCTGGGATGGGAGGAGG + Intronic
1140732931 16:77872543-77872565 CTGGAGAGGCAGGTGGGAGTTGG - Intronic
1140733160 16:77874439-77874461 CTGGAGAGGCAGGTGGGAGTTGG - Intronic
1141332142 16:83120595-83120617 CTTGAGCCTCAGATGAGAGCTGG - Intronic
1142308899 16:89300672-89300694 CTGGTGCCTCAGATAGGAGACGG - Intronic
1143010164 17:3861852-3861874 CAGGAGACCAAGATGGCAGGTGG - Intronic
1143028980 17:3956924-3956946 CTTGAGCCTCATTTGGGAGGTGG + Intronic
1143293124 17:5848113-5848135 CTGAAGACTCAGAAAGGAGGAGG - Intronic
1146112511 17:30102942-30102964 AGGGAGGCTCAGGTGGGAGGAGG - Intronic
1146636365 17:34508465-34508487 CTGGAGATTCAGATGTGGGGAGG - Intergenic
1147120506 17:38332713-38332735 CAGGAGGCTGAGGTGGGAGGAGG - Intronic
1147422969 17:40331709-40331731 CTGGACACACAGGTTGGAGGTGG + Intronic
1147903545 17:43807421-43807443 CGGGAGACTGAGGTGGGAGTGGG - Intronic
1148249952 17:46068459-46068481 CAGGAGGCTGAGGTGGGAGGAGG + Intronic
1148387015 17:47241484-47241506 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1148627003 17:49077226-49077248 CTGGTGACTCAGAAAGGATGCGG - Intergenic
1148723796 17:49774252-49774274 CCGGAGGCTGAGGTGGGAGGAGG - Intronic
1148784946 17:50141434-50141456 CTGGAGTTTCTGATGGGAGGAGG - Intronic
1148819077 17:50349856-50349878 ATGATTACTCAGATGGGAGGAGG - Intronic
1149275350 17:55027400-55027422 TTGGAGACTCAGAAGGGGGATGG + Intronic
1149470424 17:56911646-56911668 CAGGAGGCTAAGATGGGAGAAGG + Intronic
1150600077 17:66643254-66643276 CTGAAGAGTCAGCTGGGATGGGG + Intronic
1150665319 17:67130165-67130187 CTGGAGATTCAGAAGGTAGCGGG + Intronic
1151065530 17:71145175-71145197 CGGGAGGCTGAGATGGGAAGAGG - Intergenic
1151686102 17:75647575-75647597 CTGGGGACTGAGATGGCAGCAGG + Exonic
1151850466 17:76686871-76686893 CAGGAGGCTAAGATGGCAGGAGG + Intronic
1151956402 17:77382398-77382420 CTCGGCACTCAGGTGGGAGGTGG + Intronic
1152262415 17:79274221-79274243 CTGGAGACTGGGATGGGGGTTGG + Intronic
1152310285 17:79545700-79545722 CTGCAGTCTCAGCTGGGAGGCGG - Intergenic
1152513404 17:80805494-80805516 CAGGAGACTCTGCTTGGAGGTGG + Intronic
1153350835 18:4079521-4079543 CTGGAGACTCAGAAGTGGGGAGG + Intronic
1153497640 18:5716535-5716557 CTGGATTGTCAGATAGGAGGAGG + Intergenic
1153499597 18:5734651-5734673 CTGGAGACTCAGAAGGGTGGAGG + Intergenic
1153979987 18:10300499-10300521 CAGGAGACTGAGGTGTGAGGTGG + Intergenic
1154083855 18:11282863-11282885 TTGGAGACTCAGAAGGGTGAGGG - Intergenic
1154120661 18:11649548-11649570 CTGGACAATCAGATGGAATGAGG - Intergenic
1154435313 18:14337653-14337675 CTGGAGAATCCGAGGGCAGGTGG + Intergenic
1154496575 18:14965685-14965707 CTGGAGTCTCTGGTGGGTGGTGG - Intergenic
1155042564 18:22077024-22077046 CTGGAGGCTGAAAGGGGAGGAGG - Intergenic
1155315134 18:24563740-24563762 ATGGAGACTCAGAAGGGGGACGG - Intergenic
1155414649 18:25583914-25583936 CCAGAGATTGAGATGGGAGGTGG - Intergenic
1155771342 18:29704342-29704364 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1156422850 18:36974327-36974349 TTGGAGACTCAGAAGAGTGGAGG - Intronic
1156490916 18:37495523-37495545 CTGGAGCCTCAGATGGGGCATGG - Intronic
1157437885 18:47686610-47686632 CTGGAGATGGAGGTGGGAGGGGG - Intergenic
1157879392 18:51305366-51305388 CTGGAGACTCAGGGGCCAGGGGG + Intergenic
1157898230 18:51488733-51488755 GTTGACACTCAGATGTGAGGTGG + Intergenic
1158294312 18:55977936-55977958 TTGGAGATTCAGAAGGGAGGAGG + Intergenic
1158554289 18:58462397-58462419 TTGGAGACTCAGAAGGAAGGTGG - Intergenic
1158768151 18:60481096-60481118 TTGGAGACTCAGAAGGAAGGAGG - Intergenic
1158816423 18:61103169-61103191 CTGGAGACTCAGAAGCAGGGAGG + Intergenic
1158859440 18:61578030-61578052 GTGGACACTCAGAAGGGTGGAGG + Intergenic
1159768984 18:72526662-72526684 TTGGAGACTCAGATGCAGGGAGG - Intergenic
1160111313 18:76034450-76034472 CTGAAGTCTCAGATGGGGTGGGG - Intergenic
1160694802 19:478283-478305 CTGGTGACCCGGATGTGAGGAGG - Intergenic
1160797834 19:953965-953987 CAGGAGACCGAGGTGGGAGGTGG + Intronic
1160865368 19:1253728-1253750 CTGGTGACTTAGCTGGGAGGGGG + Intronic
1161227734 19:3154971-3154993 CTGGAGACTGAGACGGGAGTGGG - Intronic
1161530176 19:4784106-4784128 GTGGAGACTCAGAAGCGGGGAGG + Intergenic
1162020766 19:7867402-7867424 CAGGAAACTCTGATTGGAGGGGG + Intergenic
1162337325 19:10070039-10070061 ATGGAGGCTGAGGTGGGAGGAGG + Intergenic
1162570140 19:11466790-11466812 ATGGAGTCTCAGGTGGGGGGGGG - Exonic
1162949065 19:14059844-14059866 CTGGACTCTGAGCTGGGAGGAGG + Intergenic
1163090291 19:15014711-15014733 CAGGAGACTCAGTGGGGGGGCGG + Intronic
1163229300 19:15989310-15989332 CTGGAGACTCAGAAGAGGGAAGG - Intergenic
1163662904 19:18589183-18589205 CTGCAGAGTCAGATGGGGCGGGG + Intronic
1164443850 19:28300544-28300566 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1164773295 19:30830039-30830061 TTGGATACTCAGAAGGTAGGAGG - Intergenic
1164901388 19:31928515-31928537 TTGGAGACTCAGAAGAGGGGAGG + Intergenic
1164922742 19:32101799-32101821 ATGGAGACTCAGAAGGGGGTGGG - Intergenic
1164944595 19:32282757-32282779 CTGGAGACTCAAAAGGGGAGAGG - Intergenic
1164987776 19:32661440-32661462 CTGGAGGCTGAGGTGGGAGGTGG - Intronic
1165067648 19:33238444-33238466 CTGCAGACACAGACGGGAGCAGG + Intergenic
1165193675 19:34084621-34084643 CTGGAGGCTGAGGTGGGAGGAGG - Intergenic
1165319563 19:35076888-35076910 CTGGGGACCCAGGTGGCAGGAGG - Intergenic
1165833354 19:38740437-38740459 CGGGAGGCTGAGGTGGGAGGAGG - Intronic
1166145154 19:40829183-40829205 CTTGAGGGTAAGATGGGAGGAGG - Intronic
1166342340 19:42146222-42146244 CTGGAGACACAGATGGAACCAGG + Intronic
1166343301 19:42151133-42151155 CTGGGGACCCAGATGGGAGGAGG + Intronic
1166714897 19:44960723-44960745 CTGGAGCCTCAGAGGGAAGTGGG + Intronic
1166813857 19:45529837-45529859 CTGGAGGCTGAGGCGGGAGGAGG - Intronic
1167088833 19:47329393-47329415 CTGGAGGCTGAAGTGGGAGGTGG - Intergenic
1167121705 19:47521160-47521182 CTGGAGAGGCCGAAGGGAGGAGG + Exonic
1167331991 19:48861693-48861715 CTGGGGAGAGAGATGGGAGGAGG + Intronic
1167408936 19:49333701-49333723 GTGGAGACTCAGCAGGCAGGAGG + Intergenic
1167572958 19:50301607-50301629 GTGGAGTCTCAGAGGGAAGGTGG - Intronic
1167691752 19:50989258-50989280 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1167793385 19:51693966-51693988 ATGGAGACTCAGAGAGGGGGAGG + Intergenic
1167988882 19:53340993-53341015 CTGGAGTGTGAAATGGGAGGTGG - Intronic
1168037319 19:53730344-53730366 CAGGAGACTGAGGTGGGAGGTGG - Intergenic
1168039657 19:53747962-53747984 CAGGAGGCTGACATGGGAGGTGG - Intergenic
1168040821 19:53757259-53757281 CAGGAGGCTGAGGTGGGAGGTGG - Intergenic
1168041357 19:53761668-53761690 CAGGAGGCTGAGGTGGGAGGTGG - Intergenic
1168173362 19:54606068-54606090 CAGGAGAATCACTTGGGAGGTGG + Intronic
1168254725 19:55159145-55159167 CTGGAGACTCAGAGGGCAGCTGG + Exonic
1168345891 19:55650056-55650078 CTGGTGTCACAGAGGGGAGGGGG - Intronic
1168393267 19:56027975-56027997 CTGGAGACTGAGGTGGAAGAAGG - Exonic
1168430732 19:56277739-56277761 ATAGAGACTCAGAAGGAAGGAGG + Intronic
1168564549 19:57412175-57412197 CTGGAGACTGAGGTGTGAGGTGG + Intronic
925144334 2:1570779-1570801 CTGGAGACTCAGAGGCGGGGAGG - Intergenic
925623537 2:5818708-5818730 GTGGACAGTCAGATGGCAGGTGG + Intergenic
925740233 2:6999291-6999313 TTGAAGATTCAGAAGGGAGGAGG + Intronic
925942439 2:8834075-8834097 CTGGAGACTTAAGTGGGAGGAGG - Intronic
926083240 2:10005541-10005563 CAGGACACACACATGGGAGGGGG - Intergenic
926731667 2:16040163-16040185 CTGGAGATGCAAGTGGGAGGAGG + Intergenic
926875845 2:17477730-17477752 TTGGAGACACAGAAGTGAGGAGG + Intergenic
926906942 2:17814827-17814849 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
926990082 2:18669671-18669693 CTGGAGACTCAGAAGGGAGGAGG - Intergenic
927185010 2:20475759-20475781 CTGCAGCCTCAGATGGGCCGTGG + Intergenic
927195366 2:20542844-20542866 CTGGGGGCACAGATGGGAGGTGG + Intergenic
927696350 2:25242167-25242189 CTGGGGACTCATAGCGGAGGGGG - Intronic
929684973 2:44025793-44025815 CAGGAGGCTGAGATCGGAGGAGG - Intergenic
930463176 2:51710059-51710081 GTGGAGACTCAGAAGGGTGAGGG + Intergenic
930539442 2:52686754-52686776 CTGGAGTCTCAGAATGGGGGAGG + Intergenic
930605948 2:53493179-53493201 CTGTAAACTCACATGGGAGAAGG - Intergenic
930892919 2:56412005-56412027 CTGGAGACTCAGAAGGGTGAGGG + Intergenic
930950131 2:57131332-57131354 TTGGAGACTCAAAAAGGAGGAGG - Intergenic
931714708 2:65019897-65019919 CTGCAGAATCAGAGGGGATGGGG - Intronic
931878689 2:66543054-66543076 CTTGAGACTGGGATGGGAGGGGG - Intronic
932224684 2:70030247-70030269 ATGCAGCCTCAGCTGGGAGGAGG + Intergenic
932839900 2:75072414-75072436 TTGGAGACCCAGATGTGAGAGGG + Intronic
933458335 2:82545669-82545691 ATGGAGACTAAGAAGGGTGGAGG - Intergenic
933981047 2:87551067-87551089 CTGGAGGCTGAGGTGGGAGGCGG + Intergenic
934894039 2:98097253-98097275 TTGGAGACTCAGAAGTGGGGAGG - Intronic
934949638 2:98567489-98567511 CTGGAGCCCCAGCAGGGAGGTGG + Intronic
935702535 2:105824925-105824947 ATTGAGACTCAGGTGGGAGATGG - Intronic
935750185 2:106225206-106225228 CAGGAGGCTGAGGTGGGAGGAGG + Intergenic
935947083 2:108296425-108296447 CTGGAGACTCAGCTGTGCAGTGG + Intronic
936312785 2:111399718-111399740 CTGGAGGCTGAGGTGGGAGGCGG - Intergenic
936537413 2:113323043-113323065 CTGGAGGGTTAGAGGGGAGGGGG + Intergenic
936580027 2:113691493-113691515 ATGGAGACTCAGAAGGGGGAGGG - Intergenic
937244265 2:120482468-120482490 CTGGTGACTCAGATACCAGGCGG - Intergenic
937255785 2:120554531-120554553 CTGGGGACTCATATGAGAAGAGG - Intergenic
937345924 2:121125218-121125240 CAGGAGGCTGAGGTGGGAGGAGG + Intergenic
937425819 2:121797556-121797578 CAGGAGAATCACTTGGGAGGCGG + Intergenic
938526005 2:132131705-132131727 CTGTAGACTCAGAAGGGTGAGGG - Intergenic
939027417 2:137030758-137030780 CTGGAGACTCAGAAATGGGGAGG + Intronic
939335836 2:140826809-140826831 CTAGAGACACAAAGGGGAGGTGG + Intronic
939895289 2:147784251-147784273 ATGGAGAGTCAGGTGGCAGGAGG + Intergenic
942271503 2:174280281-174280303 CAGAAGGCTCAGAAGGGAGGAGG - Intergenic
943341359 2:186685736-186685758 CTGGAGACTCAGAAGTGGGGAGG - Intergenic
943435976 2:187866598-187866620 CTGGAGACCCAGGGGGGAGCTGG - Intergenic
943436200 2:187868141-187868163 CTGGAGACCCAGAGAGGAGCTGG - Intergenic
943436207 2:187868191-187868213 CTGGAGACCCAGAGAGGAGCTGG - Intergenic
943436234 2:187868385-187868407 CTGGAGACCCAGAGAGGAGCTGG - Intergenic
943436252 2:187868532-187868554 CTGGAGACCCAGAGAGGAGCTGG - Intergenic
943436326 2:187869066-187869088 CTGGAGACCCAGAGAGGAGCTGG - Intergenic
944676185 2:202035231-202035253 CGGGGGCCTCAGATGGCAGGGGG + Exonic
945033393 2:205685173-205685195 CTGGGGATTGGGATGGGAGGGGG - Intronic
945277644 2:208004307-208004329 CGGGAGGCTGAGGTGGGAGGAGG + Intronic
945327680 2:208501550-208501572 CTAGAGACTCAGAAAGGGGGAGG - Intronic
946150517 2:217764156-217764178 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
946626025 2:221613138-221613160 CTGGAGACGCAGAGGAGAGAAGG + Intergenic
946667528 2:222066670-222066692 TGGGAGACGCAGAGGGGAGGGGG - Intergenic
946875029 2:224120370-224120392 TTGGAGACTCAGATGGAGGGAGG + Intergenic
946875545 2:224126139-224126161 CTGGAGCCTCAGCAAGGAGGTGG + Intergenic
946997614 2:225412896-225412918 GTAGAGACTCAGATGGCAGCAGG + Intronic
947448877 2:230186660-230186682 ATGGAGACTCAGAAAGGAGAGGG - Intronic
948278033 2:236725004-236725026 CTGCAGACTCAGGGGGGAAGGGG + Intergenic
948622423 2:239244748-239244770 CAGGAGGCTGAGCTGGGAGGAGG - Intronic
948669853 2:239561306-239561328 CTGGAGACTCAGAAAGGAGGTGG - Intergenic
948674480 2:239588941-239588963 GCTGAGACTCAGGTGGGAGGAGG - Intergenic
948808135 2:240461719-240461741 CTGGAGACTCGCAGGGCAGGCGG + Intronic
1169260641 20:4135820-4135842 CTGGTGACTCAGGTAGGGGGAGG - Intronic
1169323214 20:4652615-4652637 ATGGAGACTCAGAAGTGGGGAGG - Intergenic
1169513731 20:6294267-6294289 CTGGAGACTCAGAAAGGGGGAGG - Intergenic
1170721844 20:18888354-18888376 AGGGAGGCTGAGATGGGAGGAGG - Intergenic
1170961891 20:21032835-21032857 TTGGAGACTCAGAGGTGGGGAGG + Intergenic
1170985097 20:21250778-21250800 CGGGAGAATCACTTGGGAGGTGG - Intergenic
1171042073 20:21773917-21773939 CTGCAGACTCAGAAGGTGGGAGG - Intergenic
1171211855 20:23323055-23323077 CTGGAGACTCAGAAGGGGTAGGG + Intergenic
1171252827 20:23662494-23662516 ATGGAGGCTCAGACGGGAGCAGG + Intergenic
1171259305 20:23717811-23717833 ATGGAAGCTCAGATGAGAGGAGG + Intergenic
1171374537 20:24683374-24683396 CTGGAGACTCAGAACGGTGGGGG + Intergenic
1171509404 20:25668925-25668947 CTGGGGTCTCAGAGTGGAGGTGG - Intergenic
1172127734 20:32635105-32635127 CAGGAGAATCACCTGGGAGGCGG + Intergenic
1172749952 20:37243819-37243841 CTGCAGACTCAGATGGGAGCTGG + Intergenic
1173275991 20:41583024-41583046 CTGGAGTCCCAGATGGCAGAAGG + Intronic
1174100236 20:48121640-48121662 CTGGAGAACCAGAGGGGAGCTGG - Intergenic
1174149021 20:48473086-48473108 CTGGAGACCCAGAGAGGAGATGG - Intergenic
1174149047 20:48473244-48473266 CTGGAGACCCAGAGAGGAGATGG - Intergenic
1174149085 20:48473495-48473517 CTGGAGACCCAGAGAGGAGATGG - Intergenic
1174149532 20:48476361-48476383 CTGGAGACCCAGAAAGGAGTTGG - Intergenic
1174149601 20:48476760-48476782 CTGGAGACCCAGAAAGGAGCTGG - Intergenic
1174785887 20:53432128-53432150 CTGGAGACTCAGAAGTGGGGAGG - Intronic
1174821191 20:53727809-53727831 CTGGGGGCTCAGATGGGTGAGGG - Intergenic
1174911966 20:54617418-54617440 CAGGAGGCTGAGGTGGGAGGAGG - Intronic
1175128240 20:56768492-56768514 GGGCTGACTCAGATGGGAGGTGG - Intergenic
1175343785 20:58254523-58254545 CTGAAGACTCAGAAGGGGAGAGG + Intergenic
1175427565 20:58878508-58878530 CTGCAGAATCTTATGGGAGGAGG + Intronic
1175644985 20:60663589-60663611 CTGGAGAATCAAATGGAATGGGG - Intergenic
1175829828 20:61957559-61957581 CTGGAGAATCAAAGAGGAGGAGG + Intronic
1176137512 20:63530647-63530669 CTGGGGACTCGGCTGGGAGCAGG - Intronic
1177378921 21:20312538-20312560 CTGGAGACTTAGAAGGTGGGAGG + Intergenic
1177473961 21:21594277-21594299 TTTGGGACTGAGATGGGAGGGGG + Intergenic
1177822883 21:26050873-26050895 CAGCAGACTCTGATGGGAGTGGG + Intronic
1178246529 21:30958048-30958070 TTGGTGTTTCAGATGGGAGGAGG + Intergenic
1179035286 21:37754107-37754129 CTGGAGAATGAGCTGGCAGGTGG - Intronic
1179313248 21:40215640-40215662 TTGGAGACTCAGAAGTGGGGAGG + Intronic
1179318350 21:40267012-40267034 CGGGAGACTCAGAAGTGGGGAGG + Intronic
1179618411 21:42596584-42596606 CTGGTGTCTGAGGTGGGAGGGGG - Intergenic
1179642868 21:42758780-42758802 CAGGCCACTCAGATGGGTGGGGG - Intronic
1179907742 21:44433019-44433041 CTGAAGACTCAGGTGTGGGGTGG + Intronic
1180053455 21:45344544-45344566 CTGGACACACAGCTGGGGGGAGG + Intergenic
1180324268 22:11354597-11354619 ATGGAGACTCAGAAGGGTGAAGG + Intergenic
1180435420 22:15298439-15298461 CTGTAGACTCAGAAGGGTGAGGG + Intergenic
1182208144 22:28649196-28649218 TTGGAGACTCAGGAGGTAGGAGG + Intronic
1182347826 22:29679208-29679230 CTGCAGAGTCAGATGGGTGAGGG - Intronic
1182373309 22:29827527-29827549 CTGCAGACCCACATGAGAGGTGG - Intronic
1182990709 22:34764707-34764729 ATTGAGACTCAGATGGGACTTGG - Intergenic
1183418427 22:37696309-37696331 GTGGCGACTGGGATGGGAGGAGG - Intronic
1184606427 22:45577181-45577203 GAGGGGACTCAGATGGGAGTTGG - Intronic
1184658274 22:45952923-45952945 CAGCAGACACAGCTGGGAGGCGG - Intronic
1184741651 22:46432047-46432069 CTTGAGCCTCATTTGGGAGGAGG - Intronic
1184918942 22:47592114-47592136 CTGAAAACTCAGATGGGTCGAGG - Intergenic
1185044120 22:48520469-48520491 CTGCAGAATCAGATGGCAGTTGG - Intronic
949159278 3:860529-860551 CTGGAGACCCAGAGAGGAGCTGG - Intergenic
949159306 3:860776-860798 CTGGAGACCCAGAGAGGAGCTGG - Intergenic
949487282 3:4552307-4552329 CTGGTGTGTCAGGTGGGAGGTGG - Intronic
949516354 3:4810716-4810738 ATGGAGACTCAGAGGGGATGAGG + Intronic
950039519 3:9911024-9911046 CTCGAGAGTCAGATGGGGTGAGG + Exonic
950199374 3:11032291-11032313 CTGGAGACTCAGAAGGGTGGGGG - Intronic
950552460 3:13675054-13675076 GTGTTGACTCAGGTGGGAGGTGG + Intergenic
950660035 3:14461537-14461559 CTGCAGACGCACAGGGGAGGAGG + Intronic
951203184 3:19897279-19897301 CTGGAAACTCACATAGGAGAGGG - Intronic
951514730 3:23545989-23546011 TTGGAGACTCAGAAGAGAGGAGG + Intronic
952199010 3:31106130-31106152 CTGGAGACTCAGAAGGGTGAAGG - Intergenic
952493147 3:33891235-33891257 TTGGAGACTCAGAAGAGAGAGGG - Intergenic
952913928 3:38216663-38216685 CTGGAGTCTCAGCCTGGAGGAGG - Intronic
953038750 3:39236558-39236580 CTGGGGACAGGGATGGGAGGAGG - Intergenic
953277297 3:41514762-41514784 ATGGAGACTCAGAAGGGTGAGGG + Intronic
953317329 3:41941140-41941162 CTGGAGGCTGAGAGAGGAGGAGG - Intronic
953380464 3:42467520-42467542 ATGGAGACTCAGAAGGGTGAAGG + Intergenic
953563997 3:44015476-44015498 CTGGAGGCCCAGCTGGGAGGAGG - Intergenic
953597459 3:44331429-44331451 CAGGAGGCTGAGGTGGGAGGAGG - Intronic
953706336 3:45233843-45233865 CAGGAGACTCAGGTGTGAGATGG + Intergenic
953869811 3:46616484-46616506 TTGGAGACTCAGAAGGAAAGAGG - Intronic
954015769 3:47689101-47689123 CGGGAGGCTGAGGTGGGAGGGGG + Intronic
954829274 3:53405079-53405101 CAGGAGGCTGAGGTGGGAGGAGG + Intergenic
954842932 3:53528235-53528257 CTGGATACCCACAAGGGAGGTGG - Intronic
954900498 3:54015012-54015034 CTGGAGCCACAGCTGGAAGGTGG + Intergenic
955457561 3:59140617-59140639 CTGGAGACTCAGGAGTGGGGAGG + Intergenic
956031075 3:65038772-65038794 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
956751840 3:72349667-72349689 CTGGAGACTCTGCTGGGTGGGGG - Intergenic
957936622 3:86951978-86952000 CTGGAGAAACAGATTAGAGGAGG + Intronic
958665176 3:97128014-97128036 CCGGAGACTCAGAAGTGGGGAGG - Intronic
958807952 3:98834456-98834478 CTGGAGGCTGAAAGGGGAGGAGG - Intronic
959167142 3:102794566-102794588 CTGGAAACACAGAAGGGAGAAGG - Intergenic
960076204 3:113488586-113488608 TTGGAGACTCAGAAGGGGGAGGG + Intronic
961422242 3:126815648-126815670 CTGTGGACACAGATGGGGGGGGG - Intronic
961643871 3:128382066-128382088 CAGGAGACTCAGAGAGGAGAGGG - Intronic
961826905 3:129603915-129603937 CGCCAGACTCAGATGGGTGGAGG + Intronic
961994431 3:131226664-131226686 TTGGAGACTCAGAAGGGAGGAGG + Intronic
962330236 3:134471861-134471883 CTGGAGACTAAGATGACAGGTGG + Intergenic
962455383 3:135560593-135560615 CTGGGGAGTCTGATGGGAGGAGG - Intergenic
962522675 3:136211742-136211764 GTGCTGACTCAGCTGGGAGGTGG - Intergenic
963106473 3:141651847-141651869 CTGGAGACTCAGAGAAGAGTGGG + Intergenic
963806660 3:149729337-149729359 CTGGTGACTCAGCTGGGGGCAGG + Intronic
964186703 3:153954252-153954274 CTGGTCACTGGGATGGGAGGGGG - Intergenic
964635497 3:158853822-158853844 TTGGAAACTCAGAAGGAAGGTGG - Intergenic
964768807 3:160203432-160203454 CAGGAGAGACATATGGGAGGAGG + Intergenic
965845200 3:172953263-172953285 ATGGAGATTGAGGTGGGAGGGGG - Intronic
966369283 3:179230980-179231002 ACAGAGACTCAGATGGGAGACGG - Intronic
967221074 3:187248625-187248647 CTCGAGCCTCAGATTGGAGGAGG + Intronic
967315927 3:188152524-188152546 CAGGAGACCTGGATGGGAGGAGG + Intergenic
967728501 3:192884336-192884358 TTGGAGACTCAGGTAGGTGGAGG + Intronic
967940934 3:194766063-194766085 TTGGAGACTCAGATGCAGGGAGG + Intergenic
968161409 3:196430614-196430636 CTGGAGATTCACATGGGGCGAGG - Intronic
968661557 4:1800818-1800840 CTGGACATCGAGATGGGAGGAGG + Intronic
968662369 4:1804044-1804066 TTGGGGACCCAGATGGGAAGTGG - Intronic
968689040 4:1980678-1980700 CTGGGGACCCTGATGGGAGAAGG - Exonic
968736747 4:2301235-2301257 CTTGAGACACAGATGAGTGGGGG + Intronic
968827677 4:2911557-2911579 CAGGAGGCTGAGATGGGAGGAGG - Intronic
969109925 4:4838272-4838294 CTGGAGACACAGTTGTGAGGGGG - Intergenic
970221422 4:13815836-13815858 ATGGAGACTCAGAAGGGTGTGGG - Intergenic
971330723 4:25679169-25679191 CTGGAGGGTCAGATGGTAAGTGG - Intergenic
971709436 4:30092757-30092779 CTGGAGTTTCAGATGGGCGTGGG + Intergenic
971765568 4:30826437-30826459 CTGGAGACTCAGTTGGACCGAGG - Intronic
971975679 4:33683311-33683333 TTGGAGACTCAGAATGGGGGAGG - Intergenic
972213191 4:36863235-36863257 TTGGAGACTCAGACGGGGAGAGG + Intergenic
972220564 4:36949943-36949965 CTGTGAACTCAGCTGGGAGGAGG - Intergenic
972446038 4:39144713-39144735 CTGGAGACTCAGAAATGGGGAGG - Intergenic
972717062 4:41657052-41657074 CTGGGGCCTCAGGTGGGAGGTGG - Intronic
972914152 4:43855232-43855254 CTGGAGATTGGGATGGGAGCAGG - Intergenic
973192408 4:47400727-47400749 TTGGAGACTCAGAAGTGGGGAGG - Intronic
973814530 4:54607019-54607041 CTGGAGGGTGAGATTGGAGGAGG + Intergenic
975126579 4:70789027-70789049 CTGGAGGATCAGATGGGAGGAGG - Intronic
975905354 4:79204716-79204738 CTGGAGACTCAGAAGGGGAGTGG - Intergenic
976070911 4:81238825-81238847 CTGGAGGCTGAGGAGGGAGGAGG - Intergenic
976277553 4:83292845-83292867 TTGGAGACTCAGAAGGGAAGAGG + Exonic
977198948 4:94092490-94092512 TTGGAGACTCAGAAGGTGGGAGG + Intergenic
977608358 4:99005905-99005927 TTGGAGACTCAGAAAGGGGGAGG + Intronic
977695852 4:99964628-99964650 CTGGAGGCTGAGGTGGCAGGAGG + Intergenic
977974549 4:103249023-103249045 CTGGAGACTCAGAAGCAGGGAGG - Intergenic
980378769 4:131982129-131982151 TTGGAGACTCAGATGTGGGGAGG - Intergenic
980421556 4:132566707-132566729 CTGGAGACCCAGTTTGGTGGGGG + Intergenic
980979734 4:139644024-139644046 ATGGAGACTTGGATGGGTGGGGG - Intergenic
981361589 4:143852065-143852087 TTGGAGACTCAGAAGGGGGAGGG - Intergenic
981653898 4:147090311-147090333 ATGGAGACTGAGATTAGAGGAGG - Intergenic
981889768 4:149721447-149721469 CTGGAGACTCAGAAGGGAGGAGG - Intergenic
981913420 4:150008504-150008526 CTGGAGCCACAGAGGTGAGGCGG + Intergenic
981954602 4:150454737-150454759 TTGGAGACTTAGAAGGGAGAAGG - Intronic
982188387 4:152826458-152826480 TTGGAGACTCAGAAGAGGGGAGG + Intronic
982431777 4:155330889-155330911 TTGGAGACTCAGAAAGGTGGAGG + Intergenic
982490946 4:156028854-156028876 CTGGAGGCTGAGGTGGGAGATGG + Intergenic
982610919 4:157574272-157574294 CTGCTGACTCAGAAGGGAGTGGG - Intergenic
983400527 4:167259000-167259022 CTGGAGACTTAGAAGGGGGAGGG + Intergenic
984321770 4:178206677-178206699 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
984702829 4:182829061-182829083 CTGGGGAGGCAGAGGGGAGGAGG + Intergenic
985042966 4:185910679-185910701 CAGGAGGCTGAGGTGGGAGGCGG - Intronic
985757540 5:1727860-1727882 CTCGAAACCAAGATGGGAGGCGG - Intergenic
986384297 5:7216593-7216615 CTGGAGACTAAGAAGGAAAGAGG - Intergenic
986687498 5:10287474-10287496 ATGGAGACTCAGAAGGGGGAGGG + Intronic
986879008 5:12147283-12147305 TTGAAGACTCAGAAGGGTGGGGG - Intergenic
986928832 5:12794277-12794299 CAGAAAACTTAGATGGGAGGAGG + Intergenic
986965623 5:13267440-13267462 CTGGGGAAGCAGCTGGGAGGGGG - Intergenic
987659226 5:20850924-20850946 CTAGAGACTCAGAAGCGAGGAGG + Intergenic
988065540 5:26226146-26226168 CTGGAGACCCAGAGAGGAGCTGG - Intergenic
988065571 5:26226392-26226414 CTGGAGACCCAGAGAGGAGCTGG - Intergenic
988065635 5:26226881-26226903 CTGGAGACCCAGAGAGGAGCTGG - Intergenic
988065654 5:26227075-26227097 CTGGAGACCCAGACAGGAGCTGG - Intergenic
988065697 5:26227422-26227444 CTGGAGACCCAGAGGGGAGCTGG - Intergenic
988065721 5:26227617-26227639 CTGGAGACCCAGAGAGGAGCTGG - Intergenic
988222331 5:28364241-28364263 ATGGAGACTCAGAAGGGTAGGGG + Intergenic
988227047 5:28426256-28426278 TTGGAGCCTGTGATGGGAGGGGG - Intergenic
988764444 5:34355057-34355079 CTAGAGACTCAGAAGCGAGGAGG - Intergenic
988979029 5:36545905-36545927 TTGGAGACTCAGAAGTAAGGAGG + Intergenic
989407748 5:41080303-41080325 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
990420989 5:55633111-55633133 CAGGAGGCTGAGGTGGGAGGAGG - Intronic
991325173 5:65423154-65423176 CTGGAGATTCAGAAGGGGGAAGG + Intronic
991720646 5:69492495-69492517 CCTGAAACTCGGATGGGAGGGGG - Exonic
992276388 5:75124803-75124825 CTGGAGACTCAGAAGGGTAGGGG + Intronic
993165064 5:84342401-84342423 ATGGAGACTCAGAAAGGTGGGGG + Intronic
993322757 5:86494319-86494341 CTGGACACTTAGAAGGGTGGAGG - Intergenic
993628031 5:90249586-90249608 CTGGAGACTCAGAGGGGTGAGGG + Intergenic
994228350 5:97281788-97281810 ATGGAGACTCAGATGGGGGCAGG - Intergenic
995016186 5:107312262-107312284 CTGGCCACTCAGAAGTGAGGAGG - Intergenic
996517872 5:124393790-124393812 CTGGAGGCTGAGATGGCAGTTGG - Intergenic
997044586 5:130298993-130299015 CTGGATACATAGTTGGGAGGAGG + Intergenic
997089896 5:130844438-130844460 CTGGAGACTCAGAAGAGGGGAGG + Intergenic
997878706 5:137571183-137571205 CTAGAGGCTCAGATGAGGGGTGG - Intronic
998278715 5:140783778-140783800 CTTGAGTCTCAGATGGGACTTGG + Intergenic
999372368 5:151063833-151063855 CTGGAGCCTCAGAAGCCAGGCGG - Intronic
999750894 5:154627605-154627627 CTGGAGCCAGAGATGGGAAGAGG - Intergenic
1000245677 5:159446854-159446876 CTGGAGACTCTGAGGGCAGGTGG - Intergenic
1000441347 5:161267432-161267454 TTGGAGACTCAGAAGTGAGGAGG + Intergenic
1000724935 5:164758048-164758070 CGGGAGGCTGAGGTGGGAGGAGG - Intergenic
1000821935 5:165995487-165995509 CCGGAGACACAGAGGGGAGAAGG + Intergenic
1001214917 5:169846855-169846877 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1001389223 5:171365459-171365481 CTGGAGACTGAACTGGGAGCCGG + Intergenic
1001652309 5:173324561-173324583 CTGGAGAGTCAAAAGAGAGGGGG - Intronic
1001711699 5:173784115-173784137 GTGGAGACTCCTTTGGGAGGTGG - Intergenic
1001818734 5:174693250-174693272 CTGGAAACACAGGGGGGAGGGGG - Intergenic
1001895345 5:175374601-175374623 TTGGAGACTCAGAAGGAGGGAGG - Intergenic
1001941456 5:175742597-175742619 CTGGAGACCAAGCTAGGAGGAGG + Intergenic
1002058583 5:176612726-176612748 CTGGATGCTCAGGTGGAAGGTGG + Intergenic
1002426778 5:179181313-179181335 CTGGAGAGGCAGAGGGCAGGGGG - Intronic
1002535584 5:179873796-179873818 CCTGACACTCAGGTGGGAGGAGG + Intronic
1002905736 6:1447590-1447612 CTGGAGACTCAGAAGGGGGGAGG - Intergenic
1003348255 6:5291396-5291418 CTGGAGAGTTAGGCGGGAGGTGG + Intronic
1003747765 6:9022447-9022469 CCAGAGACACAGAAGGGAGGGGG - Intergenic
1004696060 6:18034018-18034040 CAGGAGACTGAGGTAGGAGGAGG + Intergenic
1004985277 6:21074974-21074996 TTGGAGACTCAGAAGTGGGGAGG - Intronic
1004987010 6:21093832-21093854 CAGGAGGCTAAGGTGGGAGGTGG - Intronic
1005058859 6:21757651-21757673 CAGGAGAATCACCTGGGAGGCGG - Intergenic
1005319778 6:24641924-24641946 CAGGAGGCTGAGGTGGGAGGAGG + Intronic
1006241288 6:32681328-32681350 TTGGAGACTCAGAAGAGGGGAGG - Intergenic
1007193086 6:40036604-40036626 CTGGACACTCAGACTTGAGGTGG - Intergenic
1007414562 6:41684158-41684180 TTTGGGACTCAGATGGCAGGAGG - Exonic
1008556667 6:52679240-52679262 CTGGAGACCTACCTGGGAGGAGG - Intronic
1009278340 6:61714881-61714903 ATGGAGACTCAGAAGAGTGGGGG + Intronic
1009514503 6:64597694-64597716 CTGGAGACTTAAAAGGGTGGGGG + Intronic
1009709998 6:67305925-67305947 CTGGAGACTCAGAAAGGAGGAGG - Intergenic
1010815465 6:80353062-80353084 ATGGAGACTCAGAGAGGAGAGGG - Intergenic
1010977008 6:82326572-82326594 TTGGAGACTCAGAAGAAAGGAGG - Intergenic
1011066527 6:83332742-83332764 CTGGAGACTCAGATGGGAGGAGG + Intronic
1011428966 6:87264707-87264729 CTGAAGAAGCAGATGGGTGGTGG + Intergenic
1012029560 6:94041066-94041088 CTGGAGACTCAGAAGTGGGGAGG - Intergenic
1012351813 6:98260744-98260766 CTGGAGATTCAGAAGTGAGGAGG - Intergenic
1012389243 6:98718513-98718535 CAGGAGAATCACTTGGGAGGTGG - Intergenic
1012700028 6:102444390-102444412 TTGGAGACTCACAAGGGAGGAGG - Intergenic
1012924386 6:105252972-105252994 CTGGAGAACAAGATGGGTGGTGG + Intergenic
1013380629 6:109566704-109566726 CTGGAGACTCAGAAGGGAGCAGG + Intronic
1013569556 6:111408152-111408174 CTTGAGCCTCAGAGGTGAGGAGG + Intronic
1013640622 6:112075152-112075174 CAGGAGGCTGAGATGGGAGGCGG - Intronic
1014069661 6:117166891-117166913 CTGGAGACACAGAAGAGAGGTGG - Intergenic
1014088969 6:117381394-117381416 TTGGAGACTCAGAAGGAGGGAGG - Intronic
1014092627 6:117421414-117421436 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1015636266 6:135277801-135277823 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
1015822382 6:137278247-137278269 CTGGAGACAGGGATGGGAAGAGG - Intergenic
1015916506 6:138222872-138222894 CTGGAGACTCAGAATGGGGGAGG - Intronic
1016150628 6:140737554-140737576 TTGGAGACTCAGAAAGGAGAGGG - Intergenic
1016274101 6:142328306-142328328 CAGGAGGCTGAGGTGGGAGGAGG - Intronic
1016689563 6:146921169-146921191 CTGGAAACTCAGAAGGGAGCGGG + Intergenic
1016693040 6:146961360-146961382 CTGGAGACTCAGAAGGGTAAGGG + Intergenic
1016916201 6:149246770-149246792 CAGGAGGCTGAGCTGGGAGGAGG - Intronic
1017009595 6:150054298-150054320 CTGGAGACTCAGGGAGGAGCTGG - Intergenic
1017549274 6:155487930-155487952 CTGGGTACGCAGATAGGAGGTGG + Intergenic
1017751365 6:157492814-157492836 GTGGGGACCCAGATGGGAGGAGG + Intronic
1017933754 6:158985265-158985287 CAGACGACTCAGATGGGAGTGGG + Intronic
1017938360 6:159027334-159027356 TTGGAGACTCAGAATGGGGGAGG + Intergenic
1018049108 6:159992370-159992392 CTGGAGACTCAGAAAGGTTGGGG - Intronic
1018537685 6:164838780-164838802 CTTGAGCCTAGGATGGGAGGTGG - Intergenic
1018573202 6:165232236-165232258 CTGGAGACTGAGATGAAAGAGGG - Intergenic
1018792263 6:167157598-167157620 CTGGAGGCTCAGGTAGAAGGCGG + Exonic
1019098440 6:169607612-169607634 CTGGAGACTCAGAAGGGTAGAGG + Intronic
1019391927 7:793180-793202 GTGGAGACTCAGAAGGGTGAAGG + Intergenic
1019513274 7:1429052-1429074 CTGGGGCATCAGGTGGGAGGTGG - Intronic
1019558349 7:1643576-1643598 CTGGGGACTCAGAGGGAATGGGG + Intergenic
1019708651 7:2508353-2508375 CTGGAGACTCCGGAAGGAGGAGG - Intergenic
1019978215 7:4601483-4601505 CTGGAGACTCTGAAGGGTGGGGG + Intergenic
1020533349 7:9362695-9362717 TAGGAGACTGAGATGGGAGGAGG + Intergenic
1020966944 7:14882596-14882618 ATAGAGACTCAGAAGGGAGAAGG - Intronic
1020970252 7:14928831-14928853 ATGGAGACTCAGATGGATGAGGG - Intronic
1021466500 7:20949987-20950009 TTGGAGACTCAGAAGGTGGGAGG + Intergenic
1022307702 7:29163694-29163716 CTGGTGACAGAGATGGCAGGAGG - Intronic
1022354165 7:29596281-29596303 CTGAAGACTCAGAAGTGGGGAGG + Intergenic
1022680930 7:32545473-32545495 TGGGAGTCTGAGATGGGAGGAGG - Intronic
1023760483 7:43461217-43461239 CTGGAGACTCACATATTAGGAGG + Intronic
1023840365 7:44093715-44093737 ATGGAGACTGAGAGGGGCGGGGG + Intergenic
1023909186 7:44541587-44541609 CTGGAGGCACAGATGGGACCAGG + Intergenic
1024272458 7:47652864-47652886 AGGGAGACTCAGAAGGGTGGAGG + Intergenic
1024592967 7:50905680-50905702 CTGGAGACTACTATGGGTGGAGG + Intergenic
1024996659 7:55277852-55277874 CTGGTGACAGAGATGGGAGCTGG + Intergenic
1026070995 7:67119483-67119505 CCGAAGACTCAGAAGGGAGAAGG - Intronic
1026122843 7:67552431-67552453 CTGCCAACTCAGATGGGAAGTGG - Intergenic
1026289083 7:68989791-68989813 ATGGAGACACAGATGGAAGAAGG - Intergenic
1026915463 7:74117410-74117432 CTGCAGAGTCCGATGGAAGGTGG + Intronic
1026940930 7:74287598-74287620 TTGGAGACTAATAAGGGAGGAGG - Intergenic
1027435028 7:78155503-78155525 CAGGAGGCTGAGGTGGGAGGAGG + Intronic
1028123910 7:87089354-87089376 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
1028423348 7:90658359-90658381 CTGTATACTCAGATGGTAGAAGG + Intronic
1028607593 7:92671969-92671991 TTGGAGACTCAGAAAGGGGGAGG + Intronic
1028738003 7:94239870-94239892 CAGGAGCCTGAGCTGGGAGGAGG + Intergenic
1028967498 7:96818269-96818291 TTGGAGACTCAGAAGAGGGGTGG - Intergenic
1029350114 7:100007461-100007483 CGGGAGGCTGAGGTGGGAGGAGG - Intergenic
1029422633 7:100479044-100479066 CTGGAGACTGATGTGGGAGGGGG + Exonic
1030145755 7:106353161-106353183 CTGGAGACTCAGAAGTGGGGAGG - Intergenic
1030401495 7:109057235-109057257 CTGGAGACTCAGAAGGAGAGAGG - Intergenic
1032172603 7:129597818-129597840 CAGGAGTCTGAGGTGGGAGGAGG + Intergenic
1032699940 7:134370653-134370675 TGGGAGAGTGAGATGGGAGGTGG + Intergenic
1033064283 7:138138683-138138705 TTAGAGACTCAGAAGGGAAGAGG + Intergenic
1033085449 7:138337214-138337236 CTGGGGAATGAGATGAGAGGAGG - Intergenic
1033337419 7:140465392-140465414 CGGGAGGCTGAGGTGGGAGGTGG + Intronic
1033363411 7:140653805-140653827 CTGGAGACTCAAATGCTAGTGGG + Intronic
1033984362 7:147205243-147205265 CTGGAGACTTAGAAGGAGGGAGG - Intronic
1034071701 7:148192259-148192281 GTGGAGACTCAGAAGGGTGTAGG - Intronic
1034445592 7:151112548-151112570 CTGGAGACGGAGAGGGGATGGGG - Intronic
1035124792 7:156600739-156600761 CTGGAGCCTCGGAAGGGCGGGGG + Intergenic
1035138666 7:156734479-156734501 ATGGAGAGTCAGAAGGGAGAGGG + Intronic
1036009140 8:4701432-4701454 CTGGAGAGTCTGATGGGGAGGGG + Intronic
1036576805 8:10035152-10035174 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1036683890 8:10895548-10895570 CTGGAGAGTCACCTGGGAGTTGG - Intergenic
1036986961 8:13543828-13543850 TTGGAGACTCAGAAGAGGGGAGG + Intergenic
1037250992 8:16894065-16894087 CTGGAGACTCAGAAGGGAGGAGG - Intergenic
1037581960 8:20250689-20250711 CAGGAGAATCAGAGGGGAGGCGG - Intronic
1037783531 8:21887791-21887813 CAGGAGATTGAGATAGGAGGAGG + Intergenic
1037811175 8:22087946-22087968 CGGGAGACTGAGGTGGGAGGAGG - Intergenic
1038932233 8:32206791-32206813 CTGGAGACTCAGAAGGGTGGAGG - Intronic
1038946451 8:32366351-32366373 CTAGAGGCTGAGATGGGTGGAGG - Intronic
1039897772 8:41728404-41728426 CTGAAGACTCAGAGGGTGGGAGG + Intronic
1040005390 8:42616635-42616657 ATGGAGAGCCAGATGGGAGTGGG - Intergenic
1040582946 8:48712302-48712324 TTGGAAATGCAGATGGGAGGTGG + Intronic
1041036793 8:53799807-53799829 CTGTAAACTCAGATGGCAGAGGG - Intronic
1041893551 8:62898545-62898567 TTGGAGACTCAGAAGGGAGGAGG + Intronic
1042482737 8:69322568-69322590 CTGGAGACCCAGAAAGGAGCTGG + Intergenic
1042784496 8:72533329-72533351 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1042981106 8:74529613-74529635 CTGGGGACTCAGGGGGTAGGAGG + Intergenic
1043355621 8:79408858-79408880 TTGGAGACTCAGAAGGGGAGAGG - Intergenic
1043366521 8:79539454-79539476 TTGGAGACTCAGAAGGGTAGTGG - Intergenic
1043791634 8:84475323-84475345 CAGGAGGCTGAGGTGGGAGGTGG - Intronic
1044688627 8:94854127-94854149 CAGGAGAATCTCATGGGAGGTGG + Intronic
1044735301 8:95272502-95272524 CTGGAGACTCAGAAGAGAGGAGG - Intergenic
1046118299 8:109811713-109811735 ATGCAGACTCACATGGGAGAAGG + Intergenic
1046232951 8:111381475-111381497 TTGGAGACTCAGAAGGGGGCAGG - Intergenic
1046730569 8:117721263-117721285 TTGGAGACTCAGAAGGGTTGGGG - Intergenic
1046927890 8:119812478-119812500 TTGGAGACTCAGAAGCGGGGAGG - Intronic
1047059673 8:121210741-121210763 TGGGAGACTCAAAAGGGAGGAGG - Intergenic
1047106078 8:121731900-121731922 TTGGAGACTCAGAAGGAAGAGGG - Intergenic
1047899866 8:129408413-129408435 CTGGAGATTCAGAAGGGTTGGGG - Intergenic
1048351632 8:133621246-133621268 CTGAGGGCTCAGATGGGAGCAGG - Intergenic
1049427976 8:142545721-142545743 CTGGAGACACAGAGGGAAGCAGG - Intergenic
1049482775 8:142834808-142834830 CGGGAGGCTCAGATGGCTGGAGG + Exonic
1049558318 8:143294847-143294869 TAGGAGGCTCAGGTGGGAGGAGG + Intronic
1049641467 8:143717859-143717881 CTGGAAGCTCAGGTGGGAGCTGG + Intronic
1050446581 9:5729027-5729049 CTGGAGACAGAGAGGGGAGAGGG - Intronic
1051775591 9:20629761-20629783 CTGGAGGCTGAGGTGGGAGGAGG - Intergenic
1052061726 9:23967732-23967754 CTGGAGACTCAGAGGATGGGAGG - Intergenic
1052208163 9:25869004-25869026 GTGAAGACTCAGAAAGGAGGAGG - Intergenic
1052434766 9:28412097-28412119 CTGGAGAATCAGAAGAGGGGAGG - Intronic
1052709359 9:32034458-32034480 GTGGAGACTCGGATTGGAGCGGG - Intergenic
1052728963 9:32262892-32262914 CTTGAGCCTCAGATGGAAGGAGG - Intergenic
1052768674 9:32667751-32667773 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1052868307 9:33479822-33479844 CGGGAGGCTGAGGTGGGAGGTGG + Intergenic
1053107380 9:35422982-35423004 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1053338150 9:37296816-37296838 ATGGAGGCTGAGGTGGGAGGAGG - Intronic
1053475498 9:38379335-38379357 CTGGAGCCTCAGAAAGGAGCAGG + Intergenic
1053487411 9:38470431-38470453 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1053524852 9:38818032-38818054 CTGGAGACTCAGAAGCGGGAGGG - Intergenic
1053904848 9:42831131-42831153 CAGGAGGCTCAGGTGGGAGGTGG + Intergenic
1054197086 9:62042448-62042470 CTGGAGACTCAGAAGCGGGAGGG - Intergenic
1054641322 9:67546246-67546268 CTGGAGACTCAGAAGCGGGAGGG + Intergenic
1055202586 9:73684698-73684720 CTAGAGACAAAGTTGGGAGGTGG - Intergenic
1057917487 9:99068131-99068153 CTGGAGACTCTAATGTGAGGTGG + Intronic
1057977146 9:99618137-99618159 CTGGAGACTCAGAAGAGTAGGGG + Intergenic
1058583556 9:106483757-106483779 CTGGAGAATCAGATGCAGGGAGG - Intergenic
1058587462 9:106525602-106525624 CTGGAGACTCAGAAGGGGGTGGG + Intergenic
1058660586 9:107263866-107263888 CTGGAGATTCATATGGGTGTTGG + Intergenic
1058663994 9:107292747-107292769 CTGGCTACTCATATGGGAGATGG - Intronic
1058776489 9:108289318-108289340 CTGGAGAAGCAGATGGAAGGGGG - Intergenic
1058923954 9:109643513-109643535 CAGGAGACTCAGAGGGAATGTGG - Intronic
1059051174 9:110927025-110927047 CAGGTGACTCAGATGCAAGGTGG + Intronic
1059279531 9:113120552-113120574 ATGCAGACTCAGATTTGAGGAGG - Intergenic
1059333239 9:113549899-113549921 CAGGAGGCTGAGATGGGAGATGG + Intronic
1059643904 9:116245144-116245166 ATGGACACTCAGAAGGGTGGGGG + Intronic
1059740216 9:117142854-117142876 CTGGAGACACAGATGGAGGGAGG - Intronic
1059959226 9:119548995-119549017 CTGGAGCCTCAGTTGGGAAGAGG - Intergenic
1061138662 9:128751321-128751343 CTGGAGACTGAGCTGGGATCTGG - Intronic
1061213672 9:129207953-129207975 ATGGAGACTCAGAGAGGTGGCGG + Intergenic
1061238914 9:129358014-129358036 CTGGAATCCCAGATGGGTGGAGG - Intergenic
1062604110 9:137336124-137336146 CTGGAGGCTCAGAGGTGGGGAGG + Intronic
1185487025 X:489807-489829 CTGGAGACTGAGATGGGTACGGG + Intergenic
1186122544 X:6379589-6379611 CTGGAGACTCAGAAGTTGGGAGG - Intergenic
1186479343 X:9884122-9884144 CTGGAAACTGCGATGGGGGGCGG - Intronic
1186826308 X:13343548-13343570 TTGGAGACTCAGAAGGGAGGAGG - Intergenic
1186835861 X:13437159-13437181 TTGGAGACTCAGAAGGGTGAGGG + Intergenic
1187080287 X:15979042-15979064 CTGGAGACTCAGAAAGGGGGAGG + Intergenic
1187149644 X:16669814-16669836 CTGGGGACTCAGGCAGGAGGGGG - Intronic
1187149703 X:16670132-16670154 CTGGAGACTGAGGTGGGAATTGG + Intronic
1187532879 X:20112569-20112591 CGGCCGACTCAGATGTGAGGTGG + Intronic
1188181439 X:27060815-27060837 ATGGAGGCTCAGAAGGGTGGAGG - Intergenic
1189237580 X:39499558-39499580 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
1190867728 X:54398867-54398889 CGGGAGACCTAGGTGGGAGGAGG - Intergenic
1191044444 X:56120737-56120759 CTTGAGCCTCAAAGGGGAGGAGG - Intergenic
1192247477 X:69385869-69385891 CTGGGGACTGAGATAAGAGGTGG - Intergenic
1192284389 X:69719505-69719527 TTGGAGACTCAGAAGTGGGGAGG - Intronic
1193065207 X:77252544-77252566 CTGGAAACTCAGAAGTGAAGAGG + Intergenic
1193344909 X:80394482-80394504 CAGGAGAATCACTTGGGAGGGGG - Intronic
1193470943 X:81902571-81902593 TTGGAGACTCAGAAGGGGGAGGG - Intergenic
1193525852 X:82587911-82587933 ATGGAGACTCAGACAGGTGGAGG - Intergenic
1194047497 X:89026546-89026568 TTGGAGACTCAGAAGAGAGGAGG - Intergenic
1194615312 X:96093651-96093673 TTGGAGACTCAGAAGGGAGGAGG + Intergenic
1194695109 X:97038013-97038035 CTGGAGACTCAGAAGGGGGTAGG - Intronic
1194874478 X:99169671-99169693 CTGGAGACTCAAAAGCAAGGAGG + Intergenic
1195010283 X:100726931-100726953 ATGGAGACTCAGAAGGGTGAGGG - Intronic
1195712925 X:107789306-107789328 TTGAAGACACAGATGAGAGGAGG - Intronic
1197645952 X:129016681-129016703 TTGGAGACTCAGAAGGGGGTAGG - Intergenic
1197796502 X:130304641-130304663 CTGGGGACTGAGATGGCAGGCGG + Intergenic
1198417189 X:136432612-136432634 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1198744822 X:139879003-139879025 CAGGAGGCTGAGCTGGGAGGAGG + Intronic
1198845904 X:140910187-140910209 CTGGAGATTCAGATGAGAGTTGG - Intergenic
1200092189 X:153641228-153641250 ATGGAGACCCAGATGGGACAGGG + Intergenic
1200353995 X:155528489-155528511 CTGGAGACTCAGAAGGGGAGAGG - Intronic
1200794309 Y:7326496-7326518 CTGGAGACTCAGAAGTGGGGAGG + Intergenic
1201143895 Y:11051681-11051703 CAGGAGGCTGAGGTGGGAGGCGG - Intergenic