ID: 1011109237

View in Genome Browser
Species Human (GRCh38)
Location 6:83818659-83818681
Sequence TAGGATCTACACCCTCAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011109237_1011109243 28 Left 1011109237 6:83818659-83818681 CCTTGCTGAGGGTGTAGATCCTA No data
Right 1011109243 6:83818710-83818732 AGCTCATGCTTCTTTACAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011109237 Original CRISPR TAGGATCTACACCCTCAGCA AGG (reversed) Intergenic
No off target data available for this crispr