ID: 1011085719

View in Genome Browser
Species Human (GRCh38)
Location 6:83538230-83538252
Sequence CAGTGTATGAAACATCTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011085719_1011085726 15 Left 1011085719 6:83538230-83538252 CCCCAAAGATGTTTCATACACTG No data
Right 1011085726 6:83538268-83538290 CCACAAGGATGTTGGGTGTCTGG No data
1011085719_1011085723 7 Left 1011085719 6:83538230-83538252 CCCCAAAGATGTTTCATACACTG No data
Right 1011085723 6:83538260-83538282 AAGATGAACCACAAGGATGTTGG No data
1011085719_1011085724 8 Left 1011085719 6:83538230-83538252 CCCCAAAGATGTTTCATACACTG No data
Right 1011085724 6:83538261-83538283 AGATGAACCACAAGGATGTTGGG No data
1011085719_1011085722 0 Left 1011085719 6:83538230-83538252 CCCCAAAGATGTTTCATACACTG No data
Right 1011085722 6:83538253-83538275 AAAAAGAAAGATGAACCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011085719 Original CRISPR CAGTGTATGAAACATCTTTG GGG (reversed) Intergenic
No off target data available for this crispr