ID: 1011109707

View in Genome Browser
Species Human (GRCh38)
Location 6:83823509-83823531
Sequence TCATTTCAATAAAGGCATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011109703_1011109707 -8 Left 1011109703 6:83823494-83823516 CCTCCAAGGACAGTGTCATTTCA No data
Right 1011109707 6:83823509-83823531 TCATTTCAATAAAGGCATGTGGG No data
1011109701_1011109707 9 Left 1011109701 6:83823477-83823499 CCTCGGGTTAAGAAAGACCTCCA No data
Right 1011109707 6:83823509-83823531 TCATTTCAATAAAGGCATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011109707 Original CRISPR TCATTTCAATAAAGGCATGT GGG Intergenic