ID: 1011093477

View in Genome Browser
Species Human (GRCh38)
Location 6:83633382-83633404
Sequence CAGTGTCAGCTGTGGTAGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 436
Summary {0: 1, 1: 1, 2: 26, 3: 127, 4: 281}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011093475_1011093477 -1 Left 1011093475 6:83633360-83633382 CCAGGAGGTGGCACTTTCTAGAC 0: 1
1: 17
2: 211
3: 325
4: 553
Right 1011093477 6:83633382-83633404 CAGTGTCAGCTGTGGTAGTATGG 0: 1
1: 1
2: 26
3: 127
4: 281
1011093474_1011093477 3 Left 1011093474 6:83633356-83633378 CCTGCCAGGAGGTGGCACTTTCT 0: 4
1: 168
2: 302
3: 449
4: 635
Right 1011093477 6:83633382-83633404 CAGTGTCAGCTGTGGTAGTATGG 0: 1
1: 1
2: 26
3: 127
4: 281
1011093473_1011093477 6 Left 1011093473 6:83633353-83633375 CCTCCTGCCAGGAGGTGGCACTT 0: 75
1: 230
2: 363
3: 459
4: 563
Right 1011093477 6:83633382-83633404 CAGTGTCAGCTGTGGTAGTATGG 0: 1
1: 1
2: 26
3: 127
4: 281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011093477 Original CRISPR CAGTGTCAGCTGTGGTAGTA TGG Intronic
900698991 1:4032308-4032330 CAGTGTGGGTTGTGGTGGTAGGG + Intergenic
901828800 1:11879736-11879758 CAGGGGCAGCTGTCGTAGCAGGG - Intergenic
902969586 1:20037712-20037734 GACCATCAGCTGTGGTAGTATGG + Intronic
904972872 1:34432795-34432817 CAGGGTCAGCTGGGGTTGGATGG - Intergenic
905497467 1:38403829-38403851 GAGCATCAGCTGTGGTAGTTAGG - Intergenic
906528122 1:46508288-46508310 CAGGATCAGCTGGGGTAGTCAGG + Intronic
906910565 1:49944186-49944208 GAGCATCAGCTGTGGTAGTATGG - Intronic
907029165 1:51153583-51153605 CAGAGTCTGCTGTGGAACTAAGG - Intergenic
908981778 1:69967436-69967458 AAGTATCAGCTGTGGCAGTATGG - Intronic
909673615 1:78214695-78214717 GAGCATCAGCTGTGGTATTATGG - Intergenic
909724604 1:78819335-78819357 CAGTGCCAGCTGTATTATTATGG + Intergenic
909751000 1:79160581-79160603 AAGTTTCAGCTGTGCTAGGAAGG + Intergenic
910738956 1:90494527-90494549 GAGCATCAGCTGTGGTAATATGG + Intergenic
911678872 1:100691550-100691572 GAGCATCAGCTGTGGTAGTATGG + Intergenic
912313336 1:108645029-108645051 CAGTGTCAGCAGTGGCAATGTGG - Intergenic
912616112 1:111101919-111101941 CAGCATCAGCTGTGGTAGTATGG + Intergenic
913143164 1:115962050-115962072 GAGCATCAGCTATGGTAGTACGG - Intergenic
913339701 1:117746854-117746876 GAGCATCAGCTGTGGTACTATGG + Intergenic
913418192 1:118635685-118635707 GAGCATCAGCTGTGGTAGTATGG + Intergenic
914863557 1:151406376-151406398 CAGTGGCAGCTTTGTTAGTGGGG + Exonic
915737631 1:158094853-158094875 CAGTGCCAGCTGGGGCAGCAGGG - Exonic
916579961 1:166097867-166097889 GAGCATCAGCTGTGGTATTATGG - Intronic
917898464 1:179516959-179516981 GAGCATCAGCTGTGATAGTATGG + Intronic
917958613 1:180125311-180125333 CAGTGACAGCTGTGCTGGCAGGG + Intergenic
918422965 1:184382740-184382762 CAGTGTTAGCTGTGATTGCATGG + Intergenic
919277934 1:195445142-195445164 GAGCATCAGCTGTGGCAGTATGG - Intergenic
921409772 1:214823381-214823403 GAGCTTCAGCTGTGGTATTATGG + Intergenic
922012148 1:221599575-221599597 CAGTGCCAGCTGTGCCAGTTGGG + Intergenic
922396029 1:225202197-225202219 AAGCATCAGCTGTGGTAGTATGG + Intronic
922657944 1:227402137-227402159 GAGCGTCAGCTGTGGTAGTATGG - Intergenic
1063069521 10:2647217-2647239 CATTGTCAGCATTGTTAGTATGG + Intergenic
1063553201 10:7052655-7052677 CAGTTTCAGATGTGGTATTAAGG - Intergenic
1064145823 10:12825708-12825730 CAGTGTCAGCTGAGGGATTCTGG - Intronic
1065470925 10:26081059-26081081 AAGTATCAGCTGTGGTAGTATGG + Intronic
1066145473 10:32553827-32553849 GAGCATCAGCTGTGGTAGTATGG + Intronic
1066747726 10:38618007-38618029 CAGTGACAGCTGGGGTGGAATGG + Intergenic
1067196523 10:44124299-44124321 AAGTGTGGGCTGTGGTAGTGTGG - Intergenic
1067223439 10:44360381-44360403 CAGTGTGCGCTGTGGGAGTCAGG - Intergenic
1067928878 10:50539232-50539254 CTGTGTCAGCTGTGGTCAAAGGG + Intronic
1068096585 10:52499289-52499311 GAGTATCAGCTGTGATATTATGG + Intergenic
1069071969 10:63998547-63998569 CAGGGGAAGCTGTTGTAGTATGG - Intergenic
1069325313 10:67225358-67225380 GAGCATCAGCTGTGGTAGTATGG - Intronic
1069417151 10:68210613-68210635 CAGTCTCAGCTGAGGGAGAAAGG + Exonic
1070327724 10:75399380-75399402 CAGTGGTAGCTGAGGCAGTAAGG + Exonic
1071024151 10:81092738-81092760 CAGCATCAGTTATGGTAGTATGG + Intergenic
1071103908 10:82071824-82071846 GAATGTGAGCTGTTGTAGTAAGG + Intronic
1071910675 10:90229486-90229508 GAGCATCAGCTGTGGTAGTATGG - Intergenic
1072928009 10:99633786-99633808 GAGCATCAGCTGTGGTAGTATGG - Intergenic
1074896519 10:117782056-117782078 CAGTGGCAGCTGTTTTGGTAGGG + Intergenic
1075946838 10:126440525-126440547 TAGCATCAGCTGTGGTAGTATGG - Intronic
1079273680 11:19013397-19013419 GAACATCAGCTGTGGTAGTATGG + Intergenic
1079464149 11:20713126-20713148 GAGCATCAGCTGTGGTAGTAGGG + Intronic
1079791687 11:24747553-24747575 GAGCATCAGCTGTGGTAGTATGG + Intronic
1079952127 11:26819022-26819044 GAGCATCAGCTGTAGTAGTATGG + Intergenic
1079994929 11:27286041-27286063 AACTGACAGCTGTGGGAGTATGG + Intergenic
1080226420 11:29966247-29966269 GAGAGGCAGCTATGGTAGTATGG + Intergenic
1080402326 11:31947527-31947549 AAGCATCAGCTGTAGTAGTATGG - Intronic
1080672511 11:34394580-34394602 GATCATCAGCTGTGGTAGTATGG + Intergenic
1082200049 11:49355741-49355763 TAGTGTGAGCTGTAGTAGTTTGG + Intergenic
1082903938 11:58285582-58285604 GAGCATCAGCTGTAGTAGTATGG - Intergenic
1082916889 11:58446778-58446800 GAGCATCAGTTGTGGTAGTATGG - Intergenic
1083899287 11:65635957-65635979 CACTGTCAGCTCTGGGGGTAAGG - Intronic
1084108458 11:66997019-66997041 CAGTCTCAGCTGTGGCAAGAGGG + Intergenic
1085917187 11:80903625-80903647 GAGCATCAGCTATGGTAGTATGG - Intergenic
1086072370 11:82813333-82813355 AAGTGCCAGCTGTGATACTATGG + Intergenic
1086300640 11:85423434-85423456 GAGTATCAGCTGTGGTAATATGG + Intronic
1086655622 11:89350467-89350489 TAGTGTGAGCTGTGGTAGTTTGG - Intronic
1087353294 11:97060512-97060534 TGGTGCCAGCTGAGGTAGTAGGG - Intergenic
1087468885 11:98546145-98546167 GAGCATCAGCTGTGATAGTATGG - Intergenic
1087501287 11:98957739-98957761 CAGTCACACCTGTGGTAGCAGGG - Intergenic
1087619515 11:100525807-100525829 CAGCATCAACTGTGGTAGTATGG - Intergenic
1088179506 11:107092870-107092892 GAGCATCAGCTGTGGTGGTATGG - Intergenic
1088388016 11:109281432-109281454 GAGCATCAGCTCTGGTAGTATGG + Intergenic
1088884032 11:113993227-113993249 CAGTATCAGCTCTGGAAGTTGGG + Intergenic
1090304719 11:125681391-125681413 CAGTGTCAACTGTGGCAGGAAGG - Intergenic
1090753064 11:129764131-129764153 GAGCATCAGCTGTGGTAGTATGG - Intergenic
1090758944 11:129818586-129818608 CAGAGGCAGCTGTGGTATTCTGG - Intronic
1090894986 11:130964216-130964238 GAGCATCAGCTGTGGTAGTATGG + Intergenic
1092204784 12:6608052-6608074 GAGTGTCCGTTGTTGTAGTATGG - Intergenic
1092272456 12:7034061-7034083 CAGTGTCAGCTATGTTCGTAGGG + Intronic
1093409236 12:18845097-18845119 GAGCATCAGCTGTGGTATTATGG + Intergenic
1093488697 12:19681183-19681205 GAGCATCAGCTGTGGTAGCATGG + Intronic
1094447321 12:30546030-30546052 GAGCATCAGCTGTGGTAGTATGG + Intergenic
1094722237 12:33076692-33076714 GAGCATCAGCTGTGGTAGTATGG + Intergenic
1095115318 12:38345046-38345068 AAGCATTAGCTGTGGTAGTATGG - Intergenic
1095486042 12:42685657-42685679 AATTGTCACCTGTAGTAGTATGG + Intergenic
1095932109 12:47637326-47637348 GAGCATCAGCTGTGGTAGTATGG - Intergenic
1096347914 12:50866616-50866638 GAGCATCAGCTGTGGTATTATGG - Intronic
1097295519 12:57958369-57958391 GAGCATCAGTTGTGGTAGTATGG - Intergenic
1098612819 12:72482653-72482675 TAGTGGCAGTGGTGGTAGTATGG + Intronic
1099187704 12:79533913-79533935 CATTGGAAGCTGCGGTAGTAGGG + Intergenic
1099477130 12:83121659-83121681 GAGCATAAGCTGTGGTAGTATGG + Intronic
1099687412 12:85907922-85907944 CAGCATCAGCTATGGTAGTATGG + Intergenic
1099710972 12:86223807-86223829 CAGTGCAAGCTATGGTAGTCTGG - Intronic
1099860892 12:88224326-88224348 TAGTGTCACTTGTGGCAGTATGG - Intergenic
1100203566 12:92325256-92325278 GAGCATCAGCTGTGGTAGTATGG + Intergenic
1101395715 12:104345324-104345346 CAGAGCCAGCTGTGGTAGGCTGG + Intronic
1101635234 12:106535308-106535330 GAGAATCAGCTGTGGTAGTATGG + Intronic
1103761074 12:123250842-123250864 AAGCATCAGCTGTGGTAATATGG + Intronic
1104626996 12:130365230-130365252 CACTGTGAACTGTGGCAGTAGGG + Intronic
1107755970 13:43622762-43622784 GAGCGTCAGCTGTGGTAGTATGG + Intronic
1108469757 13:50756221-50756243 GAGCATCAGCTGTGGTAGTATGG + Intronic
1108817132 13:54305539-54305561 GAGCATCAGCTGTGGTAGTATGG - Intergenic
1108825578 13:54408396-54408418 GAGCATCAGCTGTGGTAGCATGG - Intergenic
1109508379 13:63336757-63336779 GAGTATCAGCTGTGGTATTATGG + Intergenic
1110561899 13:76918239-76918261 CAGCATCAGCTGTGGTATTACGG - Intergenic
1110627592 13:77668699-77668721 GAACATCAGCTGTGGTAGTATGG - Intergenic
1110748121 13:79079719-79079741 GAGCATCAGCTGTGGTAGTATGG - Intergenic
1110852591 13:80262507-80262529 GAGCATCAGCTGTGGTTGTATGG + Intergenic
1111748196 13:92296271-92296293 GAGCATCAGCTGTGGTAGTATGG + Intronic
1111878346 13:93923733-93923755 CAGTGGCAGCTGTGCTAGTCTGG + Intronic
1112087031 13:96042008-96042030 GAGCATCAGCTGTGGTAGTATGG - Intronic
1113507641 13:110828143-110828165 CAGTGTCTGCTGAGGGTGTATGG + Intergenic
1114191690 14:20444014-20444036 CAGTGGCAGCAGTGGAAGTGAGG + Intergenic
1114692287 14:24595276-24595298 GAGCATCAGCTGTGGTAGGATGG + Intergenic
1115299283 14:31865781-31865803 GAGCATCAGCTGTGGTAGTATGG - Intergenic
1115680352 14:35730870-35730892 GAGCATCAGCTGTGGTAGTATGG - Intronic
1115958558 14:38809237-38809259 GAGCATCAGCTGTGGTAGTATGG - Intergenic
1115969843 14:38932763-38932785 TAGCATCAGCTGTGGTAGTATGG - Intergenic
1116335576 14:43651916-43651938 GAGTATCAGCTGTGGTAGTATGG - Intergenic
1116346746 14:43803428-43803450 GAGCATCAGCTGTGGTAGTATGG - Intergenic
1118165634 14:63332758-63332780 GAGTATCAGCTGTGGTAGTATGG - Intergenic
1118532082 14:66718011-66718033 GAGTATCAGCTGTGGTAGTATGG + Intronic
1120489635 14:85161162-85161184 GAGCATCAGCTGTGGTAGTATGG - Intergenic
1121516573 14:94556238-94556260 GAGCATCAGCTGTGGTAGTATGG + Intergenic
1122672411 14:103382871-103382893 CAGAGTTAGCTGTGGGAGGATGG - Intergenic
1122970802 14:105151428-105151450 CAGTGTGAGCCGTGGGAATAAGG + Intronic
1124094158 15:26633318-26633340 CAGGGTCAGCTGCAGTAGGATGG - Intronic
1124114385 15:26827646-26827668 CAGTGTGAGCTGGGGCAGGAGGG - Intronic
1124557169 15:30736591-30736613 GAGCATCAGCTGTGGTAGCATGG - Intronic
1124667941 15:31609706-31609728 GAGCATCAGCTGTGCTAGTATGG - Intronic
1124674096 15:31669156-31669178 GAGCATCAGCTGTGGTAGCATGG + Intronic
1128365948 15:67003080-67003102 CACTGTCAGCTGTGGTTTTGTGG + Intergenic
1129979158 15:79850640-79850662 CAGTGTCAAATGTGGCAGAATGG + Intronic
1133692947 16:8233961-8233983 CAAAGTCATCTGTGGGAGTATGG + Intergenic
1137743385 16:50802637-50802659 CTGTGGAAGCTGTGGTAGAATGG - Intergenic
1138687575 16:58739066-58739088 CAATGTCAGCTGTGGAAATCAGG + Intergenic
1138881053 16:61015039-61015061 GAGCATCAGCTGTGGTGGTATGG - Intergenic
1142270477 16:89086538-89086560 CTGTGTCAGCTGTGGCAGGCTGG - Intergenic
1142338651 16:89506979-89507001 CAGTGTCAGCCCTGGGTGTAGGG + Intronic
1143879046 17:10015746-10015768 AAGAGTCAGCTGTGTTTGTAGGG - Intronic
1143990867 17:10960074-10960096 GAGCATCAGCTATGGTAGTATGG - Intergenic
1144139644 17:12336394-12336416 AAGCGTCAGCTGTAGTAGTGTGG + Intergenic
1146507317 17:33416598-33416620 CAGTGGCAGCTGAGGGAGGATGG + Intronic
1150538991 17:66076692-66076714 GAGCATCAGCTGTGGTACTATGG - Intronic
1150971153 17:70029648-70029670 CAGAGCCAGCTGGGGGAGTATGG + Intergenic
1151048428 17:70948383-70948405 GGGCATCAGCTGTGGTAGTATGG - Intergenic
1153065488 18:1039991-1040013 GAGCATCAGCTATGGTAGTACGG - Intergenic
1153069454 18:1089054-1089076 AAGCATCAGCTGTGGTAGTGTGG + Intergenic
1153400516 18:4679241-4679263 GAGCATCAGCTGTGTTAGTATGG - Intergenic
1156011340 18:32501185-32501207 GAGCATCAGCTGTGATAGTATGG + Intergenic
1156474617 18:37397776-37397798 CAGTCTCAGCTGGGGTAGAGTGG + Intronic
1156944698 18:42814703-42814725 AAGCATCAGCTGTGGTAGTATGG - Intronic
1157012655 18:43670237-43670259 CATTGGCAGCAGTGGTAATATGG - Intergenic
1157964697 18:52194700-52194722 CAGTGTCAACTGGTGTAATATGG + Intergenic
1158829796 18:61264300-61264322 CAGCATCAGCTGTGGTAGTATGG - Intergenic
1159555790 18:69943103-69943125 CAGTGTCTTCTGTTGTATTACGG + Intronic
1159787120 18:72727344-72727366 GAGCATCAGCTGTAGTAGTATGG - Intergenic
1160968549 19:1757361-1757383 CAGTCTCAGCTCTGGGAGTCTGG + Intronic
1162737275 19:12753641-12753663 CAGTGTCTGTTGTGTTATTAGGG + Intronic
1163886624 19:19971207-19971229 CAGCATCAGCTGTGGTAATATGG + Intergenic
1163950122 19:20576490-20576512 GAGCATCAGCTGTCGTAGTATGG + Intronic
1166604221 19:44126545-44126567 GAGCATCAGCTGTGGTAGTATGG + Intronic
1167007035 19:46782782-46782804 CAGTGCCAGCTTGGGGAGTAGGG + Intronic
1167879504 19:52444506-52444528 GAGCATCAGCTGTGGTAGTATGG + Intronic
925343348 2:3151643-3151665 GAGCATCAGCTGTGGTAGTATGG - Intergenic
925479102 2:4250711-4250733 AAGCATCAGCTGTAGTAGTACGG - Intergenic
926915969 2:17892928-17892950 CACTTTCAGCTGTGCTAGTATGG + Intronic
930486473 2:52017640-52017662 AAGCATCAGCTGTGGCAGTATGG + Intergenic
931547908 2:63409034-63409056 GAGCATCAGCTGTGGTATTATGG - Intronic
932270407 2:70403933-70403955 GAGTATCAGCTGTGGTAGTATGG - Intergenic
932384864 2:71323178-71323200 GAGCATCAGCTGTGGTAGTATGG + Intronic
932954603 2:76337150-76337172 GAGCATCAGCTGTGGTAGTCTGG + Intergenic
933187313 2:79292233-79292255 CAGTGTTGGCTGTGGCAGTGAGG + Intronic
933619019 2:84515844-84515866 CAGGGTCTGCTTTGGTAGAAGGG + Intergenic
934310691 2:91860147-91860169 CAGTGACAGCTGGGGTGGAAAGG + Intergenic
935556324 2:104513336-104513358 CAGCATCAGCTGTGGAGGTATGG + Intergenic
936554947 2:113488000-113488022 GAGTGTCAGTTGTGGTAGTATGG - Intronic
937521825 2:122721128-122721150 GAGCATCAGCTGTGGTAGTATGG - Intergenic
937723023 2:125126055-125126077 AAGCATCAGCTGTGGTAGTATGG + Intergenic
937767592 2:125679997-125680019 CAGCATCAGCTCTGGTAGTATGG + Intergenic
939745031 2:145957806-145957828 GAGTATCAGCTGCGGTAGTATGG + Intergenic
939769594 2:146299016-146299038 AAGCATCAGCTGTGGTAGTATGG - Intergenic
939957506 2:148539345-148539367 CAGTGTCAGCTGGTGCAGTGTGG - Intergenic
940172334 2:150842873-150842895 AAGCATCAGCTGTAGTAGTATGG + Intergenic
941627471 2:167845229-167845251 GAGCACCAGCTGTGGTAGTATGG - Intergenic
941631586 2:167890961-167890983 GAGTATCAGCTGTGGTAGTATGG + Intergenic
941992184 2:171568267-171568289 CACTGTCACCTGTGGTAACATGG - Intergenic
942529590 2:176895129-176895151 CACTGTCAGCTGTTGAAATATGG - Intergenic
944432044 2:199644546-199644568 GAGCATCAGCTGTGGTAGTAAGG + Intergenic
944602152 2:201313697-201313719 CAGCATCAGCTGTGGTAGTATGG - Intronic
945127063 2:206524375-206524397 CAGTGTAAGTTGTGGAAGTCAGG - Intronic
945285622 2:208078488-208078510 CAACTTCAGCTGCGGTAGTATGG - Intergenic
945482547 2:210360674-210360696 GAGCATCAGCTGTGGTAGTATGG + Intergenic
946761166 2:222994549-222994571 CAGTGTCAGCTGATGAAATAAGG + Intergenic
947457044 2:230264972-230264994 GAGCATCAGCTGTGGTATTATGG + Intronic
948005363 2:234603796-234603818 CAGAGTCAGCTATGGAAGCAGGG + Intergenic
948714013 2:239847264-239847286 GAGCATCAGCTGTGGTAGTATGG - Intergenic
948885546 2:240881057-240881079 CAGTGTCAGCTTTTGTATTTAGG + Intergenic
1169401352 20:5283124-5283146 GAGCATCAGCTGTGGTAGTATGG - Intergenic
1169655565 20:7918921-7918943 CAGTGTCTGCTTTGGGAGCAGGG - Intronic
1170245729 20:14220035-14220057 GAGCATCAGCTGTGGTATTATGG + Intronic
1170720982 20:18879138-18879160 GAGCATCAGCTGTGGTAGTATGG + Intergenic
1171060775 20:21957082-21957104 CAGTGTCAGCAGCTGTAGGAAGG + Intergenic
1172517444 20:35544761-35544783 CAATGGCAGCTGTGGCAGAAGGG + Intronic
1173317049 20:41954507-41954529 CAGTGACAGTGGTGGTATTAGGG + Intergenic
1177140551 21:17353252-17353274 GAGCATCAGCTGTGGTAGTATGG - Intergenic
1177195547 21:17900695-17900717 GAGCATCAGCTGTGGTAGTGTGG + Intergenic
1178059414 21:28835130-28835152 CAGCATTAGCTGTAGTAGTATGG - Intergenic
1178801714 21:35801552-35801574 GAGCATCAGCTGTGGTAGTGTGG - Intronic
1178921060 21:36738587-36738609 AAGTGGCAGCTGTGGGAGGAGGG - Intronic
1179053706 21:37913129-37913151 CAGTGACAGTTGTGGTGGTGGGG + Intronic
1179084164 21:38202986-38203008 GATCATCAGCTGTGGTAGTATGG + Intronic
1180250734 21:46585701-46585723 CAGCATCAGCTGTGGTAGTATGG - Intergenic
1180537443 22:16406080-16406102 CAGTGGCAGCTGGGGTGGAATGG + Intergenic
1181454372 22:23047975-23047997 CAGCATCAGCTGTGGTAGTATGG - Intergenic
1184288093 22:43483321-43483343 CAGTGACAGCTGGGGGAGTGGGG - Intronic
949814295 3:8041278-8041300 GAGCATCAGCTGTGGTAGTATGG - Intergenic
950603518 3:14057627-14057649 GACCATCAGCTGTGGTAGTATGG + Intronic
950865763 3:16187978-16188000 CAGTGTCAGATGTGGGAACAAGG + Intronic
953723920 3:45381397-45381419 GAGCATCAGCTGTGGTAGTATGG + Intergenic
955461586 3:59189511-59189533 GAGCATCAGCGGTGGTAGTATGG + Intergenic
956950300 3:74274289-74274311 GAGCATCAGCTGTGGTAGTATGG - Intronic
957016364 3:75069308-75069330 GAGAATCATCTGTGGTAGTATGG + Intergenic
957628174 3:82681664-82681686 TAGTGACAGCTGAGTTAGTAAGG - Intergenic
958013842 3:87914829-87914851 GAGCATCAGCTGTGGTAGTATGG - Intergenic
958480752 3:94643259-94643281 GAGCTTCAGCTGTGGTAGTATGG + Intergenic
958505643 3:94973776-94973798 AAGCATCAGCTGTGGTAGTATGG - Intergenic
958771278 3:98428736-98428758 ATGTGCCAGCTATGGTAGTAAGG - Intergenic
959279809 3:104323614-104323636 GAGCATCAGCTGTGTTAGTATGG - Intergenic
959715703 3:109430960-109430982 GAGCATTAGCTGTGGTAGTATGG + Intergenic
959875203 3:111373815-111373837 GAGCATCAGCTGTGGTAGTATGG - Intronic
959997310 3:112693611-112693633 GAGTATCAACTGTGGTAGTATGG - Intergenic
960516574 3:118608465-118608487 GTGTATCAGCTGTGTTAGTATGG - Intergenic
960786124 3:121373996-121374018 AGGTGTCAGTGGTGGTAGTATGG - Intronic
961820368 3:129572740-129572762 CAGGGGCAGCTGTGGGAGGAAGG + Exonic
962065983 3:131981197-131981219 GAGCATCAGCTGTGGTAGAATGG + Intronic
962401813 3:135067195-135067217 GAGCATCAGCTGTGGTAGTATGG + Intronic
962883752 3:139603659-139603681 TAGTGGCAGCGGTGGTAATATGG - Intronic
963753848 3:149212541-149212563 CAGTTTCAGCTTTGATAATAGGG + Exonic
964601221 3:158503392-158503414 GAGCATCAGCTGTGGTAGTATGG + Intronic
964643861 3:158937119-158937141 CAGCATCAGCTGTGGTAGTATGG - Intergenic
965061009 3:163786230-163786252 GAGCATCAGCTGTGGTAGTGTGG + Intergenic
966020386 3:175202624-175202646 GAGCATCAGCTGTGGTAGTATGG + Intronic
967528187 3:190518169-190518191 CTGTAGCAGCTGTGGTAGTGTGG + Intronic
970088984 4:12381820-12381842 CAATGTCAGCTGTGAAAATAAGG + Intergenic
970549283 4:17163427-17163449 GAGCATCAGCTGTGGTAGTATGG + Intergenic
970996127 4:22269105-22269127 GAGCATCAGCTGTGGTAGTATGG - Intergenic
972043118 4:34629142-34629164 CAATGTCACCTGTGGGAATATGG - Intergenic
972048852 4:34702765-34702787 GAGTATCAGCTGTGGTAGTATGG - Intergenic
972180406 4:36457826-36457848 CATTCTCAGGTGTGGTAGGAGGG - Intergenic
972189043 4:36568447-36568469 CAGCATCAGCTGTGGTAGTATGG + Intergenic
973831528 4:54764664-54764686 GAATATCAGCTGTGGTAGTATGG + Intergenic
974474409 4:62361403-62361425 GAGCATCAGATGTGGTAGTATGG + Intergenic
975951049 4:79771824-79771846 GAGCCTCAGCTGTGGTAGTATGG - Intergenic
976556231 4:86453749-86453771 GAGCATCAGCTGTGGTAGTATGG - Intronic
976856515 4:89610409-89610431 GAGCATCAGCTGTGGTATTATGG - Intergenic
976916104 4:90376423-90376445 CAGGCTCAGCTTTGGAAGTAAGG - Intronic
977826889 4:101543029-101543051 CAGTGTCTCCTGAGGTAGTGTGG - Intronic
977943851 4:102888098-102888120 CAGTGACAGCTGGGGTGGAATGG + Exonic
978726654 4:111977439-111977461 GAGCATCAGCTGTGGTATTATGG + Intergenic
979498397 4:121411175-121411197 GAGCATCAGTTGTGGTAGTATGG + Intergenic
979995508 4:127426355-127426377 AAGCATCAGCTGTAGTAGTATGG - Intergenic
980392057 4:132159536-132159558 AAGCATCAGCTATGGTAGTATGG + Intergenic
980523558 4:133961047-133961069 GAGCATCAGCTGTGGTAGTAAGG - Intergenic
981346676 4:143684142-143684164 GAGCATCAGCTGTGGTAGTATGG - Intronic
981400945 4:144313409-144313431 GAGCATCAGCTGTGGTAGTATGG + Intergenic
982491780 4:156038880-156038902 GAGCAGCAGCTGTGGTAGTATGG - Intergenic
982680113 4:158418895-158418917 GACCATCAGCTGTGGTAGTATGG + Intronic
983544901 4:168952921-168952943 GGGCATCAGCTGTGGTAGTATGG + Intronic
984527518 4:180875287-180875309 AAGCATCAGCTGTGGTAGTGTGG + Intergenic
984721727 4:182978594-182978616 GAGCATCAGCTGTGGTAGTATGG - Intergenic
985217717 4:187671743-187671765 GAGCATCAGCTGTGGTAGTGTGG + Intergenic
986870266 5:12036951-12036973 GAGCATCAGCTGTGGTAGTATGG - Intergenic
987577762 5:19752664-19752686 GAGCATCAGCTGTGTTAGTATGG - Intronic
988344643 5:30021259-30021281 GAGCATCAACTGTGGTAGTATGG - Intergenic
990572816 5:57095571-57095593 GAGCATCAGCTGTGGTAGTATGG - Intergenic
990776188 5:59308766-59308788 GAGCATCAGCTGTGGTAGTATGG + Intronic
990891164 5:60651800-60651822 AACTGTCACCTGTGGTAATAGGG + Intronic
991117413 5:62970196-62970218 GAGCATCAGCTGTGGTAGTATGG - Intergenic
991923914 5:71684561-71684583 GAGCATCAGCTGTGGTAGTATGG - Intergenic
993145770 5:84091614-84091636 CAGTGTCTGCTGTGGACATAAGG + Intronic
993964802 5:94347288-94347310 GAGCATCAGCTGTGGTATTACGG - Intronic
994051270 5:95365490-95365512 GAGCATCAGCTGTGGTAGTATGG + Intergenic
994222148 5:97208519-97208541 GAGCCTCAGCTGTGGTAGTATGG + Intergenic
994568340 5:101482771-101482793 GAGTATCAGCTGTGGTAGTATGG + Intergenic
994875343 5:105414133-105414155 GAACATCAGCTGTGGTAGTATGG - Intergenic
994883541 5:105529097-105529119 GAGCATCAGCTATGGTAGTATGG + Intergenic
995472972 5:112523128-112523150 GAGCATCAGCTGTGGTATTATGG + Intergenic
995694563 5:114865367-114865389 AAGCATCAGCTGTGGTAGTATGG + Intergenic
996008443 5:118452091-118452113 CATTGTCAGTTGTGTTAGTCAGG - Intergenic
996010790 5:118479329-118479351 GAGCATCAGCTATGGTAGTATGG - Intergenic
996080847 5:119256186-119256208 GAGCATCAGCTGTGGTAGTATGG - Intergenic
996124111 5:119705945-119705967 GAGTATCAGCTGTAGTAGTATGG + Intergenic
996325442 5:122267667-122267689 AAGCATCAGCTGTGGTATTATGG - Intergenic
998509295 5:142697989-142698011 CAGTGTCAGCTGCACTTGTAGGG - Exonic
998777447 5:145618687-145618709 GAGCATCAGCTGTGGTAGCATGG + Intronic
998820250 5:146051466-146051488 AAGTGTTAGCTGTGGAGGTAGGG + Intronic
998924828 5:147111023-147111045 CAGTTTCTGCTTTGGTACTATGG + Intergenic
999484779 5:151984831-151984853 GAGCATCAGCTGTGGTAGTTTGG + Intergenic
999677123 5:154015261-154015283 AAGCATCAGCTGTGGTAGTATGG - Intronic
1000757879 5:165183969-165183991 GAGCATCAACTGTGGTAGTATGG + Intergenic
1001166664 5:169374701-169374723 GAGCCTCAGCTATGGTAGTATGG - Intergenic
1001695770 5:173668590-173668612 CAGCGTCTGCTGTGGTGGTCAGG + Intergenic
1001733729 5:173981409-173981431 CAGCATCAGCTGTAGTAGTATGG + Intronic
1002866988 6:1130420-1130442 GTGGGTCAGCTGTGGAAGTAGGG + Intergenic
1003578816 6:7320993-7321015 CACTGACAGCAGTGGGAGTAAGG + Intronic
1007529288 6:42526683-42526705 CAGTGAGAGCTGTGGTAGTTTGG + Intergenic
1008256167 6:49302982-49303004 GAGCATCAGCTGTGGTAGTATGG - Intergenic
1008290090 6:49704972-49704994 CAGTGTAAGCTGTGGTAGTATGG + Intronic
1008528582 6:52433682-52433704 TAGCATTAGCTGTGGTAGTATGG + Intronic
1008559883 6:52713448-52713470 CTGTGTCAGCTGGGGAAGAAAGG + Intergenic
1009798550 6:68503080-68503102 GAGCATCAGCTGTGGTAGTATGG - Intergenic
1009968814 6:70604844-70604866 AAGCATCAGCTGTGGTAGTATGG - Intergenic
1010076335 6:71803216-71803238 GAGTATTAGCTGTGGTAGTATGG + Intergenic
1010633639 6:78230838-78230860 GAGCATCAGCTATGGTAGTATGG + Intergenic
1010707730 6:79134877-79134899 GAGGGTCAGCTATGGTAGTATGG + Intergenic
1011093477 6:83633382-83633404 CAGTGTCAGCTGTGGTAGTATGG + Intronic
1011133109 6:84072580-84072602 GAGCATCAGCTGTGGTAGTTTGG + Intronic
1011168661 6:84479635-84479657 GAGGATCAGCTATGGTAGTATGG - Intergenic
1011893269 6:92193916-92193938 CAGCATCAGCTGTGGTAGTATGG + Intergenic
1012225112 6:96694545-96694567 GAGCATCAGCTGTGGTAGTATGG - Intergenic
1012793776 6:103734537-103734559 CAGCATCAACTGTAGTAGTATGG - Intergenic
1013571530 6:111431287-111431309 CTGTGTCAGGTGTCCTAGTATGG - Intronic
1013852601 6:114534447-114534469 GAGCATCAGCTGTGGTATTATGG + Intergenic
1014336864 6:120147643-120147665 AAGCATCAGCTGTGGTATTATGG - Intergenic
1015663276 6:135600247-135600269 GAGCATCAGCTGTAGTAGTATGG + Intergenic
1015849755 6:137559968-137559990 GAGCATCAGCTGTGCTAGTATGG + Intergenic
1016289980 6:142518434-142518456 CAGCATCAGCTCTGGTAGTATGG + Intergenic
1017190446 6:151648196-151648218 CAGCATCAGCTATGGTAGTGTGG + Intergenic
1018009445 6:159655925-159655947 GAGCGTCAGCGGTGGTAGTATGG - Intergenic
1018168716 6:161126801-161126823 GCGTATCAGCTGTGGTGGTATGG + Intergenic
1018168722 6:161126836-161126858 GCGTATCAGCTGTGGTGGTATGG + Intergenic
1018910177 6:168097236-168097258 CAGTGTGAGCTGTGTTATAATGG - Intergenic
1020373732 7:7461876-7461898 GAGCATCAGTTGTGGTAGTATGG - Intronic
1020634939 7:10685181-10685203 GAGCATCAGCTGTGGTAGCATGG - Intergenic
1020941266 7:14541205-14541227 AAGTGGCAGCTGTAGTATTATGG + Intronic
1022894829 7:34739910-34739932 GAGCATCAGCTGTGGTAGTATGG + Intronic
1022943369 7:35259411-35259433 CAGAGTCAGCTGTTTTTGTAAGG + Intergenic
1023892793 7:44405356-44405378 GACTGGCAGCTGTGGGAGTAGGG + Intronic
1024037123 7:45516633-45516655 CAGTGTCAGAAGTGGTAGGAAGG + Intergenic
1024251327 7:47507846-47507868 CAGGGACAGCTGTGGGAGGAGGG + Intronic
1024545522 7:50513959-50513981 GAGCATCAGCTGTAGTAGTATGG - Intronic
1024917193 7:54515069-54515091 AAGCATCACCTGTGGTAGTATGG + Intergenic
1025610686 7:63073374-63073396 CAGGCTCAGCTGTGGTGGGAGGG + Intergenic
1027699254 7:81449526-81449548 GAGCCTCAGCTATGGTAGTATGG - Intergenic
1027963825 7:84980849-84980871 AAGCATCAGCTGTGGTAGGATGG + Intergenic
1028182924 7:87747488-87747510 GAGCATCAGCTGTGGTAGTATGG + Intronic
1028638919 7:93021677-93021699 CAGGGTCAACTGTGTTAGAAAGG + Intergenic
1028962200 7:96761660-96761682 GAGCATCAACTGTGGTAGTACGG + Intergenic
1029400984 7:100345983-100346005 CAGTGTCACCTGGAGTAATAAGG - Intronic
1030325242 7:108211889-108211911 GAGTATCAGTTCTGGTAGTATGG - Intronic
1030390417 7:108920852-108920874 GAGCATCAGCTGTGGTAGTATGG + Intergenic
1030416724 7:109253566-109253588 CAGGGTTAGCTGTTGTATTAGGG + Intergenic
1031138898 7:117919395-117919417 GAGCATCAGCTGCGGTAGTATGG - Intergenic
1031879257 7:127177484-127177506 AAGCATCAGCTGTAGTAGTATGG - Intronic
1032893081 7:136220713-136220735 CATTGTCACCTGTGGTAATGCGG + Intergenic
1032931553 7:136678099-136678121 GAGCATCAGCTGTGTTAGTATGG - Intergenic
1034699298 7:153082783-153082805 CAGTGGTAGCTGTGGTAGTTTGG + Intergenic
1034969098 7:155408335-155408357 GAGTGTCAGGTGTGGGAGTGTGG + Intergenic
1037684810 8:21129728-21129750 CAATGTCAGGTGTGGTAGCCAGG + Intergenic
1038367172 8:26948252-26948274 GAGCATCAGCTGTGGTGGTATGG + Intergenic
1039309897 8:36305931-36305953 CATTGTCAGCTGTGGCATCAGGG + Intergenic
1039641499 8:39227815-39227837 GAGCATCAGCTGTGGTAGTATGG - Intronic
1040635636 8:49270297-49270319 GAGCATCAGCTGTGGTAGTATGG + Intergenic
1041200649 8:55450175-55450197 CGGGGGCAGCTGTGGTAGCAGGG + Intronic
1041364208 8:57083762-57083784 GAGCATCAGCTGTGGTAGTATGG - Intergenic
1041570513 8:59332927-59332949 GAGCATCAGCTGTGGTAGTATGG + Intergenic
1041877949 8:62712242-62712264 GAATATCAGCTATGGTAGTATGG + Intronic
1043040824 8:75259816-75259838 GAGCATCAGCTGTGGTAGTATGG - Intergenic
1043048088 8:75352574-75352596 GAGCATCAGCTGTGGTAATACGG - Intergenic
1043816846 8:84812435-84812457 GAGCATCAGCTGTGGTAGTATGG + Intronic
1044227643 8:89737156-89737178 GGGCATCAGCTGTGGTAGTATGG - Intergenic
1045994224 8:108343480-108343502 GAGCATCAGCTGTGGTAATATGG - Intronic
1046074450 8:109299738-109299760 GAGCATCAGCTGTGGTAGTATGG - Intronic
1049898059 9:129184-129206 GAGTGTCAGTTGTGGTAGTATGG + Intronic
1050394617 9:5182124-5182146 CAGTGTTATCTGTAGTGGTAGGG + Intronic
1052537172 9:29761770-29761792 GAGCATCAGCTGTGGTAGTATGG - Intergenic
1052894627 9:33735423-33735445 GAGCATCAGCTATGGTAGTATGG - Intergenic
1052896620 9:33753105-33753127 CAGAGGCAGCTGTGGTATTCTGG - Intronic
1053741137 9:41139482-41139504 GAGTGTCAGTTGTGGTAGTATGG + Intronic
1054346347 9:63968971-63968993 GAGTGTCAGTTGTGGTAGTATGG + Intergenic
1054444123 9:65295621-65295643 GAGTGTCAGTTGTGGTAGTATGG + Intergenic
1054486149 9:65725884-65725906 GAGTGTCAGTTGTGGTAGTATGG - Intronic
1054687212 9:68291815-68291837 GAGTGTCAGTTGTGGTAGTATGG - Intronic
1055110836 9:72557671-72557693 CAGGGACAGCAGTGGGAGTAGGG + Intronic
1055124440 9:72702919-72702941 CAGTGTCTGCTTTCGTACTAAGG - Intronic
1055500931 9:76901798-76901820 CAGTGACAGCTGTGGAAGAAGGG - Intronic
1056684284 9:88746843-88746865 CAGCATTAGCTGTGGTAGAAGGG - Intergenic
1056699009 9:88886916-88886938 AAGCATCAGCTGTAGTAGTATGG + Intergenic
1056762297 9:89424188-89424210 CAGTCTCATCTCTGGTGGTAGGG - Intronic
1057003861 9:91538198-91538220 AAGCATCAGCTGTGGTAGTGTGG - Intergenic
1058085004 9:100739574-100739596 AAGCATCAGCTGTGGTAGTGTGG + Intergenic
1060239764 9:121892862-121892884 CAGTGTCAGGTCTGGCAGTCAGG + Intronic
1062527003 9:136981971-136981993 CAGTGGCAGCTGAGGGGGTATGG - Intronic
1062580194 9:137225985-137226007 CAGTGGCAGCAGTGGCAGCAGGG - Exonic
1188045864 X:25425949-25425971 GAGCATAAGCTGTGGTAGTATGG + Intergenic
1188444242 X:30240011-30240033 GAGTGGCAGCTGTGGTAGACAGG - Intergenic
1188600433 X:31956995-31957017 CAGTGTCTGCAGTGGTAGAGTGG + Intronic
1189603216 X:42648966-42648988 GAGCATCAGCTGTGGTAGTATGG - Intergenic
1189938720 X:46098225-46098247 CATTGTCAGCACTGGTAGAAAGG + Intergenic
1189946082 X:46180309-46180331 CTGTGGCTGCTGTGGGAGTAGGG + Intergenic
1191080679 X:56506254-56506276 CAGCATCAGCTGTGGTAGTATGG - Intergenic
1191679557 X:63826687-63826709 GAGCATCAGTTGTGGTAGTATGG + Intergenic
1191692357 X:63953157-63953179 CAGCATCAGCTATGGTAGTATGG - Intergenic
1191718278 X:64207699-64207721 CAGTCTCAGTTGTGGAAGCAGGG + Intergenic
1191954164 X:66625650-66625672 GAGCATCAGCTTTGGTAGTATGG - Intronic
1191965220 X:66750662-66750684 GAGTATCAGCTGTGTTATTATGG + Intergenic
1192069032 X:67917920-67917942 GAGCATCAGCTGTGGTAGTATGG + Intergenic
1192929613 X:75792055-75792077 GAGCATCAGCTGTGGTACTATGG - Intergenic
1192968150 X:76202184-76202206 GAGCATCAGCTGTGGTAGTATGG + Intergenic
1192982962 X:76366848-76366870 CAGTGGCAGCAGTGGCAGCATGG + Intergenic
1193389891 X:80913948-80913970 AAGCATCAGCTGTGGTAGTATGG + Intergenic
1193423725 X:81315976-81315998 GAGCATCAGCTGTAGTAGTATGG + Intergenic
1193749586 X:85326252-85326274 CAGTGGCAGCGGTGGCAGCATGG + Intronic
1193785976 X:85760338-85760360 GAGCATCAGCTGTGGCAGTATGG + Intergenic
1193937659 X:87642027-87642049 AAGCATCAGCTATGGTAGTATGG - Intronic
1194466177 X:94237520-94237542 GAGCATCAGCTGTGGTAGTATGG + Intergenic
1194701459 X:97119558-97119580 GAGCATCAGCTGTGGTAGTATGG + Intronic
1194972907 X:100363816-100363838 AAGTGTCTGCTGTGGTAGATGGG - Intronic
1195075913 X:101326861-101326883 GAGCATCAGCTGTGATAGTATGG - Intergenic
1195624727 X:106996336-106996358 CAGGGTCAGCTGGAGCAGTAGGG + Intronic
1195795491 X:108642373-108642395 AAGCATCAGCTGTGGTAGTATGG - Intronic
1195838179 X:109143329-109143351 GAGCATCAGCTGCGGTAGTATGG - Intergenic
1196170926 X:112587742-112587764 GAGCATCAGCTGTGGTAGTATGG - Intergenic
1196948237 X:120850095-120850117 GAGCATCAGCTGTGGTAGCATGG + Intergenic
1197463445 X:126771807-126771829 GAGCATCAGCTGTGGTAGTATGG - Intergenic
1197476272 X:126929448-126929470 AATTATCAGCTGTGTTAGTATGG + Intergenic
1197518946 X:127473311-127473333 GAGCATCACCTGTGGTAGTATGG - Intergenic
1197559637 X:128001818-128001840 CACTGTCACCTGAGGTACTATGG - Intergenic
1197664576 X:129210248-129210270 GAGCATCAGGTGTGGTAGTATGG + Intergenic
1197669049 X:129255734-129255756 AAGCATCAGCTGTGGTAGTATGG + Intergenic
1199057823 X:143318913-143318935 GAGCATCAGCTGTGGTAGTATGG + Intergenic
1199668563 X:150121422-150121444 GAGCATCAGCTGTGCTAGTATGG - Intergenic
1201315834 Y:12644344-12644366 GAGCATCAGCTGTGATAGTATGG - Intergenic
1201408483 Y:13673330-13673352 GAGCATCAGCTGTGGTAGTATGG - Intergenic