ID: 1011113776

View in Genome Browser
Species Human (GRCh38)
Location 6:83867277-83867299
Sequence CTGTGTTTGTACCTTTGTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 266}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011113776_1011113781 16 Left 1011113776 6:83867277-83867299 CCTGAACAAAGGTACAAACACAG 0: 1
1: 0
2: 1
3: 27
4: 266
Right 1011113781 6:83867316-83867338 CTGGAGCTTAGGTTAATTGTTGG 0: 1
1: 0
2: 1
3: 8
4: 184
1011113776_1011113779 -3 Left 1011113776 6:83867277-83867299 CCTGAACAAAGGTACAAACACAG 0: 1
1: 0
2: 1
3: 27
4: 266
Right 1011113779 6:83867297-83867319 CAGGAAAGTTTGAGGTGTTCTGG 0: 1
1: 0
2: 1
3: 23
4: 222
1011113776_1011113780 5 Left 1011113776 6:83867277-83867299 CCTGAACAAAGGTACAAACACAG 0: 1
1: 0
2: 1
3: 27
4: 266
Right 1011113780 6:83867305-83867327 TTTGAGGTGTTCTGGAGCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011113776 Original CRISPR CTGTGTTTGTACCTTTGTTC AGG (reversed) Intronic
900202648 1:1418020-1418042 CTGCATTAGCACCTTTGTTCTGG - Intergenic
901270048 1:7945199-7945221 CTCTGTTTGTACTCTTGTCCTGG - Intergenic
901927032 1:12572853-12572875 CTGTGTCTCTTCCTGTGTTCAGG - Exonic
903185042 1:21624128-21624150 CTGTGTATGTACGTGTGTGCAGG + Intronic
903533549 1:24050897-24050919 CAGTGTCTGTCCCTTTGATCAGG + Intergenic
904437509 1:30508216-30508238 CTGTGCTTGGACCTCTGTTCAGG - Intergenic
904506428 1:30959362-30959384 GTGTGTTTGTATTTTTGTTGAGG - Intronic
905495024 1:38378112-38378134 TTGTCTGTGTCCCTTTGTTCAGG + Intergenic
906996763 1:50803871-50803893 CTTTTATTGTACCTTTATTCTGG - Intronic
907839559 1:58143175-58143197 CTGTGTGTGTACATTTGGTGAGG - Intronic
908415614 1:63910627-63910649 CTGTGTTGGGACCTTTATCCTGG + Intronic
908426264 1:64010520-64010542 CTGAGTTTCTACTTTAGTTCAGG + Intronic
908980469 1:69950736-69950758 CTCTGTTTCCACCTTAGTTCTGG - Intronic
911244930 1:95506532-95506554 CTGTGTTTGTTCCTATGTCCAGG + Intergenic
912718256 1:111998042-111998064 CTGTGATTGCACCTTTGTTATGG + Intergenic
912998428 1:114554985-114555007 CTTTGTTTGTACCTCTTTTATGG - Intergenic
915908357 1:159896289-159896311 CTGTTTTTCTTCCTCTGTTCTGG - Intronic
916582701 1:166122961-166122983 CTGTGTTTATACCTTCGTCCTGG - Intronic
916915639 1:169403420-169403442 CTGTGTTTTTACATTTGCTGAGG - Intronic
919118685 1:193313040-193313062 CTCTGTTTGTACCTTCGTGTTGG + Intergenic
919218413 1:194591983-194592005 CTGTGTATCTTCCTTTTTTCAGG + Intergenic
919221602 1:194637643-194637665 CTGTGTTTGTGCTTTTATTCTGG + Intergenic
920658172 1:207891852-207891874 CTTTGGTTGTACCTTTCTTATGG - Intronic
920794207 1:209123181-209123203 CTGGCTTTTTACCTTTGTACTGG - Intergenic
1063288757 10:4718341-4718363 ATGTGTGGGTACCTTTTTTCTGG - Intergenic
1063504397 10:6582792-6582814 CTGGGTTTGAATCTTGGTTCTGG - Intergenic
1064078812 10:12291701-12291723 CTGTGGTTGTTGTTTTGTTCTGG + Intergenic
1064296158 10:14080611-14080633 CTGTGATTGTAGCTGTGTCCAGG - Intronic
1064878998 10:20028986-20029008 CTGTGTATGAGCTTTTGTTCTGG + Intronic
1065052922 10:21814243-21814265 CTGTGTTTGAACCTATTTCCTGG - Intronic
1066004899 10:31137212-31137234 TTGTGGTTTTACTTTTGTTCTGG - Intergenic
1067571877 10:47377836-47377858 CTGTGTTTGCACCCTGGTTGAGG + Intronic
1069586075 10:69603362-69603384 CTGTTTGTGTTGCTTTGTTCTGG - Intergenic
1069680525 10:70281927-70281949 CTGTGTTTGGTCATTTCTTCTGG + Intronic
1070585869 10:77765580-77765602 CTTTGTTTGTACTTTTCTTAGGG + Intergenic
1071007299 10:80897229-80897251 CCCTGTTTTTACCATTGTTCGGG + Intergenic
1071682105 10:87716661-87716683 CTGTGTTTGTGCCTTTGCCTGGG + Intronic
1071859774 10:89660531-89660553 CTGTATTTGTTCATTTGTTAAGG - Intergenic
1072483581 10:95832446-95832468 CTGGGAAAGTACCTTTGTTCTGG + Intronic
1072509181 10:96101217-96101239 ATGTGTTTGCACATTTGTACTGG + Intergenic
1072621463 10:97082164-97082186 CTGTGCTTGCATCTGTGTTCAGG - Intronic
1072689275 10:97560968-97560990 CTGCATTGGTACTTTTGTTCTGG - Intronic
1073494237 10:103876857-103876879 CTGTGTATGTGCCTATTTTCTGG + Intergenic
1075212737 10:120504815-120504837 CTCTGTTTAAACCTCTGTTCTGG + Intronic
1076890311 10:133280207-133280229 CTGTGTTTGTGCCTTTGAGCAGG - Intronic
1081750703 11:45508832-45508854 CTGTGTCTGTGCCTTTGCTTGGG + Intergenic
1083096155 11:60253645-60253667 CTGTGTTTCTTCATTTGTTTGGG + Intergenic
1083106327 11:60361704-60361726 CTGTGTTTCTTCATTTGTTTTGG - Intronic
1083806486 11:65077359-65077381 CTGGGGTTGTCCCTTTGTCCAGG - Intronic
1085819468 11:79776819-79776841 CTCTATTTGTACCCTTTTTCGGG + Intergenic
1086123948 11:83330677-83330699 CTGTGTTTGTGCCTTTGGGCAGG + Intergenic
1086480705 11:87234726-87234748 CTGGGTTTGAATCTTAGTTCTGG - Intronic
1087909448 11:103736295-103736317 CTGTGTTTATACCTTTCATTTGG + Intergenic
1088651974 11:111965880-111965902 CTAGGTTTGTACCTCTGTTTTGG - Intronic
1089027544 11:115287503-115287525 CTGTGTTTGAACGCTTCTTCTGG - Intronic
1090130637 11:124137831-124137853 CTGTCTTTATATATTTGTTCTGG + Intronic
1093901473 12:24639289-24639311 ATTTGTTTTTACCTTTCTTCGGG - Intergenic
1094356301 12:29581677-29581699 CACTGTTAGTACCTTTATTCAGG + Intronic
1094644523 12:32309283-32309305 ATGTGTCAGTACCATTGTTCTGG + Intronic
1097394594 12:59058372-59058394 CAGTGTATGTTTCTTTGTTCTGG - Intergenic
1097456671 12:59806819-59806841 GTGTGTTTGTATGTTTGTGCAGG + Intergenic
1097768555 12:63553297-63553319 CTGTTTTTGAGCCTTTGTTGGGG + Intergenic
1099986041 12:89665699-89665721 CTGTGTTTTTCCTTCTGTTCAGG + Intronic
1100804069 12:98262604-98262626 CTGTGTTTGTAGCCATGTTGAGG - Intergenic
1105770179 13:23602623-23602645 CTATGCTTTTACCTTTGTTAAGG - Intronic
1106833750 13:33612401-33612423 GTGTGTGTGTGCCTTTGTTTAGG + Intergenic
1106993153 13:35448520-35448542 CTGAGTTTATACATTTATTCAGG + Intronic
1108026647 13:46184949-46184971 GTGTGTATGTACTTTTTTTCTGG + Intronic
1108995353 13:56726048-56726070 CCTTGTTTTTACCATTGTTCAGG + Intergenic
1112502779 13:99955574-99955596 CTGAGTTTCTACCTTGGTTCTGG - Intergenic
1112952673 13:105020444-105020466 CTGTGCTTGTATCTTTATGCTGG + Intergenic
1115106569 14:29769111-29769133 CTGTCTTTTTAACTTTTTTCAGG - Intronic
1118307429 14:64667080-64667102 CTGTGTTAGTTCCTTTGTGTTGG + Intergenic
1119360157 14:74042567-74042589 CTGTGTCTGTCCCTTTTATCTGG + Intronic
1119986206 14:79140899-79140921 ATGTGTTTGTATGTTTATTCAGG - Intronic
1120513506 14:85443375-85443397 CTGTGGTGGTCCCTTTCTTCTGG + Intergenic
1122025505 14:98873007-98873029 CCTGGTCTGTACCTTTGTTCAGG + Intergenic
1125299296 15:38237447-38237469 CTGTCCTTGTATCTTTGTTAGGG + Intergenic
1125407488 15:39368906-39368928 CTTTGTGTGTAGCTTAGTTCTGG - Intergenic
1125436952 15:39656374-39656396 CTGGGTTTGTAACTTCGTTTTGG - Intronic
1127673733 15:61220583-61220605 CTGTCTTTGTCCATTTCTTCAGG + Intronic
1130314374 15:82782505-82782527 CAGTCTTTGTTCCTCTGTTCTGG - Intronic
1131827558 15:96332962-96332984 CTGAGATTGTACTTTTGTACAGG + Intronic
1132345285 15:101104501-101104523 CTCTGTTTGTCACTTGGTTCTGG - Intergenic
1133691009 16:8215150-8215172 CTGTTCATGTACCTTTATTCAGG + Intergenic
1134006701 16:10822791-10822813 CTGTGTGTGTACCTCTGTCCAGG - Intergenic
1134285468 16:12857905-12857927 CTGTGTGTGTATTTTTTTTCTGG + Intergenic
1134639190 16:15815729-15815751 CTGTCTTTGTACCCCTATTCAGG - Intronic
1135523663 16:23197038-23197060 CTGTGTTTGAACCCCTGTTTTGG + Intronic
1135780407 16:25295000-25295022 CAGTTTTTGTACTTTTGCTCTGG - Intergenic
1136411822 16:30082187-30082209 CTGTGTTAGTAACTTGATTCTGG + Intronic
1137549654 16:49428534-49428556 CCCTGTTTTTACCTGTGTTCTGG - Intergenic
1138756428 16:59491868-59491890 CTGTGTTTGCATGTTTATTCAGG - Intergenic
1138946931 16:61862916-61862938 CTGTTTTTGTCCCTTTGTCAAGG + Intronic
1144405425 17:14948327-14948349 CTCTTTCTGTACCTTTGTCCAGG - Intergenic
1144461902 17:15465122-15465144 CTGTGTTTGTATCTGTGTGTTGG - Intronic
1145788902 17:27612152-27612174 CTGTGTTTGTAAGTTTTGTCAGG + Intronic
1146822393 17:35994104-35994126 CTGTGCTTGTAGCTTTATCCTGG - Intronic
1149303859 17:55330201-55330223 CTTTTTTTGTAACTTTCTTCTGG + Intergenic
1149816587 17:59730704-59730726 CTGTGATTGTATCATTCTTCAGG - Intronic
1149823604 17:59805353-59805375 CTGTGTTTTGACCTCTTTTCAGG + Intronic
1150127397 17:62646923-62646945 CTGGGTATGTACAGTTGTTCTGG + Intronic
1150151301 17:62810646-62810668 CTGTTTTTGAACCCTGGTTCTGG - Intergenic
1150829567 17:68506965-68506987 CTGTGTGTGTATGTTTGTTTGGG + Intergenic
1152203618 17:78961645-78961667 CTGTGTTAGCACCTTTGTTGGGG - Intergenic
1153096234 18:1407540-1407562 CAGTTTTTGTATCTTTGTTCAGG - Intergenic
1153985737 18:10349630-10349652 CTATTTTTATTCCTTTGTTCAGG + Intergenic
1159716151 18:71825910-71825932 CTGTGTTAGCACACTTGTTCTGG + Intergenic
1160087236 18:75787994-75788016 CTGTGTTTACAGCTCTGTTCAGG - Intergenic
1160409439 18:78665628-78665650 GTGCGTTTGAACCTTTGTACAGG - Intergenic
1163114249 19:15179579-15179601 CTGTGTGTGTCCTTTTGTGCTGG - Intronic
1163934620 19:20431763-20431785 CTGTATTGGCACTTTTGTTCTGG - Intergenic
1166996566 19:46722393-46722415 CTGCGCTTGTGCCTCTGTTCTGG - Intronic
925451171 2:3970278-3970300 CTTTGTTTTTCCCTTTCTTCTGG - Intergenic
928768656 2:34677998-34678020 CTGTATTGGCACTTTTGTTCTGG + Intergenic
928923369 2:36549915-36549937 CTGTTTATCTGCCTTTGTTCTGG - Exonic
930763065 2:55057033-55057055 TTGTGTTTGTGCATTTTTTCTGG - Intronic
930843751 2:55878754-55878776 CTGAGTCTGAATCTTTGTTCTGG + Intronic
931607060 2:64063066-64063088 CAGTGTTTGTACAGCTGTTCAGG + Intergenic
931857316 2:66316805-66316827 CTCTGTTTCTACCCTTTTTCTGG + Intergenic
933330577 2:80887973-80887995 CCCTGTTTTCACCTTTGTTCAGG - Intergenic
935310715 2:101780484-101780506 CTGTGTTTTGTCTTTTGTTCTGG + Intronic
935600651 2:104918529-104918551 CCCTGTGTGTACCTGTGTTCAGG - Intergenic
935673729 2:105576594-105576616 CTTTGTTTGTCTCTTTGTCCTGG - Intergenic
937729477 2:125210358-125210380 TTGTGTTTCTCTCTTTGTTCAGG - Intergenic
938124754 2:128663840-128663862 CTGTGTTAGTATTTTTGGTCGGG + Intergenic
938593850 2:132766725-132766747 CTGTGGTTGTTTCTTTGGTCAGG - Intronic
938994083 2:136659099-136659121 TTTTGTTTGTATCTTTTTTCAGG - Intergenic
939051879 2:137317143-137317165 CTGTTCTTTTATCTTTGTTCAGG + Intronic
939053452 2:137333432-137333454 GTGTGTCTGTACCTTTTTCCAGG + Intronic
940888198 2:159009207-159009229 CTGTGTTTTTAGCTTTTTTGAGG - Intronic
941620281 2:167770074-167770096 CTGTGTTTGTATGTTTATTTAGG + Intergenic
943056821 2:182992160-182992182 CTTTCTTTGGACCTTTGTTCTGG - Intronic
943175183 2:184463688-184463710 CTGTTATTGTACCTTACTTCTGG - Intergenic
943203731 2:184862908-184862930 CTGTTTTTGTTTCTTTGTTTTGG + Intronic
944302072 2:198134891-198134913 TTGTATTTGCACTTTTGTTCTGG + Intronic
945255311 2:207798280-207798302 CTGTGTTTGTATCTGTGCTTTGG + Intergenic
945580072 2:211582058-211582080 CTGTGTTTGCACATATCTTCTGG + Intronic
946738749 2:222780704-222780726 CTGTTTTTGTTACTTTGTTATGG + Intergenic
947105659 2:226665115-226665137 CTGTGTGTCTAACTTTGTGCCGG - Intergenic
947135998 2:226977118-226977140 TTGTTTCTGTGCCTTTGTTCTGG + Intronic
947244301 2:228030076-228030098 CTTTGTTTTTATCTTGGTTCAGG - Intronic
948440546 2:237984402-237984424 TTGTTTTGGGACCTTTGTTCTGG + Intronic
1170438468 20:16353728-16353750 CTGTTTTTGTTGTTTTGTTCTGG + Intronic
1172833426 20:37856357-37856379 CTGGATTTGTACCTCTGTTGTGG - Intronic
1172864280 20:38083717-38083739 CTTTGTGTGTACCTTTATTACGG + Intronic
1177077182 21:16590366-16590388 CTATGTATGTTCTTTTGTTCTGG - Intergenic
1177450007 21:21254069-21254091 CTGAGATTGTACCCTTGTTTTGG - Intronic
1177499543 21:21934788-21934810 CTCTGTTCGTGCCTTTGTCCAGG - Intergenic
1178122888 21:29487065-29487087 CTTTGTTTGTGCCTTTGTTTGGG - Intronic
1178910666 21:36670699-36670721 TTTTGTTTATACCTTTATTCTGG + Intergenic
1183769075 22:39907950-39907972 CTGTGTTTGGACCAGTGTTGTGG - Intronic
949651867 3:6169000-6169022 CTGTGTTTGTTTCTTTCATCAGG + Intergenic
949958543 3:9290950-9290972 GTGTGTGTGTACGTGTGTTCTGG + Intronic
950381861 3:12622768-12622790 CTGTTTTTGTAGCATTATTCTGG - Intronic
952492806 3:33888162-33888184 CTTTGTTTTTACCTCTGTTCAGG + Intergenic
956785278 3:72637259-72637281 CTGTGTTTACACCATTGCTCTGG - Intergenic
956995918 3:74825838-74825860 CTGTATTGGCACCTTTGTTCTGG + Intergenic
958569005 3:95855587-95855609 TAGTATTTGTACCTTCGTTCTGG - Intergenic
960773429 3:121220766-121220788 CTGGGTTTGAATCTTTGTCCTGG + Intronic
961627524 3:128274201-128274223 TTGGGTTTGTACCTATGTGCTGG + Intronic
962755447 3:138462317-138462339 TGGTGTTTGTACCATTTTTCTGG - Intronic
962946976 3:140180872-140180894 CTCTGTTTGTCCTTTTGTTCAGG + Intronic
966172995 3:177103678-177103700 TTGTGTTTGTACCTTTGTCTAGG - Intronic
966318082 3:178671111-178671133 GTGTGTTTGTACGTGTGTTTTGG - Intronic
966683214 3:182665836-182665858 GTTTGTTTGTACATTTGTTTGGG + Intergenic
969072128 4:4547906-4547928 CTGGGTCTGTACCTTTCTTGTGG + Intergenic
969147157 4:5133963-5133985 CTTTGTTTAAACCTTTGTCCAGG + Intronic
970320065 4:14866848-14866870 CTTTGTTTGTAACTTTTATCAGG - Intergenic
971027210 4:22600060-22600082 CTGTATTGGCACCTTTGTTCTGG + Intergenic
972076912 4:35101345-35101367 CTGTATCTGCACTTTTGTTCTGG + Intergenic
973197693 4:47463882-47463904 CGCAGTTTGTACCTTTGTTTAGG + Intergenic
973787768 4:54349486-54349508 CATTGTTTGTTTCTTTGTTCTGG + Intergenic
974949940 4:68575858-68575880 CTGTGTTGGCACCTTTGTTCTGG - Intronic
974987860 4:69051673-69051695 CTGTATTGGCACCTTTGTTCTGG + Intronic
978576522 4:110195929-110195951 CTTTATCTGTACCTTTCTTCTGG - Intronic
979052373 4:115951196-115951218 CTGTATTGGCACTTTTGTTCTGG + Intergenic
979122107 4:116916579-116916601 CTGTGTTTGTATATGTGTTTAGG + Intergenic
979817774 4:125131688-125131710 GTGTGTTTATATCTTTATTCAGG + Intergenic
980413553 4:132455777-132455799 CTGTGTTTTTACTATTGTACTGG - Intergenic
981972626 4:150683954-150683976 CTGTCTTTGTCTCATTGTTCAGG - Intronic
982365173 4:154570183-154570205 CTGTGTTTGTTACTTTATACTGG - Intronic
983811506 4:172067814-172067836 CTCTGTTTTCACCTTTGGTCAGG - Intronic
984769947 4:183428632-183428654 TTGTGTATGTACTCTTGTTCTGG - Intergenic
985716161 5:1463147-1463169 CAGTGTTTCTACCTGTGTGCTGG - Exonic
987771092 5:22306081-22306103 ATGTCTTTATACTTTTGTTCAGG + Intronic
988712200 5:33789746-33789768 CTGTGTTTGTTCATTTGTCAGGG - Intronic
989557465 5:42813990-42814012 CTGTATTGGCACTTTTGTTCTGG + Intronic
989775963 5:45207049-45207071 CTGTATTCGCACTTTTGTTCTGG + Intergenic
992989791 5:82272919-82272941 CTGTATTGGCACTTTTGTTCTGG - Intronic
993528035 5:88990802-88990824 CTGTTCTTTTACATTTGTTCAGG + Intergenic
994044000 5:95287417-95287439 CTTTCTTTGTAGCTCTGTTCTGG + Intergenic
995076416 5:107990106-107990128 CTGTGGTTGTTGCTTTCTTCTGG + Intronic
996964868 5:129295780-129295802 TTCTCTGTGTACCTTTGTTCAGG - Intergenic
997006451 5:129822215-129822237 CTGTGATGGTAACTTTGCTCTGG + Intergenic
997844460 5:137274112-137274134 CTGTGTTTGGGCTTTTCTTCTGG + Intronic
998210367 5:140192628-140192650 CTTTGTGTATACCTTTGTACAGG + Intronic
1000605000 5:163318573-163318595 CTGTATTGGCACTTTTGTTCTGG - Intergenic
1000605016 5:163318686-163318708 CTGTATTGGCACTTTTGTTCTGG - Intergenic
1000667546 5:164017293-164017315 CTGTGTTTTTACCATAGTTCAGG + Intergenic
1002197803 5:177510531-177510553 CTGTGTGTATACCTTTATTCTGG + Intronic
1003517139 6:6826733-6826755 CTCTGTTTGTAGCTCTGTGCTGG + Intergenic
1003961789 6:11215677-11215699 CTCTGTCTGTCCCTTTCTTCTGG + Intronic
1004074916 6:12336319-12336341 CTCTGTTTGCACTTTTGTTATGG - Intergenic
1004473420 6:15949029-15949051 CTGTGTTTAGAACATTGTTCGGG - Intergenic
1005336200 6:24799114-24799136 CTGTCTTTGAACCTTTGCTCAGG + Intronic
1005708085 6:28476802-28476824 CTGTGTTTATGCCTTTTTTGAGG - Intergenic
1006103572 6:31702310-31702332 CTGTGTTTGTTCCCATGGTCAGG - Intronic
1006995530 6:38256516-38256538 TTATGTTTTTCCCTTTGTTCAGG - Exonic
1010148711 6:72703572-72703594 ATGTCTGTGTACCTTGGTTCTGG - Intronic
1010317663 6:74469071-74469093 CTGTATTGGCATCTTTGTTCTGG + Intergenic
1011113776 6:83867277-83867299 CTGTGTTTGTACCTTTGTTCAGG - Intronic
1011813834 6:91164863-91164885 CTGAATTTGAACCTGTGTTCTGG - Intergenic
1012375379 6:98555784-98555806 CTATGTCTGTACCTCTGTTTTGG + Intergenic
1012691673 6:102320644-102320666 CTTTGTTTTTGCCTTTCTTCTGG - Intergenic
1013022637 6:106234374-106234396 CTGTAGTTGTTCCATTGTTCAGG - Intronic
1013559403 6:111289787-111289809 CTGTATTGGCACCTTTGTTCTGG - Intergenic
1014618513 6:123635098-123635120 CTGTTTCTCTACCTCTGTTCAGG - Intronic
1014851732 6:126348612-126348634 GTGTGTTTGTATTTTTTTTCTGG + Intronic
1015114880 6:129636887-129636909 CTGATTTTTTACCTTTTTTCTGG + Intronic
1015533903 6:134247422-134247444 CTGTGTTTGTGGCTTTGTGGAGG - Intronic
1017423953 6:154301448-154301470 CTGTGTGTGTACCGTTCTCCAGG + Intronic
1017583253 6:155890629-155890651 CTGTGTTTGTCTCATTGATCTGG - Intergenic
1018300308 6:162395350-162395372 CTCTGTTTGGACCTTTCTGCAGG - Intronic
1019364414 7:625023-625045 CTGTTCTTTTACATTTGTTCAGG - Intronic
1021141203 7:17028029-17028051 CTGTGTTGGTTCCTGTGTTCAGG + Intergenic
1021210546 7:17847222-17847244 GTGTGTGTGCACCTTTGTTTTGG - Intronic
1021237997 7:18166813-18166835 ATTTGTTTGTAGCTTTGTCCTGG - Intronic
1021969913 7:25955361-25955383 TTGTGTTTGTACCATTGCTGAGG - Intergenic
1022306086 7:29147754-29147776 CTCTGTTTGTACTTTTGCCCTGG - Intronic
1022309462 7:29182911-29182933 CTGAGTGTTTATCTTTGTTCTGG - Intronic
1022603908 7:31789844-31789866 CTGTGTGTGTGGCTTTTTTCAGG + Intronic
1022815783 7:33912952-33912974 CTGTGTTTGAAGCATTGTGCTGG + Intronic
1023119851 7:36898546-36898568 CTGTGCTTGTACCTTTAACCCGG - Intronic
1023733606 7:43215861-43215883 CTCTCTCTGTAGCTTTGTTCTGG + Intronic
1024987717 7:55209740-55209762 CTATTTTTGTAACTTTGTTGCGG + Exonic
1025859467 7:65312923-65312945 CTGAGTTTGTACGTTTGTCCTGG - Intergenic
1028869979 7:95759447-95759469 CTGTGTATGTGCCTTTAATCAGG - Intergenic
1031837825 7:126700044-126700066 CAGTGTGTGTGCCTTGGTTCTGG - Intronic
1032782187 7:135172154-135172176 CTGTATTGGCACTTTTGTTCTGG + Intergenic
1033580664 7:142730878-142730900 CTGTTTTTGTAGCTTTTTGCTGG + Intergenic
1034066730 7:148144159-148144181 CTTTGTTTATACCTTTTTTAAGG + Intronic
1034420452 7:150987844-150987866 GTGTGTGTGTCCGTTTGTTCAGG + Intergenic
1035787554 8:2273779-2273801 TTGTGTTTGTATCTATGTACAGG + Intergenic
1035805256 8:2447937-2447959 TTGTGTTTGTATCTATGTACAGG - Intergenic
1036566581 8:9943481-9943503 CTGGGCTTGTCCCTTTGCTCCGG + Intergenic
1037332806 8:17760888-17760910 CTGGTGTTATACCTTTGTTCTGG - Intronic
1038920016 8:32072633-32072655 CTTTGTTTTTACTTTTCTTCTGG + Intronic
1039757946 8:40543133-40543155 CTGTGTTTGTAGCTGGGTGCTGG - Intronic
1039884844 8:41649008-41649030 CTGTGTGTGTACCTGCATTCAGG + Intronic
1040565404 8:48562439-48562461 CTGTGTTTCTTCCTTTTCTCAGG + Intergenic
1040739973 8:50561422-50561444 CTGTATTTTTTCCTTTTTTCTGG - Intronic
1041300123 8:56402950-56402972 CTGTTTTTGACCCTTTGCTCTGG + Intergenic
1041956825 8:63565600-63565622 CTGTGTTTGTTCATTTCTCCGGG + Intergenic
1042340617 8:67675211-67675233 CTATGGTTGTATCTTTGTTTAGG - Intronic
1042599235 8:70481784-70481806 CTGTGTTTGTTCGTTAGTTTGGG + Intergenic
1045117118 8:98994604-98994626 ATGGGCTTGTACCTTTGTGCAGG + Intergenic
1045992263 8:108322478-108322500 CTATGTCTATATCTTTGTTCTGG + Intronic
1047498154 8:125422959-125422981 CTCTGTTTATACTCTTGTTCAGG + Intergenic
1050365038 9:4866185-4866207 CTGTGTTAGTAGCATTGTGCTGG + Intronic
1050546927 9:6716966-6716988 CACTGTTTTCACCTTTGTTCAGG - Intergenic
1050703351 9:8366109-8366131 CTGTTTTTGTTCATTTGTTTTGG - Intronic
1050897866 9:10906852-10906874 ATGTGTTTGTGCGTTTTTTCAGG + Intergenic
1051496631 9:17730897-17730919 CTGTTTTTGTCCTTTTGTTTTGG - Intronic
1051959889 9:22746093-22746115 CTGTGTTAGTCTCTTTATTCAGG - Intergenic
1052081226 9:24208171-24208193 GTATTTTTTTACCTTTGTTCAGG - Intergenic
1052742700 9:32409098-32409120 CTGTGTTTCTTCTTTTGTTTGGG + Intronic
1052867201 9:33471484-33471506 CTGCCTTTGTGCCTTTGTACTGG + Intronic
1054817922 9:69493504-69493526 TTGTGTTTGTACCATTCTTAAGG + Intronic
1056160750 9:83889953-83889975 TTGCCTTTATACCTTTGTTCTGG + Intronic
1056359390 9:85839369-85839391 TTGCCTTTATACCTTTGTTCTGG - Intergenic
1057288212 9:93777923-93777945 TTGTGTTTGTGCCCTGGTTCAGG + Intergenic
1058269363 9:102950657-102950679 GTGTTTTAGTACCTTTGCTCTGG - Intergenic
1059120299 9:111636000-111636022 CTGTGTCTTTTCCTTTGTTATGG - Intronic
1059947123 9:119420855-119420877 CTAGTTTTGTACATTTGTTCAGG + Intergenic
1060916550 9:127395339-127395361 CTGTGTTTTTCCTTTTTTTCTGG + Intergenic
1061760086 9:132844922-132844944 CTGTGTTTGCATCTCAGTTCTGG + Intronic
1062521144 9:136958515-136958537 CTCTGCTTGTGCCTTTGTCCGGG - Intergenic
1185480157 X:439908-439930 GTGTGTGTGCACCTGTGTTCAGG - Intergenic
1185568030 X:1111560-1111582 ATGTGTTTTTACATCTGTTCAGG + Intergenic
1190833934 X:54083159-54083181 CTGTGCTTGTGACTTGGTTCTGG - Intronic
1193165059 X:78270326-78270348 CTGGGTTTGAACCTTGGTTCTGG + Intergenic
1193538977 X:82747515-82747537 CCGTGCTAGTACCTTAGTTCTGG + Intergenic
1193789372 X:85799930-85799952 CTGTGTTGGTTCCTTGGTTATGG + Intergenic
1194195653 X:90888456-90888478 CTGTTTTTCTACATTTGCTCAGG - Intergenic
1195043866 X:101038500-101038522 CTGTTTTTGTTCCTTCATTCTGG - Intronic
1196348557 X:114698423-114698445 GTGTGTTTGTGCCTGTGTTCTGG - Intronic
1196786468 X:119425455-119425477 CAGTGTTTGTACCTCTGGACAGG - Intronic
1198079142 X:133222362-133222384 CTCTGTTTGTATTCTTGTTCTGG - Intergenic
1199371272 X:147052430-147052452 TTGTGTTTCTGCCTTTGTTTGGG - Intergenic
1199797631 X:151216277-151216299 ATGTGGTTGTACAGTTGTTCCGG + Intergenic
1201270145 Y:12246308-12246330 CTGTATTGGCACTTTTGTTCCGG + Intergenic
1201372769 Y:13283103-13283125 CTGTATTAGCACTTTTGTTCCGG + Intronic
1201696447 Y:16832169-16832191 CTGTATTGGCACCTTTGTTTCGG + Intergenic
1201696464 Y:16832282-16832304 CTGTACTGGCACCTTTGTTCTGG + Intergenic