ID: 1011071809

View in Genome Browser
Species Human (GRCh38)
Location 6:83393195-83393217
Sequence GCGTCAGAGGACCCCCTCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 7, 3: 8, 4: 81}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011071807_1011071809 -3 Left 1011071807 6:83393175-83393197 CCAAGAAGGTGGTGAAGCAGGCG 0: 1
1: 1
2: 4
3: 15
4: 193
Right 1011071809 6:83393195-83393217 GCGTCAGAGGACCCCCTCAAAGG 0: 1
1: 0
2: 7
3: 8
4: 81
1011071802_1011071809 16 Left 1011071802 6:83393156-83393178 CCTACCAAATATGATGACACCAA 0: 1
1: 2
2: 13
3: 24
4: 183
Right 1011071809 6:83393195-83393217 GCGTCAGAGGACCCCCTCAAAGG 0: 1
1: 0
2: 7
3: 8
4: 81
1011071803_1011071809 12 Left 1011071803 6:83393160-83393182 CCAAATATGATGACACCAAGAAG 0: 2
1: 11
2: 17
3: 32
4: 199
Right 1011071809 6:83393195-83393217 GCGTCAGAGGACCCCCTCAAAGG 0: 1
1: 0
2: 7
3: 8
4: 81
1011071801_1011071809 29 Left 1011071801 6:83393143-83393165 CCGTCTGGAAAAACCTACCAAAT 0: 2
1: 8
2: 14
3: 49
4: 305
Right 1011071809 6:83393195-83393217 GCGTCAGAGGACCCCCTCAAAGG 0: 1
1: 0
2: 7
3: 8
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011071809 Original CRISPR GCGTCAGAGGACCCCCTCAA AGG Intronic
901678051 1:10898321-10898343 GGGTCAGAGGGCCCCCTCAAGGG + Intergenic
904707483 1:32402303-32402325 GCATCGGAGGCCACCCTCAAGGG - Intergenic
904807693 1:33143343-33143365 GGGTCGGAGCACCCCCTCCATGG - Intergenic
907089017 1:51707332-51707354 GCACCAGAGGGCCCCCTAAAGGG - Intronic
910900460 1:92114994-92115016 GCATCAGAGGGGGCCCTCAAGGG - Intronic
911233210 1:95382345-95382367 GGGTCAGATGACCCCCTGAAGGG + Intergenic
913227656 1:116714026-116714048 GCATCAGAGGGCCCCCTCAAGGG - Intergenic
913499865 1:119462222-119462244 ACATCAGAGGATCCCCTCAAGGG - Intergenic
920147711 1:203876565-203876587 GCATCAAAGGACCCAATCAATGG - Intergenic
924207210 1:241725597-241725619 GCCTGGGAGGAACCCCTCAAAGG - Intronic
1068338347 10:55667540-55667562 GCATCGGAGGGCCCGCTCAAGGG - Intergenic
1070060822 10:72981337-72981359 GCCTCACAGGACACCCTCAGTGG - Intergenic
1070559506 10:77555216-77555238 GAGTCAGACGGCCCCCTCACAGG + Intronic
1076992163 11:281080-281102 GCGTCCGAGGACGCCCTCGCGGG - Exonic
1078987775 11:16611856-16611878 GCGGCAGAGCACCGCCACAAAGG + Intronic
1082009099 11:47438332-47438354 GAGTCAGAGAGGCCCCTCAAAGG - Intronic
1083615545 11:64024357-64024379 AAATCATAGGACCCCCTCAACGG - Intronic
1086581794 11:88408371-88408393 GCATCAGAAGGCCCCTTCAAGGG - Intergenic
1089046432 11:115504804-115504826 GGGACAGAGGACCCTCTTAAGGG - Intronic
1090199369 11:124843320-124843342 CCTTCGGAGGACCCCCTCCAGGG - Intergenic
1092193928 12:6537851-6537873 GCGTCGGAGGGCCCCCTCAAGGG + Exonic
1094846578 12:34364011-34364033 GCGGCAGAGGTCACCCCCAACGG - Intergenic
1094850865 12:34381780-34381802 GTGGCAGAGGTCCCCCCCAAGGG - Intergenic
1094851517 12:34384371-34384393 GAGGCAGAGGTCCCCCTCACGGG - Intergenic
1094853574 12:34393093-34393115 GCGGCAGAGGTCCCCCCCACGGG + Intergenic
1094854073 12:34395160-34395182 GAGTCAGAGGTCCCCCACCACGG + Intergenic
1094855235 12:34399949-34399971 GCATCAGAGGTCCCCTGCAACGG + Intergenic
1103557313 12:121774608-121774630 GGGGCAGCGGACCCCCTCAGCGG + Intronic
1105547122 13:21359103-21359125 GTATCGGAGGGCCCCCTCAAGGG + Intergenic
1106388077 13:29307570-29307592 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1108001893 13:45911464-45911486 GGGTCAAAGGAGCCCCTCAGTGG + Intergenic
1113482914 13:110634779-110634801 GAGTCAGTGGACCCCCTGGAGGG + Intronic
1120879708 14:89405573-89405595 GCCTCATAGGACCCCTTCAGTGG - Intronic
1124336028 15:28857840-28857862 GGTGCAGAGGAACCCCTCAAAGG + Intergenic
1124632909 15:31347454-31347476 GCGTCAAAGGGCACCCTCAGGGG + Intronic
1129737388 15:77973901-77973923 GGGTCAGAGGACCCCCTGGCTGG + Intergenic
1129848685 15:78779724-78779746 GGGTCAGAGGACCCCCTGGCTGG - Intronic
1130253234 15:82314222-82314244 GGGTCAGAGGACCCCCTGGCTGG + Intergenic
1136015675 16:27399255-27399277 GACCCAGAGGAACCCCTCAAGGG + Intergenic
1141436392 16:84002105-84002127 GCACCAGAGCACCCCCTCCACGG + Intronic
1146884557 17:36462434-36462456 GGGGCAGAGCAGCCCCTCAAGGG + Intergenic
1148999986 17:51747652-51747674 GGGTCGGAGCACCTCCTCAATGG - Exonic
1151668589 17:75559177-75559199 GAGTCAGGGGACCCCGTCCATGG + Intronic
1157213281 18:45761838-45761860 GCCTCAGAGGACCCCATGGATGG - Intergenic
1160764886 19:803155-803177 AGGGCAGAGGACCCCCTCCATGG - Intronic
1164879018 19:31715186-31715208 GCATCGGTGGAACCCCTCAAAGG - Intergenic
1166679859 19:44759548-44759570 GCCTCGGAGGACCCCAGCAAAGG - Exonic
1166969919 19:46559427-46559449 GCATTGGAGGACCCCCTCAAGGG + Intronic
925418164 2:3688176-3688198 GCATTGGAGGGCCCCCTCAAGGG - Intronic
928392404 2:30919672-30919694 CCCTCAGAGGACACGCTCAAAGG - Intronic
929562166 2:42962679-42962701 GCGTCTGAGCCCTCCCTCAATGG - Intergenic
930885121 2:56316390-56316412 GGGTCTGAGGACCCACACAAAGG + Intronic
947166066 2:227263795-227263817 GCCTCAGAGGAGCCCCTGGATGG + Exonic
948538234 2:238663939-238663961 GCCCCAGAGGACCACCTGAACGG - Intergenic
948912266 2:241010598-241010620 GGGTCAGAGCATCCCCTCCATGG + Intronic
1170169317 20:13393465-13393487 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1173639767 20:44592710-44592732 GCTTCAGAGGCTCCTCTCAAAGG - Intronic
1175097452 20:56552741-56552763 GAGCCTGAGGACCCCCTGAAGGG - Intergenic
1175918417 20:62438400-62438422 GGGTCAGGGGACCCCCACACCGG + Intergenic
1177557983 21:22716210-22716232 GCCTCAGAGCCACCCCTCAAAGG + Intergenic
1183365501 22:37404554-37404576 GGGTCAGAGGAACACCCCAAAGG + Intronic
1184885497 22:47342639-47342661 GCTTCAGAGGAGCCCCTGTATGG + Intergenic
950656424 3:14439830-14439852 ACCTCAGAGGACACCCTCCAGGG - Intronic
951359300 3:21705583-21705605 GAGTAAGAGGACTTCCTCAAAGG + Intronic
955126518 3:56117583-56117605 GGATAAGAGGACTCCCTCAAGGG + Intronic
964501104 3:157348798-157348820 GGGTCAGAGGACCACAGCAATGG - Intronic
967240702 3:187436606-187436628 GCCACAGAGGACCCCCTCACAGG - Intergenic
970379518 4:15492917-15492939 GCATCAGAGGGCCCCCTCAAGGG - Intronic
975416954 4:74115549-74115571 CTGACAGAGCACCCCCTCAAGGG - Intronic
976628051 4:87207877-87207899 ACATCGGAGGGCCCCCTCAAGGG + Intronic
977720992 4:100240216-100240238 GCCTCAGAGTCACCCCTCAAGGG + Intergenic
988984420 5:36602928-36602950 GTGTCAGCCGACCCCTTCAAGGG + Intergenic
990577605 5:57138228-57138250 GAATCAGAGGAGCCCTTCAAGGG - Intergenic
991659088 5:68932315-68932337 CCTTCAGGGGACCCCCTCCATGG - Intergenic
996566332 5:124882953-124882975 GCGTGAGAGGAGCCACACAAGGG - Intergenic
998393992 5:141806524-141806546 GCTACAGAGGACTCCCTCCAGGG - Intergenic
1002232940 5:177782236-177782258 GCCTCAGAGGGCACCCTCAGAGG - Exonic
1003012132 6:2435953-2435975 GGGTCAGAGGACACCCACAGAGG + Intergenic
1005362297 6:25042268-25042290 GCGTCAGAGGAGCCGTGCAATGG + Intergenic
1010781829 6:79953198-79953220 GCATCAGAGGGCCCCCTCAAAGG - Intergenic
1011071809 6:83393195-83393217 GCGTCAGAGGACCCCCTCAAAGG + Intronic
1015665065 6:135619358-135619380 GCTTCAGAGGATCCTATCAAGGG - Intergenic
1018658691 6:166065082-166065104 GCATCAGAGGGCTCCCTCTAGGG + Intergenic
1020551778 7:9615770-9615792 GCATCAGAGGGCTCCCTCAAGGG + Intergenic
1024792566 7:52983644-52983666 TCTTCAGAGGAACCCATCAAAGG - Intergenic
1029988769 7:104944313-104944335 CCATCTGGGGACCCCCTCAAAGG + Intergenic
1034895833 7:154875816-154875838 ACGTCAGATGACCCCCGTAAGGG - Intronic
1039221098 8:35331615-35331637 GAGTCAGAGCACCCCCTCCAAGG - Intronic
1039569258 8:38574042-38574064 GCCTCAGAGAATCCCCTAAAGGG - Intergenic
1045952222 8:107865220-107865242 GGGTGAGAGCACCACCTCAAGGG - Intergenic
1059755615 9:117290817-117290839 GCTTCTGTGGACCCCCACAATGG + Intronic
1061424218 9:130489077-130489099 GCGTCTGAGGGCCCCTTCAAAGG + Intronic
1061488023 9:130930124-130930146 GGGTCAGAGGACCCCCTTCTTGG + Intronic
1189248012 X:39578530-39578552 CCATCAGAGGAACCCCTCATGGG - Intergenic
1189276114 X:39787325-39787347 GCATCGGAGGGCCCCCTCAAGGG - Intergenic
1189973394 X:46439899-46439921 GCGTTGAAGGCCCCCCTCAAGGG - Intergenic
1201929651 Y:19328349-19328371 GTGCCAGAGGTCCCCCACAAGGG + Intergenic