ID: 1011080845

View in Genome Browser
Species Human (GRCh38)
Location 6:83489096-83489118
Sequence CAAAATACAATGGTGGGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011080838_1011080845 6 Left 1011080838 6:83489067-83489089 CCTATAAAACCAGGTAAGTTATG No data
Right 1011080845 6:83489096-83489118 CAAAATACAATGGTGGGGCTGGG No data
1011080836_1011080845 17 Left 1011080836 6:83489056-83489078 CCGGTTATGAACCTATAAAACCA No data
Right 1011080845 6:83489096-83489118 CAAAATACAATGGTGGGGCTGGG No data
1011080835_1011080845 22 Left 1011080835 6:83489051-83489073 CCTCTCCGGTTATGAACCTATAA No data
Right 1011080845 6:83489096-83489118 CAAAATACAATGGTGGGGCTGGG No data
1011080839_1011080845 -3 Left 1011080839 6:83489076-83489098 CCAGGTAAGTTATGTGCTTACAA No data
Right 1011080845 6:83489096-83489118 CAAAATACAATGGTGGGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011080845 Original CRISPR CAAAATACAATGGTGGGGCT GGG Intergenic
No off target data available for this crispr