ID: 1011067293

View in Genome Browser
Species Human (GRCh38)
Location 6:83341056-83341078
Sequence ATGCCCTACCCCAGATCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 177}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011067293_1011067295 5 Left 1011067293 6:83341056-83341078 CCATGTGATCTGGGGTAGGGCAT 0: 1
1: 0
2: 1
3: 13
4: 177
Right 1011067295 6:83341084-83341106 TCATACAGTATCGGTCAACCTGG No data
1011067293_1011067298 27 Left 1011067293 6:83341056-83341078 CCATGTGATCTGGGGTAGGGCAT 0: 1
1: 0
2: 1
3: 13
4: 177
Right 1011067298 6:83341106-83341128 GAGACTGAGTTCAACCACCTGGG 0: 1
1: 0
2: 6
3: 70
4: 1307
1011067293_1011067297 26 Left 1011067293 6:83341056-83341078 CCATGTGATCTGGGGTAGGGCAT 0: 1
1: 0
2: 1
3: 13
4: 177
Right 1011067297 6:83341105-83341127 GGAGACTGAGTTCAACCACCTGG 0: 1
1: 2
2: 4
3: 54
4: 197
1011067293_1011067294 -4 Left 1011067293 6:83341056-83341078 CCATGTGATCTGGGGTAGGGCAT 0: 1
1: 0
2: 1
3: 13
4: 177
Right 1011067294 6:83341075-83341097 GCATCTGCGTCATACAGTATCGG 0: 1
1: 0
2: 0
3: 0
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011067293 Original CRISPR ATGCCCTACCCCAGATCACA TGG (reversed) Intronic
901516798 1:9753124-9753146 ATGCCCCACCTCAGATCATCAGG + Intronic
901709141 1:11100131-11100153 AGGCCGCACCCTAGATCACAGGG - Intergenic
903030401 1:20459793-20459815 ATGCCTTGCCCAAGGTCACATGG - Intergenic
903250777 1:22052017-22052039 GTGACTTGCCCCAGATCACAGGG - Intergenic
904298476 1:29539214-29539236 ATTCCCTGCCCCAAATCCCATGG + Intergenic
904483223 1:30807150-30807172 GTGCCCTCCCCAAGGTCACACGG + Intergenic
906575239 1:46883288-46883310 ATCCCCTGCCCCAGAACAAATGG - Intergenic
906596736 1:47084606-47084628 ATCCCCTGCCCCAGAACAAATGG + Exonic
909340188 1:74523000-74523022 ATTCACTACAGCAGATCACAAGG + Intronic
911785163 1:101937373-101937395 ATGCTCCAACCCAGATGACATGG + Intronic
914229301 1:145750455-145750477 AGGCCCTCCCCCAGCTGACAAGG - Exonic
917883855 1:179364951-179364973 ATGCCTCCCCCCAGAGCACAAGG - Intergenic
921006284 1:211096422-211096444 ATGCCCAACCTCATTTCACATGG + Intronic
922945117 1:229507764-229507786 GTGACTTACACCAGATCACACGG + Intronic
924473303 1:244362637-244362659 ATGACCTGCCGCAGGTCACATGG + Intronic
1063046900 10:2400665-2400687 ATGCCCTCACCCAGATAACCAGG + Intergenic
1066506764 10:36053464-36053486 GTGACTTACCCAAGATCACATGG + Intergenic
1066657121 10:37706194-37706216 TTGCCCCTCCCCAGATCACAAGG - Intergenic
1067041668 10:42956433-42956455 TTGCCCCTCCCCAGATCACAAGG - Intergenic
1069048501 10:63767422-63767444 ATGCCTTTCCCAACATCACATGG - Intergenic
1069488566 10:68842072-68842094 CTGCTCTGCCCCAGGTCACATGG - Intronic
1071458898 10:85872822-85872844 ATGCTCTGACCCAGAGCACATGG - Intronic
1071733137 10:88268942-88268964 TTGCCCCACCCCAGGCCACACGG + Intergenic
1071734998 10:88288707-88288729 ATGCCAGATGCCAGATCACATGG + Intronic
1071778065 10:88811190-88811212 CTGCCCGACCTCAGATCAGATGG - Intronic
1073330980 10:102669663-102669685 ATGCCCCACACCAGAGTACAAGG - Intergenic
1077698661 11:4419038-4419060 CTCCCCTACCCCAAATCTCAGGG - Intergenic
1078366780 11:10713434-10713456 ATGCCTTATCCAAGATCATACGG + Intergenic
1078854322 11:15194397-15194419 GTGCCCTACCCAAGATTCCATGG + Intronic
1082200175 11:49357373-49357395 ATGCCCTACCCAAAGTCACATGG + Intergenic
1084051898 11:66605556-66605578 ATCCCTTATCCAAGATCACAGGG + Exonic
1084752727 11:71214731-71214753 ATACCCCACCCCAGAGGACAGGG - Intronic
1085191028 11:74622724-74622746 ATTCCCTACAGCAGAGCACAAGG - Intronic
1086655497 11:89348823-89348845 ATGCCCTACCCAAAGTCACATGG - Intronic
1090828161 11:130402401-130402423 GTGCTCTGCCCCAGATCACCAGG - Intergenic
1090995854 11:131865195-131865217 GTAGCCTACCCCTGATCACATGG + Intronic
1091258709 11:134216222-134216244 TTGCCCATTCCCAGATCACATGG + Intronic
1092997463 12:13963637-13963659 ATGCCCTACCCAAAGTCACTCGG + Intronic
1094003058 12:25717151-25717173 ATGAACTACCCAAGGTCACAGGG + Intergenic
1094265998 12:28560553-28560575 ATGCACTACACAAGATCACCTGG + Intronic
1096503943 12:52081288-52081310 CTGCCCTACCCCAGATAAGCAGG - Intergenic
1098154821 12:67587078-67587100 ATGAATTACCCCAGATAACATGG + Intergenic
1098292320 12:68968448-68968470 TTGCCCCACTCCAGATCACTGGG + Intronic
1101676351 12:106920406-106920428 ATGACTTCCCCCAGGTCACATGG + Intergenic
1102068788 12:110000247-110000269 ATGCCTTGCCCAAGGTCACAGGG - Intronic
1104548275 12:129732161-129732183 TTGCCCTTCCTCAGATCGCATGG + Intronic
1110896054 13:80754054-80754076 ATGGCCTACCCCAGCCCATATGG + Intergenic
1111792918 13:92881454-92881476 ATGCCCTAACACAGATGCCAAGG - Intergenic
1113063601 13:106351619-106351641 ATGCCCTATTCCTGATCAGAGGG - Intergenic
1114131034 14:19792929-19792951 ATGACCTTCCCAAGATCTCAGGG + Intronic
1118177553 14:63456757-63456779 ATACCCTATTCCAGAACACAGGG + Intronic
1118311562 14:64697335-64697357 ATACCCCACCCCAGCTCCCAAGG - Intergenic
1120997810 14:90429742-90429764 ATGGCCTATTCCAGATCATATGG + Intergenic
1121545275 14:94758552-94758574 CTGCCCAACCACAGATCTCAGGG + Intergenic
1123610712 15:22091141-22091163 ATGACCTTCCCAAGATCTCACGG + Intergenic
1125370461 15:38971001-38971023 ATTTCCTTCCCTAGATCACAGGG - Intergenic
1127287371 15:57543543-57543565 ATCCCGTACCCCAGAGCAGATGG + Intronic
1127983315 15:64049987-64050009 ATAGCCTGCCCCAGACCACATGG - Intronic
1128099169 15:64984160-64984182 ATGACTTACCCAAGATCACATGG + Intronic
1130160671 15:81396579-81396601 TTGCCTAACCCCACATCACAAGG - Intergenic
1131429468 15:92375124-92375146 ATGCTCTGCCCCCGATCACAGGG - Intergenic
1202982960 15_KI270727v1_random:382902-382924 ATGACCTTCCCAAGATCTCACGG + Intergenic
1133475656 16:6119065-6119087 ATGACCCACCCAAGATCCCATGG - Intronic
1134115212 16:11542997-11543019 ATGCCATGCCCCAGATCAACTGG - Intergenic
1134567921 16:15266847-15266869 ACGCCCTACCCAAGGTCGCATGG - Intergenic
1134734514 16:16489506-16489528 ACGCCCTACCCAAGGTCGCATGG + Intergenic
1134932952 16:18222400-18222422 ACGCCCTACCCAAGGTCGCATGG - Intergenic
1137790023 16:51167066-51167088 ATGACCTGCCCAAGGTCACATGG - Intergenic
1137816929 16:51407118-51407140 ATGACCTGCCCAAGGTCACATGG + Intergenic
1138693830 16:58792827-58792849 ATGCCTGACCCCAGCTCAAAAGG - Intergenic
1139594429 16:67949781-67949803 CTGCCCGGCCCCAGCTCACATGG + Exonic
1140417631 16:74787431-74787453 ACTCCCACCCCCAGATCACATGG + Intergenic
1141593697 16:85085065-85085087 CTGCACAACCCCAGACCACACGG - Intronic
1142962550 17:3559633-3559655 ATCCCCTACACCCCATCACAGGG - Intergenic
1144106753 17:11992980-11993002 ATGCCCTACCCGAGAAGCCATGG + Intronic
1144578244 17:16443426-16443448 ATCCCCTTCCCCAGATGATATGG + Exonic
1144761577 17:17710444-17710466 ATCCCCCACCCCAGAGTACAGGG + Intronic
1149316718 17:55445249-55445271 ACGTCCTGCCTCAGATCACAAGG + Intergenic
1150599493 17:66638402-66638424 ATGACCTTCCCCAAATCACATGG - Intronic
1155620871 18:27778075-27778097 ATGCCCTTGCCCAGAGCACAAGG + Intergenic
1155999532 18:32369704-32369726 ATTCCCTAAACCACATCACAGGG + Intronic
1156008979 18:32474391-32474413 AGGTGCTACCCCAGATCATAGGG - Intergenic
1156575685 18:38312471-38312493 ATGCCCTAACCCCATTCACAAGG - Intergenic
1158408870 18:57186771-57186793 ATGCCATAGCCTAGATCCCAGGG + Intergenic
1160078703 18:75703070-75703092 ATGCCCCACCTCAGATCATCAGG + Intergenic
1160422184 18:78754811-78754833 CTGTCCTGCCCCAGGTCACATGG + Intergenic
1160707345 19:535772-535794 AAGACCTGCCCCAGCTCACAAGG - Intronic
1165953804 19:39489368-39489390 ATCTCCTTCCCCAGATCCCAGGG - Intronic
1166656262 19:44614215-44614237 GTCACCTACCCAAGATCACAGGG + Intronic
1166999630 19:46738313-46738335 ATCCCAAACCCCAAATCACAGGG + Intronic
926314277 2:11697833-11697855 AAGCCCTACCGCACATTACATGG + Intronic
926789254 2:16553660-16553682 ATGATCTATTCCAGATCACAAGG + Intronic
927812495 2:26187739-26187761 CTGCCCTGCCCCAGCTCAAAGGG - Exonic
927898530 2:26801956-26801978 ACGGCCTACGCCAGAACACAGGG - Intergenic
928222653 2:29417575-29417597 ATGACTTGCCCGAGATCACATGG + Intronic
931435640 2:62243750-62243772 ATTCCTTCCCCCAGAGCACAGGG - Intergenic
932450804 2:71809553-71809575 ATGCCCAACTCAAGATAACATGG + Intergenic
933764603 2:85698157-85698179 GTTCCCTAGCCCAGATCTCAGGG - Intronic
934579982 2:95430055-95430077 GTGACCTTCCCCAGATCCCAAGG - Intergenic
934599465 2:95646670-95646692 GTGACCTTCCCCAGATCCCAAGG + Intergenic
934942063 2:98509949-98509971 CTGCCCTTCCTCAGATAACAAGG - Intronic
939640038 2:144629217-144629239 AGGCTCTACCCCAGAACACTGGG - Intergenic
944209225 2:197189015-197189037 ATTCCCAACAGCAGATCACAGGG - Intronic
944609189 2:201383366-201383388 AGGCCCTACCCTAAATCACGTGG - Intronic
946458119 2:219845639-219845661 ATGACCTGCCCAAGGTCACATGG - Intergenic
948014867 2:234680258-234680280 ATGCCCCAGCCAAGTTCACAGGG + Intergenic
948356927 2:237385515-237385537 ATGACCTGCCCAGGATCACATGG + Intronic
948689887 2:239695320-239695342 CTGTCCTGCCCCAGCTCACATGG + Intergenic
948704038 2:239778402-239778424 ATGGCTTGCCCCAGATCACCGGG - Intronic
1170715558 20:18828161-18828183 ATGGCCCACCCCAGCTCAGAGGG - Intronic
1172282665 20:33719290-33719312 ATGACTTCCTCCAGATCACACGG + Intronic
1173323675 20:42012770-42012792 AAGGACTACCCCAGAACACAAGG - Intergenic
1173325733 20:42031675-42031697 ATGCCCTGTCCAAGGTCACATGG - Intergenic
1175525832 20:59632730-59632752 ATGGCTTTGCCCAGATCACAGGG + Intronic
1175921156 20:62451184-62451206 ATGCCTTCCCCCAGGTCAGACGG + Intergenic
1176050499 20:63116790-63116812 AAGCTCCACCCCAGATCACACGG - Intergenic
1180604956 22:17051140-17051162 GTGCCTTACACAAGATCACAAGG - Intergenic
949578779 3:5365644-5365666 AACCCCTACCCTAGATCACATGG - Intergenic
950028373 3:9835649-9835671 ATGGCTTACCCAAGATCACGTGG + Intronic
952271205 3:31833315-31833337 ATAACTCACCCCAGATCACATGG - Intronic
955074943 3:55604768-55604790 ATGCCCTTGATCAGATCACAAGG + Intronic
966327338 3:178771803-178771825 ATCCCTTACCCCTGATCTCATGG + Intronic
968043950 3:195612997-195613019 ATGCAGAACCCCAGACCACAGGG + Intergenic
968254008 3:197248644-197248666 TGGTCCTACCCCAGATAACAAGG - Intronic
969417361 4:7069191-7069213 ATGCCCTCCCCAGGATCCCAGGG + Intergenic
969672578 4:8597939-8597961 ATGCCCAGCCCCAGACCACCGGG - Intronic
969700473 4:8765032-8765054 GTGCCCAACGCCAGATCACAGGG + Intergenic
970175932 4:13339480-13339502 ATGCTCTTCCCTAAATCACAGGG - Intergenic
970430253 4:15982623-15982645 ATGCCTTTCCACAGATCACCAGG - Intronic
971514161 4:27466025-27466047 CTGCCCTACCCCAGACCATAAGG - Intergenic
972155413 4:36155294-36155316 TTGTCCTACCACTGATCACATGG - Intronic
972517165 4:39819239-39819261 CTGCCCTACCTCAGGGCACAAGG - Intergenic
972662473 4:41129577-41129599 AAGCCCTGCCCCAGCGCACATGG - Intronic
972688628 4:41374806-41374828 CTGCCCTACCCCACTTCAGAAGG + Intronic
975423946 4:74204183-74204205 ATGACTTGCCCGAGATCACAGGG - Intronic
975493758 4:75015739-75015761 GTGCCTCACCCAAGATCACATGG + Intronic
975583786 4:75930294-75930316 CTGCCATTCCCCAGATCTCAGGG - Intronic
978486037 4:109254363-109254385 ATCACTTACCCCAGGTCACAAGG + Intronic
979293005 4:118998985-118999007 ATGGCTTGCCCAAGATCACACGG - Intronic
984725201 4:183013667-183013689 CTGCCCTTCTCCCGATCACACGG + Intergenic
986853289 5:11838141-11838163 ATGCCCTTCCCAACATCTCAAGG + Intronic
988522764 5:31961228-31961250 ATGCCCTGCCTCAGATTTCAAGG - Intronic
994590268 5:101762298-101762320 ATGGCCTACCCAGGATCACTGGG + Intergenic
996517092 5:124382867-124382889 TTGCCCTACCCCAGAACTTATGG - Intergenic
997517820 5:134503380-134503402 AGGCCCTACCACAAACCACAAGG - Intergenic
999381970 5:151127614-151127636 ATGCCCTAGCCCAGACCAAGGGG - Intronic
1000339796 5:160268341-160268363 GTGACTTACCCCAGACCACATGG - Intronic
1001690477 5:173629119-173629141 TTGCCCTACCCCCTAGCACAGGG - Intergenic
1001977595 5:176012958-176012980 CTGCCCTGACCCAAATCACAAGG - Intronic
1002239826 5:177830808-177830830 CTGCCCTGACCCAAATCACAAGG + Intergenic
1002771624 6:294956-294978 AGGAACTACCCCAAATCACAAGG + Intronic
1003623934 6:7726454-7726476 ACGCCCCTCCCCAGATCGCAGGG - Intergenic
1004841877 6:19596769-19596791 ATGACCTTCTCCAGATCACGGGG - Intergenic
1005655739 6:27935202-27935224 ATAACCTGCCGCAGATCACAGGG - Intergenic
1006905751 6:37532289-37532311 ATGCCTTGCCCAAGACCACATGG - Intergenic
1007950521 6:45868344-45868366 TTGTCCTGCCCCAGATCAAAGGG + Intergenic
1009637266 6:66281724-66281746 TTGCCCTACCCCAGATCACCAGG + Intergenic
1011067293 6:83341056-83341078 ATGCCCTACCCCAGATCACATGG - Intronic
1012216858 6:96597778-96597800 ATGCCCTTCTCCACATCTCAAGG + Intronic
1015222715 6:130823095-130823117 TTGCCCAACCTAAGATCACAGGG - Intergenic
1024596472 7:50941590-50941612 CTGCCCTCCCCAAGATCACCAGG - Intergenic
1026976037 7:74499060-74499082 CTGCCCTCCTCCAGCTCACAGGG - Intronic
1027876558 7:83777574-83777596 ATGCCCTTCCCTAGAGGACATGG - Intergenic
1029681975 7:102117634-102117656 ATGCCCTTCCCCAGCTCCCCTGG - Intronic
1032100293 7:128970801-128970823 ATGCTCTAGCCCAGAACACTGGG - Intronic
1034507543 7:151505972-151505994 ACGCCCTACCCCAGCTCCCCGGG - Intronic
1038268878 8:26059186-26059208 ATGCCCTAACTCAGAGCAGACGG - Intergenic
1039364419 8:36915365-36915387 ATACCATGCCCAAGATCACAAGG - Intronic
1039863379 8:41479090-41479112 ATGACCTACCACAGAACACCTGG + Intergenic
1040580313 8:48693590-48693612 CCGCCCCACCCCAGCTCACAGGG - Intergenic
1041221239 8:55653514-55653536 ATTCCCCACCAAAGATCACAAGG + Intergenic
1043777152 8:84284211-84284233 TTTCCTTACCCCAGATTACAAGG + Intronic
1044926185 8:97210481-97210503 TTGCCATAGCCCTGATCACATGG + Intergenic
1045314051 8:101027880-101027902 ATTCCCCACCCCAGATCACCTGG - Intergenic
1048202044 8:132382732-132382754 ATTCCCTTCCCCAATTCACAAGG - Intronic
1049134336 8:140881270-140881292 GTTCCCCACCCCAGAGCACAAGG - Intronic
1053306928 9:36991264-36991286 GTGACCTACCCAAGGTCACATGG + Intronic
1056271949 9:84955269-84955291 ATGTCCTTCCCCAGGGCACACGG + Exonic
1057032381 9:91785731-91785753 ATGCCCTGCAGCAGATCTCAAGG - Intronic
1057727632 9:97579331-97579353 ATGTCCTACCCGAGAGCTCATGG + Intronic
1061444939 9:130632382-130632404 ATGCCCCTCCCCAAATGACAAGG + Intronic
1061818237 9:133208594-133208616 TTGGCCTGCTCCAGATCACAGGG - Exonic
1061899158 9:133664194-133664216 ATGTCCAACTCAAGATCACATGG - Intronic
1062242219 9:135546764-135546786 TTGGCCTGCTCCAGATCACAGGG + Exonic
1187852096 X:23601238-23601260 ATGCACTACCTGATATCACAAGG + Intergenic
1188111479 X:26199433-26199455 CTCCCCAACCCCAGAACACAGGG + Intergenic
1189129117 X:38480064-38480086 GCGCCCTACTCAAGATCACAAGG - Intronic
1190490444 X:50977538-50977560 ATAACCTTCCCAAGATCACATGG - Intergenic
1193733302 X:85127452-85127474 ATGCCTTCATCCAGATCACATGG - Intergenic
1198642112 X:138767760-138767782 ATGCCCTGACCAAGGTCACATGG - Intronic
1199732421 X:150649188-150649210 GTGCCTTGTCCCAGATCACATGG + Intronic
1200153009 X:153960406-153960428 CTGCCCTCCCCCAGATACCATGG - Exonic