ID: 1011095776

View in Genome Browser
Species Human (GRCh38)
Location 6:83660279-83660301
Sequence CTCTCGTGAGAAGAGGGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 236}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011095772_1011095776 18 Left 1011095772 6:83660238-83660260 CCATGTAAGAAGTTAGAGGAAGG 0: 1
1: 0
2: 0
3: 13
4: 207
Right 1011095776 6:83660279-83660301 CTCTCGTGAGAAGAGGGTGAAGG 0: 1
1: 0
2: 1
3: 16
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011095776 Original CRISPR CTCTCGTGAGAAGAGGGTGA AGG Intronic
901299599 1:8189803-8189825 CTCTCCTGGCAAGATGGTGAAGG + Intergenic
902107563 1:14050573-14050595 CTCTCGTGAGAACAGCATGGAGG + Intergenic
904249203 1:29210618-29210640 GTCTCTTGAGAAGAGGATTAGGG - Intronic
904576846 1:31510332-31510354 CTCTCTTGAGCAGTGGTTGAAGG + Intergenic
904975449 1:34452565-34452587 CTCTGGGGAGAAATGGGTGAGGG + Intergenic
905415972 1:37804440-37804462 AACTCCTGAGAAGAGGGAGAAGG + Exonic
907785726 1:57610753-57610775 CTATCATGAGAAGAGCATGAGGG + Intronic
909528789 1:76658264-76658286 CTCTCGTGAGAACAGCATGAGGG + Intergenic
910139087 1:84006759-84006781 CTATCATGAGAAGAGCGTGGAGG + Intergenic
912614445 1:111084061-111084083 CTATCATGAGAACAGCGTGAAGG - Intergenic
915979112 1:160409094-160409116 CCCTGGTGAGAAGAGGGGGCAGG + Intronic
916314012 1:163427519-163427541 CTCTCCTGGGAGGAGGGGGAGGG - Intergenic
916463213 1:165047739-165047761 CTGAAGTGGGAAGAGGGTGAGGG - Intergenic
916801505 1:168220665-168220687 CTATCGTGAGAACAGTGTAAGGG + Intergenic
917424630 1:174901471-174901493 CTGTCATGAGAACAGGATGAGGG + Intronic
918242374 1:182631993-182632015 CTCTCATGAGAAGAATGAGAAGG - Intergenic
918242487 1:182633091-182633113 CTCTCATGAGAAGAATGAGAAGG - Intergenic
921326319 1:213988889-213988911 CTCTCCTGAGAAGAGAGAGCAGG - Intronic
923846083 1:237734365-237734387 CTATCGTGAGAACAGCATGAGGG + Intronic
924325234 1:242889058-242889080 CTCTGGGGACAAGAGGGTCAGGG + Intergenic
1065096410 10:22285108-22285130 GTCTGGGGAGAAGAGGATGAGGG - Intergenic
1069565161 10:69459065-69459087 GTCTGGTCAGAAGAGGTTGATGG + Intronic
1070922439 10:80196588-80196610 CTCTACTGAGAAGGGGGTGGGGG + Intronic
1071601105 10:86959150-86959172 CTCCCGTGTGGAGAGGGTGGGGG - Intronic
1071828598 10:89350195-89350217 CTCTGGTGTGAAGAGACTGATGG + Intronic
1074481767 10:113828843-113828865 CTATCATGAGAACAGGATGAGGG + Intergenic
1075152819 10:119949908-119949930 CTCTCATGAGAACAGCATGAGGG - Intergenic
1075678493 10:124314826-124314848 CTATCATGAGAACAGGGTGGGGG - Intergenic
1076696572 10:132250094-132250116 CTCTCATGAGAGGAGTTTGATGG - Intronic
1077080535 11:722842-722864 CTCTGGTGAGGAGTGGGTGTTGG - Intronic
1077230532 11:1456511-1456533 CTCACCTGAGAGCAGGGTGAAGG - Exonic
1079942681 11:26701146-26701168 CTGTAGTGAGAAAATGGTGAGGG - Intronic
1081679084 11:44989256-44989278 CTCTGATGAGAAGATGGTAAAGG + Intergenic
1084379023 11:68798787-68798809 CTCTCCGGGGAAGAGGGAGAGGG + Intronic
1089316558 11:117595115-117595137 CTCTGAAGAGATGAGGGTGAGGG + Intronic
1090389656 11:126380809-126380831 CTCTGGAGAGAAGAGGGTGGAGG - Intronic
1092177359 12:6419396-6419418 CAGTCTTGAGAAGTGGGTGAGGG - Intergenic
1094221481 12:27998286-27998308 CTATCATGAGAACAGGATGAGGG - Intergenic
1096540996 12:52307077-52307099 CCCTGGGGAGAGGAGGGTGAAGG + Intronic
1097476221 12:60058822-60058844 CTCTCATGAGAAAAGCATGAGGG - Intergenic
1099076452 12:78114581-78114603 CTCTCTTGAGAACAGCATGAGGG + Intronic
1105584386 13:21730552-21730574 CTCTGGTGAGAAGAGGTAAAAGG + Intergenic
1107550621 13:41471331-41471353 CTCTGGTGTGAAGAGTTTGACGG + Intergenic
1110833053 13:80053692-80053714 CTCTCATGAGAACAGTATGAGGG + Intergenic
1111607664 13:90561791-90561813 CTCTCTTGGGAAGAAGGGGAAGG + Intergenic
1115705349 14:35992936-35992958 CTCTCATGAGATGATGGTTAAGG + Intergenic
1115715185 14:36095547-36095569 TTCCTGGGAGAAGAGGGTGAGGG - Intergenic
1117344594 14:54819907-54819929 CTCTGGTGAGAACAGGGTAAGGG - Intergenic
1118322492 14:64761471-64761493 CTCTTATGAGAAGTGGGTTAGGG + Intronic
1119549298 14:75496772-75496794 CTCCCTGGAGAAGAGGGTTAGGG - Intergenic
1120384218 14:83823719-83823741 CTCTGGTGAGAAGAGGAAGAGGG - Intergenic
1125726681 15:41871764-41871786 CCCTGGTGAGAAGAGGGCCAGGG - Exonic
1127292424 15:57582306-57582328 CTCCCATTAGAGGAGGGTGATGG + Intergenic
1129119584 15:73387997-73388019 CTCTGGTGGGAAGAGGGGCAAGG + Intergenic
1130546432 15:84860051-84860073 ATCTCCAGAGAAGAAGGTGAAGG + Exonic
1131394673 15:92077122-92077144 CTATCGTGAGAACAGCATGAGGG + Intronic
1132038869 15:98507901-98507923 TGCTCGTGAAAACAGGGTGAGGG + Intronic
1133450273 16:5898195-5898217 CTCTCATGAGAACAGCATGAGGG + Intergenic
1133983892 16:10653267-10653289 CTCTGGTGGGAAGAGGGTGGTGG + Intronic
1135019431 16:18951191-18951213 CTCTCTAGAGCAGAGGGTGATGG + Intergenic
1136135673 16:28255562-28255584 CTGTCATCAGAAGAGGGTCAGGG + Intergenic
1137561613 16:49506019-49506041 CTCTGGTGAGATGAGTGGGATGG - Intronic
1138190306 16:55009069-55009091 GTCTCTGGAGAAGAGGGTGTAGG - Intergenic
1140848079 16:78908654-78908676 ATTTAGTGAGAAGAGGGTCAGGG + Intronic
1141301753 16:82822578-82822600 ATCTCTTGAGCAGAAGGTGAAGG - Intronic
1141312434 16:82927468-82927490 CTCACGTGAGTAGAGGCTGCGGG + Intronic
1141639001 16:85330238-85330260 CTGTCCTTAGAAGAGGGTGATGG + Intergenic
1144585958 17:16487925-16487947 TTCCCATGAGAAGAGGCTGATGG - Intronic
1146710436 17:35036405-35036427 GTCTTTTAAGAAGAGGGTGAGGG - Intronic
1149478708 17:56984695-56984717 ATCTCCTGGGGAGAGGGTGATGG + Intronic
1149754930 17:59178713-59178735 CTCCCCTGAGAAGAGGCTGAAGG + Intronic
1150927972 17:69554279-69554301 CTCTCATGAGAACAGTATGAGGG + Intergenic
1150946214 17:69748824-69748846 CTATCATGAGAACAGGGTGGGGG + Intergenic
1151329867 17:73400421-73400443 ATCTGGTGAGAAATGGGTGAAGG + Intronic
1152719010 17:81913688-81913710 CTCTCGTGAGCTGAGTGTGGAGG - Intronic
1153985951 18:10351015-10351037 CTCTCCTGGGAAGAGGATGAAGG + Intergenic
1154104005 18:11504106-11504128 CACTGGTGAGATGGGGGTGAGGG + Intergenic
1158127903 18:54122290-54122312 CTGTCATGAGAACAGGATGAGGG + Intergenic
1159761435 18:72431105-72431127 CTACCGTGAGAACAGTGTGAGGG + Intergenic
1159790522 18:72773587-72773609 CTATCGTGAGAACAGGATGGGGG - Intronic
1160191008 18:76713869-76713891 CTCTCTTGTGAATAGGATGAAGG + Intergenic
1160427383 18:78787636-78787658 CTCTCGGGTGCAGAGGCTGAGGG - Intergenic
1163741823 19:19018974-19018996 CTCCAGTGAGAAGAGCATGAGGG - Intronic
1164086272 19:21905493-21905515 CTATCATGAGAAGAGCGTGGGGG + Intergenic
1164422842 19:28112239-28112261 CTATCATGAGAAGAGCATGAGGG + Intergenic
1168318001 19:55492440-55492462 CTCTGGAGAGGAGAGGGTGAAGG + Intronic
925704486 2:6670883-6670905 CTCTCATGAGAACAGCATGAGGG + Intergenic
925743735 2:7027963-7027985 GTCTGGTGAGATGAGGGTGGGGG + Intronic
927862207 2:26567267-26567289 CTCTCATGAGAACAGGATGGGGG - Intronic
928252873 2:29697254-29697276 CTCTCCAGAGAAGAGGGCCAAGG + Intronic
928736294 2:34294167-34294189 CTCTGGTGAGATAAGGGAGAAGG - Intergenic
931897925 2:66754012-66754034 CTGGGGTGGGAAGAGGGTGAGGG - Intergenic
931949699 2:67349288-67349310 CTCTCATGAGAATAGGATGAGGG + Intergenic
936895371 2:117421768-117421790 CTCTCAAGAGTAGAGGGAGAGGG - Intergenic
938585490 2:132686339-132686361 CTCAAGTGATAAGAGGGTGTTGG - Intronic
939669398 2:144991509-144991531 CTATCGTGAGAACAGCATGAGGG + Intergenic
939703148 2:145419643-145419665 CTGTCATGAGAACAGTGTGAGGG + Intergenic
940050492 2:149457604-149457626 ATCTAGTGAGAAGAGGCTGTTGG + Intronic
940760558 2:157734156-157734178 CTGTCATGAGAATAGCGTGAGGG - Intergenic
941066870 2:160913382-160913404 CTCCCATGAGAAGAGGAGGAAGG + Intergenic
942425226 2:175853122-175853144 CTCTGGTCAGCAGAGGGTGGAGG - Intergenic
942664642 2:178304447-178304469 CTCTCATGAGGACAGGATGAGGG + Intronic
945120937 2:206456308-206456330 CTCTCATGAGAACAGCATGAGGG + Intronic
945358485 2:208867059-208867081 CTCTCATGAGAACAGCATGAAGG + Intergenic
946003131 2:216499415-216499437 CTCTGGTGAGAGGAGAGGGAGGG + Intronic
946763473 2:223018826-223018848 GGCTCCAGAGAAGAGGGTGAAGG - Intergenic
946987149 2:225286245-225286267 CTCTGATGAGAAGAATGTGAGGG - Intergenic
947076333 2:226349750-226349772 CTATCAGGAGAACAGGGTGAAGG + Intergenic
947535288 2:230936359-230936381 CTATCATGAGAACAGGATGAGGG - Intronic
947813038 2:233016113-233016135 AACTCGTGAGAAGAGGGTGAAGG + Intergenic
948179263 2:235966727-235966749 TCCTCCTGCGAAGAGGGTGAAGG - Intronic
948880638 2:240855639-240855661 CACTTGGGAGAAGAGGGTGATGG + Intergenic
1170438665 20:16355617-16355639 CTTTCTTGAGAAGAGGATGGTGG + Intronic
1173474825 20:43351651-43351673 CTCTGGGAAGAAGAGGCTGAAGG + Intergenic
1173760261 20:45553617-45553639 CTCTACTGAGAACAGTGTGATGG - Intronic
1174104311 20:48151364-48151386 CTCTCCTGGGCAGAGGTTGAGGG + Intergenic
1175204830 20:57303435-57303457 CTATCATGAGAAGAGCATGAGGG - Intergenic
1175430926 20:58902550-58902572 CTCTGGTAAGTAGAGGTTGAAGG - Intronic
1176929414 21:14790246-14790268 CTCTCATGAGAACAGTATGAGGG + Intergenic
1177748404 21:25250360-25250382 CTATCGTGAGAACAGCGTGGGGG - Intergenic
1177854339 21:26384374-26384396 CTGTCATGAGAACAGGATGAAGG - Intergenic
1179297777 21:40078862-40078884 CTCTAGTGTGAAGGAGGTGATGG + Exonic
1180406523 22:12560796-12560818 CTCTCATGAGAACAGGATGGGGG + Intergenic
1181685675 22:24526153-24526175 CACCAGTGGGAAGAGGGTGAGGG + Exonic
1183088757 22:35506756-35506778 CTCTGGAGAGAAGAGGTTGCCGG + Intergenic
1183815897 22:40299889-40299911 CACTCCTGAGAACAGGGAGAAGG + Intronic
1183969789 22:41468423-41468445 CTCTGATGAGAAGAGGGCGGGGG - Intronic
949733435 3:7142519-7142541 CTATCACAAGAAGAGGGTGAGGG + Intronic
950535498 3:13575916-13575938 CTCTGCTGAGAATAGGGAGATGG + Intronic
950730126 3:14948757-14948779 CTCTCGTGGGAAGAGGTTTTCGG + Intronic
952104903 3:30057946-30057968 CTCTCATGAGAATAGCATGAGGG - Intergenic
952584789 3:34877955-34877977 CTATCATGAGAACAGCGTGAGGG - Intergenic
953581070 3:44157179-44157201 CTCTCGTGAGAAGAAATGGAAGG + Intergenic
954314411 3:49793372-49793394 CTGTGGTGAGAAGAAGTTGAGGG - Intronic
955396858 3:58563699-58563721 CTCTGTTGAGAACAGGGTGTAGG + Intergenic
957279244 3:78128432-78128454 CTATCATGAGAAGAGCATGAGGG + Intergenic
958047782 3:88305483-88305505 CTGTCCTGAGAACAGGATGAGGG - Intergenic
961556458 3:127699673-127699695 GTCTCGAGAGGAGAAGGTGAAGG + Intronic
961621576 3:128228612-128228634 CTCTGTGGAGAAGAGAGTGAGGG - Intronic
961630565 3:128295634-128295656 CTGTGGTGAGAAGATGGAGAAGG + Intronic
962471660 3:135714597-135714619 CTCATGTGAGGAGAGGCTGAGGG - Intergenic
964279743 3:155051612-155051634 CTATCATGAGAACAGTGTGAGGG + Intronic
968380778 4:94138-94160 CTATCATGAGAACAGGGTAAGGG + Intergenic
969118097 4:4886673-4886695 CTATCATGAGAACAGCGTGAAGG - Intergenic
969462044 4:7334100-7334122 GGCTCTTGAGAGGAGGGTGAGGG - Intronic
974857928 4:67482976-67482998 CTCTCATGAGAACAGCATGAGGG - Intronic
976321747 4:83724689-83724711 CTGTTGTGAGAAGGGGGTGGGGG + Intergenic
976485657 4:85600470-85600492 TCCACGTGAGAAGAGGGAGATGG + Intronic
977644943 4:99401892-99401914 CTTTAGGGAGAAGAGGGTAATGG + Intergenic
980017195 4:127663480-127663502 CTCTGGGGAGAAGAGGTTGAAGG + Exonic
983007101 4:162496595-162496617 CTCACGTGGGAAGAGGCTGTAGG - Intergenic
983665064 4:170172134-170172156 CTCTCATGAGAACAGCATGAGGG + Intergenic
983886604 4:172987379-172987401 CTATCATGAGAAGACTGTGAGGG + Intronic
983955408 4:173692218-173692240 CTATCATGAGAATAGCGTGAAGG + Intergenic
985647174 5:1090424-1090446 CCCTGGAGAGGAGAGGGTGACGG + Intronic
986196105 5:5537439-5537461 CTGTGGGGAGAAGAGGGAGATGG + Intergenic
988672880 5:33400842-33400864 CTCTCATGAGAACAGCATGAGGG - Intergenic
989817082 5:45749957-45749979 CTATCATGAGAAGAGCATGAGGG + Intergenic
989997806 5:50856340-50856362 CTGTGCTGAGCAGAGGGTGAGGG - Intergenic
991159101 5:63475292-63475314 TTTTTGTGAGAAGTGGGTGAGGG - Intergenic
992082508 5:73248352-73248374 CTATCGTGAGAAGAGCATGGGGG - Intergenic
1000274703 5:159723588-159723610 TTCTCATGAGCAGAGTGTGATGG + Intergenic
1002506296 5:179681426-179681448 CTCTCAGGAGAAGGGGGTGAGGG + Intronic
1002549297 5:179975088-179975110 GTCCCGTGGGAAGACGGTGAGGG + Intronic
1003282897 6:4709627-4709649 CCCTCTTGAGGAGAGAGTGAAGG - Intronic
1004813700 6:19288853-19288875 CTCTCATGAGAACAGTGTGGGGG + Intergenic
1005207645 6:23422703-23422725 CTACCATGAGAAGAGTGTGAGGG + Intergenic
1006349974 6:33513781-33513803 CTCTGGAGAGAATAGGGTGGAGG - Intergenic
1008036780 6:46753555-46753577 CCCTGGTGAGAAGAGGGAAAAGG + Intronic
1011041509 6:83034590-83034612 CTATCGTGAGACGGGGGAGATGG - Intronic
1011095776 6:83660279-83660301 CTCTCGTGAGAAGAGGGTGAAGG + Intronic
1013466056 6:110418009-110418031 CTCTAGGGAGAAGGGGTTGAAGG - Intergenic
1015933199 6:138382930-138382952 CACCCATGAGAAGAGGGAGAAGG + Exonic
1015983038 6:138858020-138858042 CTCTCACGAGAAGAGGATGGGGG + Intronic
1019554158 7:1620214-1620236 CTCTTGTGGGAAAGGGGTGAGGG + Intergenic
1020290635 7:6719878-6719900 CTCCCCTGAGAAGAGGCCGAAGG + Intergenic
1021787976 7:24171759-24171781 CTCTTGTGGGAAGGGGGTGTGGG + Intergenic
1023825087 7:44003649-44003671 CTCCCCTGAGAAGAGGCCGAAGG - Intronic
1023884918 7:44347911-44347933 CTCTCAAGAGAAGTGGGTGTAGG - Intergenic
1026088636 7:67282434-67282456 CTCCCCTGAGAAGAGGCCGAAGG - Intergenic
1026725613 7:72867919-72867941 CTCCCCTGAGAAGAGGCCGAAGG + Intergenic
1026747695 7:73025783-73025805 CTCCCCTGAGAAGAGGCCGAAGG + Intergenic
1026751345 7:73053922-73053944 CTCCCCTGAGAAGAGGCCGAAGG + Intergenic
1026754994 7:73082036-73082058 CTCCCCTGAGAAGAGGCCGAAGG + Intergenic
1026758646 7:73110070-73110092 CTCCCCTGAGAAGAGGCCGAAGG + Intergenic
1027033903 7:74911077-74911099 CTCCCCTGAGAAGAGGCCGAAGG + Intergenic
1027088759 7:75283415-75283437 CTCCCCTGAGAAGAGGCCGAAGG - Intergenic
1027092402 7:75311343-75311365 CTCCCCTGAGAAGAGGCCGAAGG - Intergenic
1027096045 7:75339310-75339332 CTCCCCTGAGAAGAGGCCGAAGG - Intergenic
1027118232 7:75497734-75497756 CTCCCCTGAGAAGAGGCCGAAGG - Intergenic
1027273570 7:76537734-76537756 CTCCCCTGAGAAGAGGCCGAAGG + Intergenic
1027323296 7:77028382-77028404 CTCCCCTGAGAAGAGGCCGAAGG + Intergenic
1027327017 7:77056790-77056812 CTCCCCTGAGAAGAGGCCGAAGG + Intergenic
1029397043 7:100315581-100315603 CTCCCCTGAGAAGAGGCCGAAGG - Intronic
1029622758 7:101700142-101700164 CTCCCCTAAGATGAGGGTGATGG - Intergenic
1029719263 7:102352306-102352328 CTCCCCTGAGAAGAGGCCGAAGG + Intergenic
1029728502 7:102424415-102424437 CTCCCGCGTGAAGAGGGGGAGGG + Intronic
1029753351 7:102556960-102556982 CTCCCCTGAGAAGAGGCCGAAGG - Intronic
1029771303 7:102656044-102656066 CTCCCCTGAGAAGAGGCCGAAGG - Intronic
1031302752 7:120083840-120083862 CTCTCCTGAGAGTAAGGTGATGG - Intergenic
1032949509 7:136891422-136891444 CTCTGGTTAGAATGGGGTGATGG + Intronic
1033095885 7:138430366-138430388 CTATCATGAGAACAGGGTGGGGG - Intergenic
1035629499 8:1097170-1097192 CTCTCCTGAGCAGAGGGAGCTGG - Intergenic
1035629520 8:1097260-1097282 CTCTCCTGAGCAGAGGGAGCTGG - Intergenic
1035629615 8:1097620-1097642 CTCTCCTGAGCAGAGGGAGCTGG - Intergenic
1035629636 8:1097710-1097732 CTCTCCTGAGCAGAGGGAGCTGG - Intergenic
1035629657 8:1097800-1097822 CTCTCCTGAGCAGAGGGAGGTGG - Intergenic
1036057263 8:5270099-5270121 CTCTCATGAGAACAGCATGAGGG - Intergenic
1036086862 8:5621989-5622011 CTCTCCTGAGAACAGGATGGGGG + Intergenic
1039261240 8:35774312-35774334 CTCTTGTGCGAAGAAAGTGATGG - Exonic
1039455065 8:37700597-37700619 CTCTCCTGACCAGAGGGTAAAGG + Intergenic
1039840926 8:41292357-41292379 CTCTCGTGAGAACAGCATGGGGG - Intronic
1039854271 8:41398886-41398908 CACTAGTGAGTAGAGGGAGATGG + Intergenic
1041494549 8:58470632-58470654 CTATCATGAGAACAGGATGAGGG - Intergenic
1043121191 8:76326706-76326728 CTCTGGTGAGGAGAGGGAAAGGG - Intergenic
1043211308 8:77521977-77521999 CTATCGTGAGAACAGGAAGAGGG + Intergenic
1045206120 8:100042932-100042954 CTTTCCTGACAAGAGGGAGAGGG + Intronic
1045287896 8:100807640-100807662 CTATCATGAGAACAGGATGAGGG - Intergenic
1047343134 8:124001966-124001988 CTCTCAGGAGAAGTGGGTGACGG + Intronic
1048045287 8:130767160-130767182 CTCTCATGAGAAGAGCCTGGGGG + Intergenic
1049787871 8:144459746-144459768 CTCTGGTGAGAAGAGGGGAGTGG - Intronic
1049873503 8:145000160-145000182 CTGTAGGGAGAGGAGGGTGATGG + Intergenic
1050523410 9:6525012-6525034 ATTTCGGGAGAAGAGGCTGAAGG - Intergenic
1050923448 9:11234458-11234480 GACTGGTGAGAAGAGGCTGAGGG + Intergenic
1051984387 9:23064827-23064849 CTCTCATGAGAACAGCATGAGGG + Intergenic
1056285532 9:85083872-85083894 CTCCCCTGAAAACAGGGTGAAGG - Intergenic
1056481993 9:87015428-87015450 CTATCATGAGAAGAGCATGAGGG + Intergenic
1057397891 9:94696311-94696333 TTCTGGTGAGCAGAGGGAGAAGG - Intergenic
1059027900 9:110656941-110656963 TTCTTGTGAGAAGAAGGGGAAGG - Intergenic
1060537137 9:124399516-124399538 CTCTCTTCAGAGGAGGGCGAGGG + Intronic
1186965174 X:14779192-14779214 CTCTCAGGAGAAAATGGTGAAGG - Intergenic
1187441873 X:19328041-19328063 CTCTTGTCTGGAGAGGGTGATGG + Intergenic
1188062632 X:25619277-25619299 CTATCGTGAGAACAGCATGAGGG + Intergenic
1189409889 X:40760793-40760815 CTATCATGAGAAGAGTGTGGGGG + Intergenic
1190579097 X:51873245-51873267 CTATCATGAGAACAGGGTAAGGG + Intronic
1192266310 X:69540430-69540452 CACTCTTGAGAACAGGGTGAGGG - Intergenic
1192387496 X:70686530-70686552 CTGTCGGGAGGTGAGGGTGAGGG + Intronic
1193889466 X:87027003-87027025 CTATCATGAGAACAGGATGAGGG + Intergenic
1194497334 X:94634235-94634257 CTATCATGAGAACAGGATGAGGG - Intergenic
1194929538 X:99868792-99868814 CTATCATGAGAACAGTGTGAGGG - Intergenic
1196315023 X:114212035-114212057 CTATCGTGAGAATAGCATGAGGG + Intergenic
1197395071 X:125917515-125917537 CTGTCGGGAGGTGAGGGTGAGGG - Intergenic
1197731422 X:129813461-129813483 CTGTCCTGAGCAGGGGGTGAAGG + Intronic
1197779247 X:130143138-130143160 ATCTGGTGAGAAGAGGAGGAAGG - Intronic
1198341625 X:135719937-135719959 CCCGTGTGAGGAGAGGGTGACGG - Intronic
1198346373 X:135763424-135763446 CCCGTGTGAGGAGAGGGTGACGG + Intronic
1198348279 X:135780709-135780731 CCCGTGTGAGGAGAGGGTGACGG + Intergenic
1198350181 X:135797972-135797994 CCCGTGTGAGGAGAGGGTGACGG + Intronic
1198352091 X:135815245-135815267 CCCGTGTGAGGAGAGGGTGACGG + Intronic
1198353999 X:135832513-135832535 CCCGTGTGAGGAGAGGGTGACGG + Intronic
1198355907 X:135849763-135849785 CCCGTGTGAGGAGAGGGTGACGG + Intronic
1198357820 X:135867042-135867064 CCCGTGTGAGGAGAGGGTGACGG + Intergenic
1198359736 X:135884324-135884346 CCCGTGTGAGGAGAGGGTGACGG + Intronic
1198366590 X:135946102-135946124 CCCGTGTGAGGAGAGGGTGACGG + Intergenic