ID: 1011111087

View in Genome Browser
Species Human (GRCh38)
Location 6:83837287-83837309
Sequence AACAAGGACTTGTGTACAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011111079_1011111087 27 Left 1011111079 6:83837237-83837259 CCTAAACATTTAGTCTGTCTTAG No data
Right 1011111087 6:83837287-83837309 AACAAGGACTTGTGTACAGGAGG No data
1011111082_1011111087 4 Left 1011111082 6:83837260-83837282 CCTGGGTTTTCTCCGAACAGAGC No data
Right 1011111087 6:83837287-83837309 AACAAGGACTTGTGTACAGGAGG No data
1011111084_1011111087 -8 Left 1011111084 6:83837272-83837294 CCGAACAGAGCCTAAAACAAGGA No data
Right 1011111087 6:83837287-83837309 AACAAGGACTTGTGTACAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011111087 Original CRISPR AACAAGGACTTGTGTACAGG AGG Intergenic
No off target data available for this crispr