ID: 1011113757

View in Genome Browser
Species Human (GRCh38)
Location 6:83867106-83867128
Sequence GCAGAGTGAAGCACCTTAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011113754_1011113757 14 Left 1011113754 6:83867069-83867091 CCCTGCTGATGGAGGAAGGATAA 0: 1
1: 0
2: 0
3: 21
4: 181
Right 1011113757 6:83867106-83867128 GCAGAGTGAAGCACCTTAAGAGG No data
1011113755_1011113757 13 Left 1011113755 6:83867070-83867092 CCTGCTGATGGAGGAAGGATAAA 0: 1
1: 0
2: 0
3: 17
4: 216
Right 1011113757 6:83867106-83867128 GCAGAGTGAAGCACCTTAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011113757 Original CRISPR GCAGAGTGAAGCACCTTAAG AGG Intronic
No off target data available for this crispr