ID: 1011096400

View in Genome Browser
Species Human (GRCh38)
Location 6:83669854-83669876
Sequence ATTTTTGTATGTTCATCTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 590
Summary {0: 1, 1: 0, 2: 4, 3: 48, 4: 537}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011096400_1011096401 12 Left 1011096400 6:83669854-83669876 CCATTAGATGAACATACAAAAAT 0: 1
1: 0
2: 4
3: 48
4: 537
Right 1011096401 6:83669889-83669911 CACCTGTTGATGAACAATTAAGG 0: 1
1: 0
2: 5
3: 47
4: 170
1011096400_1011096402 13 Left 1011096400 6:83669854-83669876 CCATTAGATGAACATACAAAAAT 0: 1
1: 0
2: 4
3: 48
4: 537
Right 1011096402 6:83669890-83669912 ACCTGTTGATGAACAATTAAGGG No data
1011096400_1011096404 29 Left 1011096400 6:83669854-83669876 CCATTAGATGAACATACAAAAAT 0: 1
1: 0
2: 4
3: 48
4: 537
Right 1011096404 6:83669906-83669928 TTAAGGGTGATTCCAGTTTTTGG 0: 1
1: 0
2: 1
3: 60
4: 565

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011096400 Original CRISPR ATTTTTGTATGTTCATCTAA TGG (reversed) Intronic
900870635 1:5299853-5299875 ATTGTAGTATGTTTATATAATGG + Intergenic
901350499 1:8591464-8591486 ATACTTGGATTTTCATCTAATGG - Intronic
901682640 1:10923094-10923116 ATTGTGGTATATTCATATAATGG - Intergenic
902363480 1:15955410-15955432 AGATTTATATGTTTATCTAAAGG - Intronic
902562483 1:17286383-17286405 ATTTTTGTATCTTCCTCTGATGG + Intergenic
902911152 1:19597975-19597997 ATTTTTGTGTGGTAATCTTAGGG + Intronic
906681935 1:47732895-47732917 ATTTTTGTGTGTTTTTTTAAAGG + Intergenic
906856450 1:49311174-49311196 ATTTTTGTCTGTTCCTCAAATGG + Intronic
906981698 1:50638136-50638158 ATTTTTGTATATTGATCTCATGG + Intronic
908769022 1:67579431-67579453 AATATTGTATATTCATCCAATGG - Intergenic
908990711 1:70085231-70085253 CCTTTTGTATTTTCATCAAAGGG + Intronic
909098372 1:71318671-71318693 ATTTTTGTATGGTACTATAATGG + Intergenic
909388791 1:75093259-75093281 ACTTTAGTTTGTTCATGTAATGG - Intergenic
910633935 1:89386057-89386079 ATTTTAGTATGTGCATGTACTGG + Exonic
911377953 1:97074726-97074748 ATTTTTGTATCATCCACTAAGGG + Intergenic
911564486 1:99447136-99447158 ATTTCAGTATATTCATATAATGG + Intergenic
911685880 1:100777080-100777102 ATTCTTTTATGTTCCTCTGAAGG + Intergenic
911840753 1:102678791-102678813 ATTTTTACATATTCATATAATGG - Intergenic
912901246 1:113651853-113651875 ATCTTTGTATATTCAGCTAGTGG - Intronic
913033757 1:114939426-114939448 AATTTGGTATATTCATATAATGG + Intronic
913034381 1:114948737-114948759 ATTTTTATATTTTCAATTAAAGG + Intronic
913381154 1:118211802-118211824 ATTTTTGTATTTCTATTTAATGG + Intergenic
914315223 1:146504506-146504528 CTTTTTGTATTTTAATGTAATGG - Intergenic
914321713 1:146569524-146569546 ATTTTTGTTTGTTAATTTGATGG + Intergenic
914882325 1:151556798-151556820 ATTTTTATATGTTAATATAGAGG - Intronic
916777073 1:167978118-167978140 ATTGTGGTATATTCATATAATGG - Intronic
917636288 1:176940007-176940029 ATTTTTTAAAGTTCATCCAAAGG - Intronic
918380250 1:183946571-183946593 ATTTTTGTCTTTTAATCTAAAGG - Intronic
918472725 1:184890924-184890946 ATTTAAGTATGTGCATCTGACGG + Intronic
918478367 1:184950599-184950621 ACTTCTGCTTGTTCATCTAAAGG + Intronic
918657322 1:187044572-187044594 ATTTATGTTTATTAATCTAAGGG - Intergenic
918760793 1:188403830-188403852 ATTTTGATAGATTCATCTAAAGG - Intergenic
919155574 1:193761441-193761463 ATTTTGGTATATTCATATGATGG + Intergenic
919510117 1:198452056-198452078 ATTGTTATATGTTAATCAAAAGG + Intergenic
921382654 1:214540840-214540862 AATTTTGTTTGTAAATCTAATGG - Intronic
921993388 1:221391541-221391563 ATCTTTGGGTCTTCATCTAAAGG - Intergenic
922119310 1:222646841-222646863 ATTATTGTATGTTCATATAATGG + Intronic
922332781 1:224592225-224592247 ATTTTTCTCAGTTCATGTAAAGG - Intronic
923829325 1:237537623-237537645 GTTTTTATAGATTCATCTAATGG + Intronic
924723065 1:246641269-246641291 ATTTTTGTGTGTGCCTTTAATGG + Intronic
924750083 1:246879255-246879277 TTTTTTGTCTCTTCATCTCATGG - Intronic
1063649623 10:7919859-7919881 ATTTTTCTATGTACATACAAGGG - Intronic
1064499626 10:15956034-15956056 ATTTCTGTAAGTTTAACTAAGGG + Intergenic
1064861011 10:19825611-19825633 TTTATTGGATGTTCATATAATGG - Intronic
1066554092 10:36592267-36592289 GTTTTTTTATGTGCATTTAAGGG - Intergenic
1067443295 10:46325111-46325133 GTTTTTCTATGTTTATTTAAGGG + Intronic
1067866871 10:49917646-49917668 ATTTTTGTATTTTTTTCTAGGGG - Intronic
1068224029 10:54083408-54083430 ATTGTTGTATATGCATGTAATGG + Intronic
1069147654 10:64916102-64916124 ATTTTTGCATGTTGATCTTGTGG + Intergenic
1069169804 10:65212481-65212503 ATTTTTGTATTTTTTTCTAGAGG - Intergenic
1070220821 10:74442336-74442358 ATTTTTGGATATAAATCTAAAGG + Intronic
1071797624 10:89023230-89023252 GTTTTTGCATGGTCATCCAATGG + Intergenic
1072088203 10:92101101-92101123 ATTTTCATCTGTTCATCTCAAGG + Intronic
1072939634 10:99749108-99749130 TTATTTGTATGTTAATCTATTGG + Intronic
1073643547 10:105276775-105276797 CTTTATTTATGTTCATCTAATGG + Intergenic
1073935328 10:108624487-108624509 AGTTTTTTATGTTAGTCTAAGGG - Intergenic
1074070539 10:110064112-110064134 ATTATTTTATGTTCATAAAATGG - Intronic
1074398818 10:113124292-113124314 AATTTAGAATGTTCATCTAAGGG + Intronic
1074756799 10:116629739-116629761 ATTTCTGAATGTTCATCCACAGG + Intronic
1074762671 10:116678709-116678731 ATTTCAGTATGTACCTCTAAAGG - Intronic
1074796101 10:116945858-116945880 ATTTTAGTGTAGTCATCTAATGG + Intronic
1075856462 10:125634105-125634127 ACCTTTGTATATTCATTTAAGGG + Intronic
1075872498 10:125781114-125781136 ATTTTTGTATGTTTTTGTAGAGG + Intergenic
1077680138 11:4232065-4232087 ATTTTTCTATGTCCTTCTTAAGG - Intergenic
1077681352 11:4243840-4243862 ATTTTTGTATGTCCTTCTTAAGG + Intergenic
1077684379 11:4277225-4277247 ATTTTTCTATGTCCCTCTTAAGG - Intergenic
1077685660 11:4289541-4289563 ATTTTTCTATGTCCCTCTTAAGG + Intergenic
1077689546 11:4328642-4328664 ATTTTTCTATGTCCTTCTTAAGG - Intergenic
1077690814 11:4340703-4340725 ATTTTTCTATGTCCCTCTTAAGG + Intergenic
1077708706 11:4514328-4514350 ATATTTTTATGTTCAACTGAAGG + Intergenic
1077812165 11:5649057-5649079 ATATGTGTATGTTGATCTTAAGG - Intergenic
1078887191 11:15513418-15513440 ATTTTGGTATGTTTATAAAATGG - Intergenic
1080300570 11:30780247-30780269 ATTTTTGTATGCTCAAAAAATGG + Intergenic
1080565627 11:33506766-33506788 ATATTTTTATGTTCTTCCAATGG - Intergenic
1081531666 11:43964667-43964689 ATTTTTGTATCTAGATCTATAGG - Intergenic
1082665831 11:55974797-55974819 ATTACGGTATGTTCATCCAATGG - Intergenic
1082962561 11:58933602-58933624 ATTTTTTTAGGTTCAGCTATTGG + Intronic
1084621842 11:70276919-70276941 AATTTTGTAAGTTCTTTTAAGGG + Intronic
1085194957 11:74664399-74664421 ATTGTGGTATATTCATATAATGG + Intronic
1085494528 11:76955824-76955846 AATATGGTATGTTCATATAATGG + Intronic
1087063208 11:94003273-94003295 ATTTTTCTTTGTTCAAATAAGGG + Intergenic
1088266941 11:107996863-107996885 ATTTTAGTATGTATTTCTAAAGG - Intergenic
1089905832 11:122037534-122037556 CTTTTTATTTGTTCATTTAACGG + Intergenic
1090140995 11:124261614-124261636 ATTTTTGTCTGATGTTCTAACGG - Intergenic
1090549568 11:127805501-127805523 ATTCTTTTATTATCATCTAATGG - Intergenic
1090833023 11:130432610-130432632 ATTTTTTTATCTTCATGTAGAGG - Intergenic
1090979670 11:131708078-131708100 ATTTTTGTATGTTGATTTTGTGG - Intronic
1091251792 11:134150350-134150372 ATCTGTGTATGTACATCTGAGGG - Exonic
1091555106 12:1567009-1567031 ATTTGTGAATGTTCAGCTGAGGG + Intronic
1092179168 12:6433549-6433571 ATTGTTGTATATTCACCCAATGG - Intergenic
1092627389 12:10341573-10341595 ATTGTTGTATATTCATATAATGG - Intergenic
1092675783 12:10917295-10917317 TTTTTTTTATTTTCAACTAAGGG + Intronic
1093155137 12:15675221-15675243 ATCTTTGTATTTTCTTCTCAAGG - Intronic
1093176848 12:15922304-15922326 ATTTTTAAATGATTATCTAAAGG - Intronic
1093319121 12:17691021-17691043 TTTTTTGTATGTTCATCAGTAGG - Intergenic
1093453336 12:19340224-19340246 TTTTTTGTATGTTTTTCTAAAGG - Intronic
1093538566 12:20252664-20252686 ATTATGGTATGTTCATAAAATGG - Intergenic
1093637537 12:21489203-21489225 ATTTTTGTAAGTTATTTTAATGG + Intronic
1093757762 12:22871451-22871473 ATTTTTGTTTGTTCCTTTCATGG + Intergenic
1094173682 12:27520965-27520987 ATTTCAGTATGTTTATTTAAGGG + Intergenic
1094724392 12:33098446-33098468 ATTTTTTTATGTTAATTTAAGGG + Intergenic
1094778555 12:33762324-33762346 GTTTTAGTTTGTTCATGTAAAGG - Intergenic
1095082291 12:38018354-38018376 CTTTTTGTAGGATCAGCTAAGGG + Intergenic
1095755247 12:45757968-45757990 ATCTTTGCATATTCACCTAAAGG - Intronic
1096163276 12:49398732-49398754 ATTTCTGTATTTACATATAAAGG - Intronic
1096996578 12:55841961-55841983 AGTTTTATATGTTGATGTAATGG - Intronic
1097478556 12:60091274-60091296 ATTTTTGTATGTCAACCTCAGGG + Intergenic
1097789078 12:63794935-63794957 ATTTTGGTATGTTAATGTATGGG + Intronic
1097932920 12:65210102-65210124 ATTTTTGTATCTTAATTTAGAGG + Intronic
1098040242 12:66347032-66347054 ATTTTTGTATAATTTTCTAAAGG - Exonic
1098285205 12:68900014-68900036 ATTTTTGTATTTTTTTCTATAGG + Intronic
1098526348 12:71491263-71491285 TTTTTTGTAAGTTTATATAAGGG + Intronic
1099411848 12:82339548-82339570 ATTTTTGTATTCTCCTTTAAGGG + Intronic
1099765894 12:86983418-86983440 ATTCATGTATCTTCATCTAGTGG + Intergenic
1100454062 12:94734509-94734531 ATTTTTGTATTTTTTTGTAAAGG - Intergenic
1100673563 12:96842586-96842608 ATTTTTTTTTGTTCATCAAAAGG - Intronic
1101794977 12:107964630-107964652 ATGTTTGCAGGTTCATCTCATGG + Intergenic
1105691045 13:22839475-22839497 ATTTTTGTATGTTTTTGTAGAGG - Intergenic
1106148283 13:27072184-27072206 ATTTATTTAGGCTCATCTAAAGG + Intronic
1106497970 13:30298368-30298390 ATTTTAGTATGTCTATATAATGG - Intronic
1106661256 13:31801818-31801840 ATTTTTTTATTTTCCTATAAAGG + Intronic
1107253026 13:38388712-38388734 ATGTTTGTATTTGCATGTAACGG - Intergenic
1107847464 13:44531670-44531692 ATGGTTGCATGTACATCTAAGGG - Intronic
1108427390 13:50317168-50317190 ATTTTTGGATGTTATTATAAAGG - Intronic
1108673404 13:52714328-52714350 ATTTGTGTAAGTTACTCTAAGGG + Intronic
1108889170 13:55231388-55231410 AAGATTGTATATTCATCTAAGGG - Intergenic
1109273393 13:60278875-60278897 ATTTTTATATGTTAACCTCATGG + Intergenic
1109481348 13:62959065-62959087 ATTTTTGTGTATTTATCCAATGG + Intergenic
1109624650 13:64958859-64958881 TTTTATGTATGTACATGTAATGG + Intergenic
1109976653 13:69844187-69844209 ATTTTTATGTGTACATCTATGGG - Intronic
1110141913 13:72140516-72140538 ATTTTTGTTTGTTAATCTTTAGG + Intergenic
1110603204 13:77400184-77400206 ATATTTGTATGTTCCTGTAAGGG + Intergenic
1111660986 13:91211399-91211421 ATTTTTATATGTTCATCCTGGGG + Intergenic
1111735873 13:92138603-92138625 ATTTGTGTATGTTCGCTTAAGGG + Intronic
1112180266 13:97071124-97071146 ATAGTGGTATATTCATCTAATGG - Intergenic
1112237037 13:97645886-97645908 CTTTTTGTAAGTTTATATAATGG - Intergenic
1113297866 13:108981841-108981863 TTTTTTGTATGTACATTTGAAGG + Intronic
1114691013 14:24581297-24581319 ATTGTAGTATATTCATATAATGG + Intergenic
1114931321 14:27471384-27471406 ATTTTCATATGTTTATATAATGG + Intergenic
1114961640 14:27898442-27898464 ATGGTAGTATTTTCATCTAATGG + Intergenic
1115591726 14:34872423-34872445 ATTTTTGTATTTTCATAGACGGG - Intronic
1116130051 14:40844500-40844522 ATATATGTATATTTATCTAAAGG + Intergenic
1116245262 14:42403444-42403466 ATTTCTGTAATTTTATCTAATGG - Intergenic
1116952305 14:50890672-50890694 ATTTTGGTATGTACATACAATGG - Intronic
1118542698 14:66846481-66846503 ATTTTGTTCTTTTCATCTAATGG + Intronic
1118960651 14:70527407-70527429 ATTTGAGTATGTTCATGTACTGG - Intronic
1118998530 14:70859772-70859794 ATTTTTGTTTGTTTAGCTCATGG - Intergenic
1119488327 14:75007515-75007537 ATTGTGGTATGTTCATATAATGG - Intronic
1119576432 14:75727320-75727342 ATTGTGGTATGTCCATATAATGG + Intronic
1119588514 14:75861828-75861850 ATTTTAGTATGATTTTCTAAAGG - Intronic
1120035654 14:79694533-79694555 ATGTTTTTATGTACATATAATGG + Intronic
1120316506 14:82900544-82900566 ATTGTGGTATGTTCATAGAATGG - Intergenic
1120500471 14:85290669-85290691 ATTTCTGTGTGTGCATTTAAGGG - Intergenic
1120582396 14:86268682-86268704 ATTTTTGTTTGTTTATTTAATGG + Intergenic
1120875827 14:89374554-89374576 ATTATGGTATGTTCATAAAATGG + Intronic
1121066953 14:90976515-90976537 ATTTCTGTGTGTTCATTTGAGGG + Intronic
1121072161 14:91034132-91034154 TTTTTTGTATTTTTATGTAAGGG - Intronic
1121344629 14:93126467-93126489 ATTTTTGTATTTTTAGCTGAGGG - Intergenic
1121913471 14:97814269-97814291 ATTTTTATTTGTTTCTCTAATGG - Intergenic
1202889194 14_KI270722v1_random:139440-139462 ATTTTTGTTTGTTTGTCTATAGG + Intergenic
1202893170 14_KI270722v1_random:178870-178892 TTTTTTGTAATTTCATATAATGG - Intergenic
1202921152 14_KI270723v1_random:31369-31391 ATTTCTGCATGTTTCTCTAAGGG + Intergenic
1123675489 15:22707241-22707263 ATTTGTGTATGTTCACTTAAGGG + Intergenic
1123858720 15:24440275-24440297 ATTTCTGTATTATCTTCTAAGGG + Intergenic
1124327482 15:28780179-28780201 ATTTGTGTATGTTCGCTTAAGGG + Intergenic
1124769165 15:32515498-32515520 ATTTGTGTATGTTCGCTTAAGGG - Intergenic
1124802289 15:32845462-32845484 ATATTTGTTTCATCATCTAAAGG - Intronic
1125580885 15:40784778-40784800 ATTTTTGTATTTCCATCTGTTGG - Intronic
1125666894 15:41438205-41438227 ATTTTTGTGTTTTCAACTAAAGG - Intronic
1125779573 15:42252417-42252439 AATGTTGTATGTTCATAAAATGG - Intronic
1127428802 15:58882036-58882058 ATTTTTGTATTTTTAGCAAATGG - Intronic
1127743552 15:61939084-61939106 ATTTTGGTATCTTCATATAATGG - Intronic
1127879728 15:63146208-63146230 ACATTTTTATGTTTATCTAAGGG - Intronic
1128035697 15:64523870-64523892 CTTTTTGCATGTTTATCAAATGG + Intronic
1128845288 15:70889207-70889229 ATTTTGGTATATTCATACAATGG + Intronic
1129560918 15:76567253-76567275 ATTATGGTATGTTCATATAATGG - Intronic
1129869397 15:78931059-78931081 ACTTTAGTGAGTTCATCTAAAGG + Intronic
1129978234 15:79841363-79841385 ATTTTTGCATGTTAATCAGAAGG - Intronic
1131587216 15:93708404-93708426 ATTTTTGTAACTTCAACAAAAGG - Intergenic
1133635959 16:7665626-7665648 ATTTAACTATGTTCATCTAGAGG + Intronic
1133702502 16:8322146-8322168 ATTTTTTTCTTTTAATCTAAAGG + Intergenic
1134035767 16:11030088-11030110 ACTGTGGTATGTTCATATAATGG - Intronic
1134873227 16:17671259-17671281 ATTTGTGTATTTACATCTAAAGG + Intergenic
1135351058 16:21729201-21729223 ATTTTTGTATTTTTTTTTAAGGG + Intronic
1135449533 16:22545328-22545350 ATTTTTGTATTTTTTTTTAAGGG + Intergenic
1135748722 16:25039207-25039229 ATTTTTGTATTTTTTTCTAGAGG + Intergenic
1135853228 16:25983368-25983390 ATTTTTGTGTGGACATCAAATGG + Intronic
1137021924 16:35436566-35436588 GTTTATGTATGTTCATCTTTAGG - Intergenic
1137259464 16:46812428-46812450 ATTTTTTAATGTTCATCTTTTGG + Intronic
1138987755 16:62351250-62351272 ATTTTTGTATCTTTTTCTAGAGG + Intergenic
1139015253 16:62682496-62682518 CTTTTCCTATGTTCTTCTAAAGG - Intergenic
1139087971 16:63611955-63611977 ATATCTGTAGGTTCATTTAATGG + Intergenic
1139668642 16:68476047-68476069 ATTGTAGTATATTCATATAATGG - Intergenic
1140011916 16:71141620-71141642 ATTTTTGTTTGTTAATTTGATGG - Intronic
1140050142 16:71473342-71473364 ATTGTGGTATATTCATGTAATGG + Intronic
1140382273 16:74500310-74500332 ATTATTGTAAGTTCATTTATAGG - Intronic
1140558649 16:75951226-75951248 ATTGTGGTATATTCATATAAGGG + Intergenic
1141930184 16:87196945-87196967 ATTTTTCTATGTGGATCTAGGGG + Intronic
1143990495 17:10956141-10956163 ATCTTTATATGTACATCTCAAGG + Intergenic
1144202443 17:12953650-12953672 AATGTGGTATGTTCATGTAACGG + Intronic
1145054259 17:19689276-19689298 ATTTTTGTATGTTGATTTGTTGG - Intronic
1145357469 17:22173684-22173706 ATTTTTGTATATTTATCCAATGG - Intergenic
1146191119 17:30767281-30767303 ATTTTTGAAAGTTTATGTAAAGG + Intergenic
1146336276 17:31973923-31973945 ATTTTTGAAAGTTTATGTAAAGG + Intronic
1146433965 17:32825458-32825480 ATTTTTGTATTTTTTTGTAAAGG + Intronic
1146454647 17:32999463-32999485 ATTTTTATTTGTACAACTAATGG + Intergenic
1147655411 17:42087789-42087811 ATTATTGTATGTGCAACAAAAGG - Intergenic
1148086926 17:44999363-44999385 ATTGTTGTATGTGCAAATAATGG - Intergenic
1148485047 17:47985366-47985388 AATTTTGTATGTGCATGTACAGG - Intergenic
1149032053 17:52095099-52095121 ATTTTTGTACATTCATACAATGG + Intronic
1149331335 17:55585631-55585653 ATTGTGGTATATTCATATAATGG + Intergenic
1149368948 17:55973773-55973795 ATTTTTTTAAGTACATTTAATGG + Intergenic
1150040975 17:61860760-61860782 ATTCTGGTATATTCATCCAATGG + Intronic
1150461593 17:65358302-65358324 ATGTATGTATGTACATATAAAGG + Intergenic
1150999343 17:70356104-70356126 TTAATTTTATGTTCATCTAATGG + Intergenic
1151157306 17:72134602-72134624 ATTCTTGTAAGTTCATGCAATGG - Intergenic
1152023824 17:77796170-77796192 ATTTAAGTATGTACATTTAATGG + Intergenic
1155253257 18:23971176-23971198 ATTTTTGCACATTCATCAAAAGG + Intergenic
1155710819 18:28876995-28877017 AATTTTGTATTTACTTCTAATGG + Intergenic
1157376345 18:47170024-47170046 TTGTCTGTATGTTCTTCTAAGGG + Intronic
1158072084 18:53483590-53483612 ATGTTTGTATGTTAATCTGTGGG - Intronic
1158372541 18:56825244-56825266 TTTTTTGTGTGTGCATGTAAAGG + Intronic
1158690577 18:59656627-59656649 TTATTTGTATGTGCATCTAGCGG + Intronic
1159373070 18:67554331-67554353 AATTTTGTATATTCATATAATGG - Intergenic
1159611889 18:70534874-70534896 ATTTTTGTCTCTTCCTATAATGG + Intergenic
1159666359 18:71166296-71166318 ATTTTTGTATGTTTGTAAAAAGG - Intergenic
1161836674 19:6652251-6652273 ATTTTTGAATATTTATATAATGG + Intergenic
1161863750 19:6818785-6818807 ATATTTGTAGGTTCCTCTAAGGG - Intronic
1162198548 19:9004564-9004586 TTTTTTGTCTGTTCATCCATTGG - Intergenic
1162708872 19:12576888-12576910 ATTTTTGTATATTTGTCTAGAGG - Intronic
1164334470 19:24299234-24299256 ATTTTTGTAGGTTCTGCAAATGG + Intergenic
1164640459 19:29821410-29821432 ATTTGTGTATGATTATCAAAGGG + Intronic
1165618785 19:37226706-37226728 ATTTTTGTAAGTTCATTTATTGG + Intronic
1166837367 19:45675717-45675739 ATTTTTGTATGTTTTTGTAGAGG - Intronic
1202664589 1_KI270708v1_random:106214-106236 ATTTTTGTTTGTTTGTCTACAGG + Intergenic
925986647 2:9221629-9221651 CTTTTTGTATATTGATCTTATGG + Intronic
926115809 2:10212599-10212621 ATTGTGGTATATTCATGTAATGG + Intergenic
926877831 2:17503728-17503750 ATTTGTGTATTTTCATCAATAGG - Intergenic
927505646 2:23612384-23612406 ATTTTTGTTCTTTCTTCTAAGGG - Intronic
928007706 2:27578577-27578599 AATATTGTATGTTCCTCAAATGG - Exonic
928388572 2:30890621-30890643 ATCTTTGTATATTCATAGAAGGG - Intergenic
929261575 2:39872100-39872122 ATTTATGTTTGTTCAAATAACGG - Intergenic
929631709 2:43469498-43469520 TTTTTTTAATGTTCATTTAAGGG - Intronic
929921484 2:46174856-46174878 ATTTTTGTATTTTTTTGTAAAGG + Intronic
929952428 2:46424564-46424586 ATTCTTGCATGTTCATCCAATGG - Intergenic
930285887 2:49427417-49427439 ATTTATCTGTGTTCATCAAAAGG - Intergenic
930877486 2:56235392-56235414 ATTTTTCAAAGTACATCTAACGG - Intronic
931114258 2:59147583-59147605 ATTTCTGAATGTGCCTCTAAGGG - Intergenic
931361651 2:61583181-61583203 ATTTTTGTATTTTTTTGTAAAGG + Intergenic
931828161 2:66022876-66022898 ATTTTTGTATCTTCAGCTTGGGG + Intergenic
933056568 2:77677320-77677342 AGTTTTGTATGTACTTTTAAAGG - Intergenic
933187534 2:79295035-79295057 ATTTGTGTATGCTCATCTTCAGG + Intronic
933425861 2:82111693-82111715 ATTTTTGTGTCTTTATTTAATGG + Intergenic
933454035 2:82498814-82498836 ATTTTTATATGTTTTTCAAATGG - Intergenic
933926644 2:87098086-87098108 AGTTTTGTATGTACTTTTAAAGG - Intergenic
934069557 2:88371454-88371476 ATTTTTGTATTTTTTTGTAAAGG + Intergenic
934957795 2:98638677-98638699 ATTTCTGTATGTTCTTCCAGTGG + Intronic
936753604 2:115677226-115677248 ATTTTTATATGTTTTTATAATGG - Intronic
937164685 2:119801728-119801750 ATTTTTGTATGTTGATGTATTGG + Intronic
939067125 2:137497020-137497042 ATTTTTATTTGGTCCTCTAAGGG + Intronic
939386526 2:141507051-141507073 ATGGTTGTATGTTCATCGGAAGG + Intronic
940029631 2:149247896-149247918 ATTATGGTATATTCATATAAAGG - Intergenic
940084696 2:149846054-149846076 ATTTTTGGATTTTCTTTTAAAGG + Intergenic
940421503 2:153484329-153484351 ATTATAGTATGTTCACATAATGG - Intergenic
940475371 2:154154753-154154775 ATTTGTGTATGTGCATTTATAGG + Intronic
941081827 2:161070622-161070644 AATTTAGTCTGTTCATCTGATGG - Intergenic
941194049 2:162424229-162424251 ATTTTTGTTCTTTCATCTATGGG + Intronic
941391141 2:164916305-164916327 ATTTTTGTATCTCCCTCAAAAGG - Intronic
943137312 2:183929975-183929997 ACTTTTGTATGTTTTTCAAAAGG + Intergenic
943203710 2:184862360-184862382 AATATTGTATGTGCATCTTAAGG - Intronic
943542557 2:189235667-189235689 ATTATGGTATGTTCATACAATGG - Intergenic
944730533 2:202512429-202512451 TTTTCTGTATGCTCAACTAAAGG + Intronic
945220024 2:207474000-207474022 TTTTTTTTATCATCATCTAAAGG + Intergenic
945646611 2:212503750-212503772 ACTTTTGACTGTTCCTCTAAAGG - Intronic
945712734 2:213319567-213319589 GATTTTGTATATTCATCTAATGG + Intronic
945759428 2:213895079-213895101 ATTTTTGTATGTTGATTTTGTGG - Intronic
946283546 2:218684587-218684609 ATTTTTGTATTTTCATAGAGAGG + Intronic
946569300 2:221004375-221004397 ATTTTTGTATATTTTTGTAAAGG + Intergenic
946589504 2:221228731-221228753 TTTTTGGTATGTGCATGTAAAGG + Intergenic
946786577 2:223251591-223251613 ATTTTTGTATTTTTAGTTAAGGG + Intergenic
947013700 2:225593828-225593850 ATTTTTGTTTTTTCACTTAATGG - Intronic
948729629 2:239954619-239954641 AATTGTGTGTGTTCATCCAATGG - Intronic
1168732896 20:102941-102963 ATTCTTGTGTTTTCTTCTAAGGG + Intergenic
1170124247 20:12945393-12945415 ATTTTTGTTTGTTCAGCAAGAGG - Intergenic
1170778960 20:19406312-19406334 ATTTTTGTATGTATATATGAAGG + Intronic
1172958715 20:38781748-38781770 ATTTTTGTATTTTCATAGACGGG - Intergenic
1173179407 20:40792480-40792502 TTTTTTGTATTTTCTTGTAATGG + Intergenic
1173770152 20:45649305-45649327 ATTTTTGTCTTTACATCTAAAGG + Exonic
1174437386 20:50519840-50519862 ATTTTTGTAGGTTGATCATAAGG + Intronic
1174887970 20:54356681-54356703 ATTTTTACATGTCCATCTATAGG - Intergenic
1174947927 20:55009278-55009300 TTTTTTGTGTGTTCATTTTAGGG + Intergenic
1175437009 20:58960124-58960146 ATTTTGGTGTGTTCTTCTGAGGG - Intergenic
1175618285 20:60422031-60422053 ACTTCTGTATGGTCATCTTATGG + Intergenic
1176426133 21:6549599-6549621 ATTTTTGTATTTTTTTGTAAAGG + Intergenic
1177546036 21:22560480-22560502 ATTTTATTTTGTTCTTCTAATGG + Intergenic
1177717856 21:24863463-24863485 TTGTTTGTTTGTTTATCTAAAGG + Intergenic
1177916735 21:27098121-27098143 ATTCATGTTTGTTCATCTGAAGG + Intergenic
1178328411 21:31664138-31664160 ATTTTTGTATTTTTTTCTAGAGG + Intronic
1179701624 21:43157916-43157938 ATTTTTGTATTTTTTTGTAAAGG + Intergenic
1179832256 21:44004558-44004580 ATTTTTGTATTTTCAGCAGATGG - Intergenic
1179838634 21:44055420-44055442 ATTTTTGTATTTTTTTGTAAAGG - Intronic
1180331318 22:11483129-11483151 ATTTTTGTTTGTTTGTCTATAGG + Intergenic
1180690585 22:17711464-17711486 ATTTTTGTATGTTTTTGTAGAGG + Intronic
1181336502 22:22135785-22135807 ATATTTGTATTTTCTTATAAGGG - Intergenic
1181336656 22:22138991-22139013 ATATTTGTATGTTTCTATAAGGG - Intergenic
1182168972 22:28207329-28207351 ATCTTTTTATGTTCCTCTAGTGG - Intronic
1182937123 22:34234999-34235021 ATTTTCATATATTCATATAATGG - Intergenic
1184906609 22:47491644-47491666 CTTTTTGTATCTGCATCTGAAGG + Intergenic
949114734 3:306902-306924 ATTTTTCTTTGCTCATCAAAAGG - Intronic
949616792 3:5762405-5762427 ATTTTTTTTTTTTCATTTAATGG + Intergenic
949725659 3:7041485-7041507 ATTGTGGTATGTTCATACAATGG - Intronic
951431046 3:22607436-22607458 ATTTTTGTATTTTTTTCTATAGG - Intergenic
951900433 3:27652928-27652950 ATTTTTGTATTCTCATATACAGG - Intergenic
951976303 3:28513730-28513752 ATTTTTTTTTCTTTATCTAAAGG + Intronic
952124456 3:30283550-30283572 ATTTTGTTCTGATCATCTAAGGG + Intergenic
953383456 3:42491388-42491410 ATTTGAGTGTGTACATCTAAAGG - Intronic
953440505 3:42912138-42912160 ATTTTTATATATTTATATAAAGG - Intronic
954475429 3:50740228-50740250 ATTTTGGTATGTTCACACAATGG - Intronic
955923951 3:63987645-63987667 AATTTTGAATGTTAATGTAAAGG - Intronic
955998760 3:64706172-64706194 ATTGTGGTATGTTCATACAATGG - Intergenic
956017312 3:64897273-64897295 ATTTTTCTATGTTTATCTAATGG + Intergenic
956023154 3:64953704-64953726 ATTTTGGTCTGTTCATCACAGGG - Intergenic
956208782 3:66781749-66781771 ATTTTGGTTTGTTCATACAATGG - Intergenic
957184243 3:76921977-76921999 ATTTTTATCTGTTCATAGAAAGG - Intronic
957284126 3:78195283-78195305 ATTTTTAAAGGTTTATCTAATGG + Intergenic
957670887 3:83301447-83301469 TTTTTTGTAGAGTCATCTAAAGG - Intergenic
957854244 3:85853666-85853688 ATTTTTTTTTTTTCATCTCATGG - Intronic
957866298 3:86028331-86028353 ATTTTTGTGTTTTCATTTACTGG - Intronic
958170775 3:89937214-89937236 ATTTTTTTATGTATATATAATGG + Intergenic
959472362 3:106767625-106767647 ATTTTTGTTTGCTCCTCTGAAGG - Intergenic
959688937 3:109177613-109177635 AATTTTATATTTTAATCTAAAGG + Intergenic
960374597 3:116883810-116883832 ATTGTGGTATGTTCATAAAATGG + Intronic
960470662 3:118061232-118061254 ATTTTTGTCTGTTGCTTTAAAGG - Intergenic
961172775 3:124810128-124810150 ATTGTAGTATGTTCATATAGTGG + Intronic
961268256 3:125665818-125665840 ATATTTGTATGTTCCTATAAGGG + Intergenic
961268538 3:125669797-125669819 ATATTTGTATGTTCCTATATTGG + Intergenic
961709430 3:128816112-128816134 ATTGTATAATGTTCATCTAAGGG + Intergenic
962356019 3:134694919-134694941 ATTTGTGTGTGTGCATGTAAGGG + Intronic
962858213 3:139369832-139369854 ATTATCGTATATTCATATAATGG + Intronic
963539741 3:146569976-146569998 GTTTTTGTACATTCATCTCATGG + Intergenic
964427184 3:156566313-156566335 CTTGTGGTATATTCATCTAAAGG - Intergenic
964491723 3:157243233-157243255 ATTTTGGTATATTCATACAATGG + Intergenic
965127199 3:164646715-164646737 ATTTTTCTATGTTGTTCTTAAGG - Intergenic
965129202 3:164673187-164673209 ATTTATGTCATTTCATCTAAGGG - Intergenic
965190151 3:165517439-165517461 ATTTTTCTATGTCAATTTAATGG - Intergenic
965231333 3:166056521-166056543 ATTTGTGTATGTATCTCTAAAGG + Intergenic
965829681 3:172771235-172771257 CATTTTGTATGACCATCTAAGGG - Intronic
967463215 3:189771881-189771903 ATATTTGTATGAGAATCTAATGG + Intronic
967666957 3:192184053-192184075 ATTTTTGTATGTTTTTGTAGAGG - Intronic
970251394 4:14119825-14119847 ATTTTTGGTTGTTGTTCTAATGG - Intergenic
970255315 4:14162810-14162832 GTGTTTGTATGTTCTTCTATGGG + Intergenic
970907688 4:21236125-21236147 ATTTTTGTATCTTCTTGTAGAGG - Intronic
971308441 4:25504010-25504032 AATGTGGTATGTTCATATAATGG - Intergenic
971515742 4:27483900-27483922 ATTTTTGGATATTTATCCAAAGG + Intergenic
971632608 4:29013230-29013252 ATTTTTGAATGATCCTCTGATGG + Intergenic
971636056 4:29059496-29059518 CTGTTTCTATATTCATCTAAAGG + Intergenic
971640712 4:29129317-29129339 ATTTTTAAATGTTCATGTAGGGG - Intergenic
971683725 4:29736348-29736370 ATTTTTTTAACTTCATCTTAGGG + Intergenic
971879087 4:32345101-32345123 ATTTTTGTCTTTTAAGCTAAGGG - Intergenic
972149318 4:36068812-36068834 TTTTATGTATGTTCACCTTATGG + Intronic
972604262 4:40599710-40599732 ATTTCTGTATTCTCATCTGAAGG - Intronic
972855682 4:43103924-43103946 ACATTTGTGTGTTTATCTAAAGG + Intergenic
973150866 4:46886822-46886844 ATTTTTGCATATTGAACTAATGG - Intronic
975478666 4:74853081-74853103 ATTTTTGTTTTTTAATCAAAAGG + Intergenic
975725106 4:77284243-77284265 AACTTGGTATGTGCATCTAAAGG + Intronic
976843126 4:89455330-89455352 ATTTTTCTATGTTCATGTAAAGG - Intergenic
977282078 4:95052792-95052814 ATTTTTGTGTGTTGATATGAAGG + Intronic
978492838 4:109327141-109327163 ATTTTTTTAACTTCATATAAAGG + Intergenic
978501407 4:109414011-109414033 ATTTTTGAACTTTCATCTACAGG + Intergenic
978738285 4:112108849-112108871 ATTTTTATAAGATCATGTAACGG - Intergenic
978873461 4:113608358-113608380 ATTATAGTATATTCATATAATGG - Intronic
978891768 4:113837401-113837423 TCTTTTGTATGTTCATATAATGG - Intergenic
979061878 4:116073164-116073186 ATTTTAGTCTGTTCACATAAAGG + Intergenic
979211188 4:118105663-118105685 AATTTTGTATGTTCAGACAATGG - Intronic
979981960 4:127267158-127267180 ATTGTAGTATGTCCATATAATGG + Intergenic
980069369 4:128227355-128227377 TTTATTGTATGGTCATATAATGG + Intergenic
980081436 4:128348895-128348917 GTTTTTTTAAGTTCATCTAGGGG + Intergenic
981295131 4:143123051-143123073 TTTTTTTCATTTTCATCTAAAGG - Intergenic
981505840 4:145498912-145498934 CTTTGTGTGTGTTCATCTGAGGG + Intronic
981807847 4:148737695-148737717 ATTTTTACATGTTCAACAAATGG - Intergenic
982240797 4:153297423-153297445 ATTTTTGCATTTTCATTTCATGG - Intronic
982294704 4:153815187-153815209 ATTATTATATATTCATCCAATGG - Intergenic
982347411 4:154375858-154375880 ATTATTGTATATTCACATAAAGG + Intronic
982604301 4:157494931-157494953 ATTTTTTTTTATTCATCTAATGG - Intergenic
982804415 4:159746515-159746537 AATGTTGTATGTTCATATAATGG - Intergenic
983043847 4:162961283-162961305 ATTTTGTTATATTCATATAATGG + Intergenic
983229851 4:165118209-165118231 TTTTTTGTCTGTTCATTGAAAGG - Intronic
983779046 4:171644970-171644992 AGTTTTGTTTTTTCACCTAAGGG - Intergenic
984000304 4:174233353-174233375 ATTTTTATTTGTTTCTCTAAAGG - Intergenic
984376352 4:178936098-178936120 AATTTTGTATGGACATTTAATGG - Intergenic
986554124 5:8993677-8993699 GTTGTGGTATATTCATCTAATGG - Intergenic
987048978 5:14133684-14133706 AATTTTGTATATTCATATAATGG - Intergenic
988666180 5:33330374-33330396 ATTTTTTGTTATTCATCTAAGGG - Intergenic
988735639 5:34018038-34018060 ATTTTTGTATCTTGCTCTAATGG - Intronic
989336294 5:40320659-40320681 TTTCTTGTATGTTCAACTCATGG - Intergenic
989706787 5:44343052-44343074 ATTTTTATTTGTTCATGTAAGGG - Intronic
989980020 5:50632478-50632500 ATTTTTGACTGTTTGTCTAAAGG - Intergenic
990100933 5:52185911-52185933 ATTTATCTGTGTGCATCTAATGG - Intergenic
990452864 5:55952890-55952912 ATTTTTGTATTTTCAGTAAAGGG - Intronic
990849977 5:60191830-60191852 ATTTTTGTATTTTTTTTTAATGG - Intronic
991146584 5:63313260-63313282 ATTTCTCTATGTTCCTGTAATGG + Intergenic
991163078 5:63528086-63528108 ATTTTGGTATATTCATACAAGGG + Intergenic
991381903 5:66037095-66037117 ATTTTTATATGCTCATCTAAGGG + Intronic
993391801 5:87327346-87327368 ATTTTTGTATTTTTCTTTAAAGG + Intronic
993550148 5:89263405-89263427 ATTTTTGCATTTTCATCTTTTGG - Intergenic
993887653 5:93435246-93435268 ATTTTTTTATTTTTATTTAATGG + Intergenic
994358862 5:98827170-98827192 ATTTTTGTATGTTATAATAAAGG - Intergenic
994381435 5:99076615-99076637 ATTGTGGTATGTTTATATAATGG - Intergenic
994796420 5:104306512-104306534 ATTTTTGTTTGTTTTTTTAAAGG - Intergenic
994886656 5:105571930-105571952 ATTGTGGTATGCTCATATAATGG + Intergenic
994934457 5:106236064-106236086 GTTTTTGTTTGTTCATTTTAAGG - Intergenic
995045274 5:107639570-107639592 ATTTTTATTTGTTTATCTTAAGG + Intronic
995757904 5:115529968-115529990 ATTTTTGGATTTTCATCTCCTGG - Intronic
995826765 5:116308326-116308348 ATATTTGTCTGTTTATCTATTGG + Intronic
996063018 5:119052552-119052574 CTTTTCGTCTGTTCATCTGAGGG + Intronic
996555544 5:124775208-124775230 ATTTAAGTATGTCCATATAATGG + Intergenic
997689750 5:135819783-135819805 ATTTGTATATTTTCATTTAAGGG - Intergenic
998334514 5:141359471-141359493 ATTGTTGTATATTCATATTACGG + Intronic
999011944 5:148052141-148052163 AGGTTTGTATGATCATCTCAGGG + Intronic
999438570 5:151583328-151583350 ATTTCAGTATGGTCATATAATGG + Intergenic
999676459 5:154008415-154008437 AATTTTGGATTTTCATATAAGGG - Intronic
1000006416 5:157188872-157188894 ATTTCTGTCTGTCCATCTAATGG + Intronic
1000733928 5:164874263-164874285 AATTTTGTATGTTTATATCATGG + Intergenic
1000790063 5:165595060-165595082 ATTTTTATAGGTACATATAACGG - Intergenic
1001067147 5:168544951-168544973 ATTGTAGTATATTCATCCAATGG + Intergenic
1001378371 5:171284491-171284513 ATTTTTGTATTTTTTTGTAAAGG + Intronic
1001739798 5:174043286-174043308 ACTACTGGATGTTCATCTAAAGG - Intergenic
1002494220 5:179600863-179600885 ATTTTTGTATTTTTAACTAAAGG + Intronic
1003001335 6:2336885-2336907 ATTTTGGTATATTCATACAATGG + Intergenic
1003274609 6:4638638-4638660 ACTTTTGTCTGTTCATAAAATGG - Intergenic
1003413181 6:5884040-5884062 ATTTTTAACTGTTCATTTAAGGG + Intergenic
1003911785 6:10749909-10749931 ATTTTTGCCTCTTTATCTAAAGG + Intronic
1004129170 6:12902521-12902543 GATGTTGTATGTTCATCCAATGG - Intronic
1007433701 6:41792622-41792644 ATTTGTGACTGTTCATCAAATGG - Exonic
1007706581 6:43795006-43795028 ATTTTAGATGGTTCATCTAAAGG - Intergenic
1008203385 6:48620780-48620802 ATTTTGGTATATTCATACAATGG - Intergenic
1008971870 6:57377915-57377937 ATGTTTGTATGTTCCTGTAAGGG + Intronic
1009026210 6:58003286-58003308 AGTTTTGTATGTTGATTGAATGG - Intergenic
1009160789 6:60279439-60279461 ATGTTTGTATGTTCCTGTAAGGG + Intergenic
1009201761 6:60754758-60754780 AGTTTTGTATGTTGATTGAATGG - Intergenic
1009260524 6:61480291-61480313 GTTTTTGTATGTTCTGCAAATGG + Intergenic
1009672124 6:66768820-66768842 ATTTTTGTTTGTTTAACCAAGGG - Intergenic
1010068956 6:71720614-71720636 ATTTGTGTATTTGCACCTAACGG + Intergenic
1010319807 6:74492671-74492693 AATTTTTTTTGTTTATCTAATGG - Intergenic
1011096400 6:83669854-83669876 ATTTTTGTATGTTCATCTAATGG - Intronic
1011133902 6:84079188-84079210 ATTGTAGTATGTTCATACAATGG + Intronic
1011708011 6:90023004-90023026 ATATTTATATATTCATATAACGG + Intronic
1011993430 6:93553319-93553341 ATATTTGTATGTCCTTCTTATGG + Intergenic
1012821871 6:104094722-104094744 ATTGTGGTATATTCATCTACTGG - Intergenic
1012903801 6:105040574-105040596 ATATTTGTATTTACATATAATGG + Intronic
1013196842 6:107851474-107851496 ATTTTTCTGTGTTTATCCAAGGG - Intergenic
1014435976 6:121421103-121421125 ATTTTTGTATGTTTTTGTAGAGG - Intergenic
1014466730 6:121764979-121765001 ATTCTTGCTTGTTCACCTAATGG - Intergenic
1014623734 6:123700888-123700910 ATTTTTGTTTATTCATTAAAGGG + Intergenic
1014682494 6:124449267-124449289 ATATTTTTATGTTCCTGTAATGG + Intronic
1014723439 6:124947671-124947693 ATTATTTTATGTTCATTAAAAGG - Intergenic
1014962630 6:127705836-127705858 ATTTTTGAAGGTTCAGCTGAGGG + Intergenic
1014976879 6:127897908-127897930 ATTGTAGTATATTCATCTAATGG + Intronic
1015627028 6:135190105-135190127 ATTTTTGTGTGTTTATCTGAAGG + Exonic
1015882632 6:137884551-137884573 ATTGTGGTATATTCATATAATGG + Intergenic
1017125465 6:151060385-151060407 GTTGTTGTTTGTTCTTCTAATGG - Intronic
1019944651 7:4317362-4317384 ATCTTTGTGTGTTTATTTAATGG - Intergenic
1020152576 7:5694876-5694898 ATTTATTTATAATCATCTAAAGG + Intronic
1020711287 7:11608743-11608765 GGTTGTGGATGTTCATCTAAGGG - Intronic
1021085144 7:16413971-16413993 ATCATTGTATGTTAATCTATTGG - Intronic
1021123946 7:16828419-16828441 ATTTTTGTAGGTTTATCTTGTGG - Intronic
1021233876 7:18118752-18118774 ATTTTTGTATATTCTTTTTAGGG + Intronic
1021310928 7:19094828-19094850 ATTTTTGTACTTTTATGTAAGGG - Intronic
1021581794 7:22162407-22162429 ATTTTTGAATGTTCATCTTCAGG + Exonic
1021909796 7:25373552-25373574 ATTTTGGTATATTCATATCATGG - Intergenic
1022402852 7:30057384-30057406 ATTGTGGTATATTCATTTAATGG - Intronic
1022870595 7:34473873-34473895 ATTTTTGTATATTCTACCAATGG - Intergenic
1023001095 7:35808268-35808290 TTTCTTGTATGTTCTTCCAAAGG + Intronic
1023037910 7:36149019-36149041 ATTTTCGTATATTACTCTAAAGG - Intergenic
1023066861 7:36386921-36386943 AGTTTTGCATGTGCATATAAAGG + Intronic
1023807969 7:43888075-43888097 AATTGTGTATGTTTATCTATAGG + Intronic
1024878479 7:54055644-54055666 ATTTGTGTGTGTTTATGTAAAGG - Intergenic
1024912450 7:54460758-54460780 ATTTTTGTATGTACATAAGAAGG + Intergenic
1025571371 7:62574871-62574893 CTTTTTGTATTGTCTTCTAATGG - Intergenic
1025761116 7:64393494-64393516 ATATTTGTATTTTCTTATAAGGG + Intergenic
1025761124 7:64393673-64393695 ATATTTGTATTTTCTTGTAAGGG + Intergenic
1025761179 7:64395041-64395063 ATATTTGTATTTTCTTATAAGGG + Intergenic
1025761203 7:64395554-64395576 ATATTTTTATGTTCCTATAAGGG + Intergenic
1025761379 7:64398408-64398430 ATTTTTGTATTTTCTTATAGGGG + Intergenic
1027708935 7:81572524-81572546 ATCTTTGTATTTATATCTAATGG + Intergenic
1028020845 7:85769014-85769036 ATTTTTACATGTCCATCTCAAGG + Intergenic
1028171969 7:87609008-87609030 ATTTTTGTATGTTTTGCTCATGG - Intronic
1028174335 7:87635956-87635978 ATTGTGGTATATTCATCCAATGG - Intronic
1028458710 7:91067209-91067231 AATTATGTTTTTTCATCTAATGG + Intronic
1028947473 7:96596823-96596845 ATTTTTGTATTTTCAGCAGATGG - Intronic
1028967173 7:96815231-96815253 TTTTTTGTATGTTTATCTTCAGG + Intergenic
1029488573 7:100857945-100857967 ATTTTTGTATTTTTATTTTATGG - Intronic
1029998147 7:105029898-105029920 GTTTTTTCATGTTCATTTAAAGG + Intronic
1030124896 7:106144322-106144344 ATATTTGGATTTTCATCTAGCGG - Intergenic
1030217657 7:107062414-107062436 ATTGTGGTATATTCATATAAGGG + Intronic
1030307263 7:108031762-108031784 ATTGTTGTATGTTCAAACAATGG - Intronic
1031638016 7:124125682-124125704 ATTATTGTATGTTCATCTTCAGG + Intergenic
1031665183 7:124474871-124474893 ATTTTTCTATGTCCCTCTTAAGG - Intergenic
1032371116 7:131353325-131353347 ATTTTTTTTTATTCCTCTAATGG + Intronic
1032911661 7:136439117-136439139 ATTTCTGTATTTACCTCTAAAGG - Intergenic
1034347202 7:150394300-150394322 ATTTTTGTATGTTTTTGTACTGG + Intronic
1035193481 7:157193966-157193988 GTTTTTGTATGTGCATCTATAGG + Intronic
1037004071 8:13754869-13754891 ACTTTTGTTTGCTCTTCTAATGG - Intergenic
1037494161 8:19422845-19422867 ATTTTTACCTGTTCATCTAAAGG + Intronic
1038992153 8:32879396-32879418 AATTCTGAATGTTCTTCTAAGGG + Intergenic
1039695365 8:39904849-39904871 TTTTTTGTGTGTTCTTCAAAGGG - Intronic
1040116770 8:43630612-43630634 CTTTTTGTATAATCATCAAAGGG + Intergenic
1040904992 8:52459257-52459279 ATTCTAGGATGTTTATCTAAGGG - Intronic
1041003432 8:53474771-53474793 TTGTTTGTATGTTTTTCTAAAGG + Intergenic
1041126771 8:54649247-54649269 ATTTTTGAATGATCTTCTACAGG - Intergenic
1041397829 8:57409875-57409897 ATTATGGTATATTCATATAATGG + Intergenic
1041411232 8:57558241-57558263 GTTTTTGTATGTGCATCTATAGG - Intergenic
1041492592 8:58451183-58451205 GTTTTTGTATGTGCATCTATAGG - Exonic
1042404843 8:68392451-68392473 ATTCTTGTATGTGCAACTCAAGG - Intronic
1043964413 8:86456729-86456751 ATTGTTGTATATTCATATAATGG + Intronic
1044022566 8:87124559-87124581 ATTTTTCTATGTCCATTAAATGG - Intronic
1044393408 8:91680328-91680350 ATTTAGGTATGTTTATCAAAGGG - Intergenic
1045536926 8:103038629-103038651 ATTTTAGTTTATTCATATAATGG + Intronic
1045561022 8:103263001-103263023 ATTTGTGTCTTTTAATCTAAGGG - Intergenic
1046403762 8:113744191-113744213 ATATGAGTATGTTCTTCTAAGGG - Intergenic
1046413525 8:113880029-113880051 GTTTTTGTTTCTTCATGTAATGG - Intergenic
1047232549 8:123009782-123009804 TTTTTTTGTTGTTCATCTAAGGG - Intergenic
1047418381 8:124685020-124685042 ATTTTTGTGTGTTTTTCTCATGG + Intronic
1047867672 8:129045045-129045067 ATTGTAGTATATTCATATAATGG - Intergenic
1050196656 9:3091410-3091432 ATTTTTATGTGTTCATATATTGG + Intergenic
1051327089 9:15983768-15983790 ATTTGTGTTTGTTCATCCCAAGG + Intronic
1051550645 9:18325230-18325252 ACTTTTGTATATTTACCTAAGGG + Intergenic
1052062553 9:23978712-23978734 ATTTTTGTATTTTTTTGTAAAGG + Intergenic
1052395214 9:27930321-27930343 ATTTTTGTGTGTTATTTTAAAGG + Intergenic
1052676965 9:31638995-31639017 AGTTTTTAATGTTCATCTATAGG + Intergenic
1052924843 9:34006506-34006528 ATTTTTGTATTTTTTTGTAAAGG - Intronic
1053256658 9:36622948-36622970 ATTTGTGTTTGTTTATTTAAGGG - Intronic
1054705689 9:68459510-68459532 ATTCTTGTTGTTTCATCTAATGG + Intronic
1054760417 9:68999648-68999670 ATTCTTGTATGCTAATGTAAGGG + Intronic
1054810304 9:69429019-69429041 GGTTATGTATGTTCACCTAAAGG - Exonic
1055084540 9:72300690-72300712 ATTTTAGTAAGATCATCTTATGG - Intergenic
1057437759 9:95058154-95058176 ATTTTTGTAGGTTCACATATAGG + Intronic
1058158523 9:101542101-101542123 ATTCTTATATGCTCATCCAATGG - Intronic
1058287637 9:103199369-103199391 AATTCTGTATGTTGATCTATTGG - Intergenic
1058440754 9:105004297-105004319 ATTATTGTATGTTTATACAATGG - Intergenic
1058857664 9:109080173-109080195 ATTTTGGTATGTTCTTTTCAAGG - Intronic
1059743062 9:117171908-117171930 ATTTTAGTAAATTCATATAAGGG + Intronic
1059886456 9:118749822-118749844 ATTTCTTTATGTTCATTTATTGG - Intergenic
1060287005 9:122262750-122262772 ATTTTTGTATTTTCTTGTAGAGG + Intronic
1060370071 9:123060421-123060443 ATTATGGTATATCCATCTAATGG - Intronic
1060744104 9:126118821-126118843 ATTTTTGTATGTTTGGCAAATGG - Intergenic
1060956145 9:127641712-127641734 ATTATTGTATGTTCATACTATGG + Intronic
1061356759 9:130111361-130111383 ATTTTTGTATCTTTTTCTAGAGG - Intronic
1185895807 X:3857909-3857931 ATTTTTGTATTTTCATTTTTGGG - Intergenic
1185900926 X:3896333-3896355 ATTTTTGTATTTTCATTTTTGGG - Intergenic
1185906041 X:3934772-3934794 ATTTTTGTATTTTCATTTTTGGG - Intergenic
1186192581 X:7080616-7080638 ATTTTAGTATTTTTAACTAATGG - Intronic
1188317938 X:28698746-28698768 ATTTTTGTATGTTGTTTCAATGG - Intronic
1188694481 X:33173361-33173383 GTTTATGTATTTTCATCAAAAGG + Intronic
1188914476 X:35892620-35892642 ATTTTTCTCTGTCCTTCTAATGG - Intergenic
1188947740 X:36328126-36328148 ATTTTTGTATATTCAACATAAGG - Intronic
1189789969 X:44594243-44594265 ATTGTAGTATATTCATATAATGG - Intergenic
1190008993 X:46766949-46766971 ACTGTTGTATGTTCATACAATGG + Intergenic
1190412244 X:50148418-50148440 ATTTCTGTTTGTTCATTTAGTGG - Intergenic
1191269162 X:58440253-58440275 ATTTTTGTACATTCTTCAAATGG - Intergenic
1191573403 X:62662132-62662154 CTTTTTGTATTATCATCAAATGG + Intergenic
1191587196 X:62841120-62841142 AATTTTATATGTTAGTCTAAAGG + Intergenic
1191995287 X:67088980-67089002 GTGTTTGTATGTGCATCTTAGGG - Intergenic
1192297214 X:69863671-69863693 ATGTATGTATGTGCATCTACAGG + Intronic
1192375728 X:70559711-70559733 ATTGTGGTATGTTCATACAATGG - Intronic
1192775373 X:74239284-74239306 AATTTTTCATGTTCATCTCAGGG - Intergenic
1192780011 X:74284226-74284248 ATTTTGGTGTATTCATGTAATGG - Intergenic
1192880413 X:75277096-75277118 ATTGTGGTATATTCATATAATGG - Intronic
1192882746 X:75304471-75304493 ATTTGTATATGTTCATCTTTAGG + Exonic
1194288004 X:92034898-92034920 ATTTTTGTATATCCATTTTAGGG + Intronic
1194419549 X:93656556-93656578 ATTTTTATCTGTTCCTCCAAAGG - Intergenic
1194644005 X:96436160-96436182 ATCTTAGTATGTTTATTTAATGG + Intergenic
1194931266 X:99890027-99890049 ATTTTTTTTTTTTCATGTAAAGG - Intergenic
1195284298 X:103368349-103368371 ATTTTTATATTTTTATCAAATGG + Intergenic
1195511455 X:105720562-105720584 ATTTTTGTATAATCACGTAATGG - Intronic
1195511490 X:105721084-105721106 ATTGTTGTATAGTCATATAATGG + Intronic
1195634708 X:107100880-107100902 ACTATGGTATGTTCATATAAAGG + Intronic
1196389721 X:115194809-115194831 ATTTTTGTAGCTTCTTCTACTGG + Intronic
1196635373 X:117995866-117995888 ATTGTGGTATGTACATATAATGG - Intronic
1197088842 X:122511882-122511904 ATTTTTATATGTTCATCTCTGGG - Intergenic
1197725545 X:129773990-129774012 ATTGTTGTATGGTCACCTACTGG - Intergenic
1197988903 X:132296045-132296067 ATTTGTGAATGCTCATCAAAAGG - Intergenic
1198319118 X:135501404-135501426 ATTCTTTTATGTTCTTTTAATGG + Intergenic
1198759863 X:140020474-140020496 ATTGTTGTATATTCATACAATGG + Intergenic
1198891865 X:141405340-141405362 ATTTATGTGTGCTCCTCTAATGG - Intergenic
1199299258 X:146194059-146194081 CTTTTTGTGTGTTTATCCAAGGG + Intergenic
1200904563 Y:8468624-8468646 ATTTTTTTGTGTCCATCTCATGG + Intergenic
1201603525 Y:15759274-15759296 ATTTTTATTTGTTAATTTAAAGG + Intergenic
1201885527 Y:18877591-18877613 ATTTTTGTATTTTTTTGTAATGG + Intergenic
1202099456 Y:21291233-21291255 ATTTGTGTATGTTGACCCAATGG - Intergenic