ID: 1011113835

View in Genome Browser
Species Human (GRCh38)
Location 6:83867853-83867875
Sequence CTGTATGTACAGCGTAAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 1, 2: 14, 3: 23, 4: 79}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011113835 Original CRISPR CTGTATGTACAGCGTAAGCA GGG (reversed) Intronic
900484628 1:2915989-2916011 ATGTGTGTACAGTGCAAGCATGG - Intergenic
902969077 1:20033695-20033717 CTGTATGTACATTCTAACCAAGG - Intronic
908445155 1:64192619-64192641 CCATATATACAGCGTTAGCAGGG - Intergenic
908655486 1:66383513-66383535 ATGTATGTACAGTGTTAGCAGGG - Intergenic
909484072 1:76154588-76154610 CTGGATGTACAGCATTACCAAGG - Intronic
909819996 1:80050428-80050450 CCGTATATACAGCGTTAGCAGGG - Intergenic
910360326 1:86409471-86409493 CCATATGTACAGCGTTAGCAGGG + Intergenic
910361431 1:86416464-86416486 CTGTATATACAGTGTTAGCAAGG + Intergenic
918413815 1:184287294-184287316 CCGTATGTACAATGTCAGCAGGG - Intergenic
918720216 1:187842854-187842876 CCATATGTACAGCATTAGCAGGG + Intergenic
918949793 1:191122853-191122875 CTTTATCAACAGTGTAAGCATGG - Intergenic
919356840 1:196535766-196535788 CCATATGTACAGTGTCAGCATGG + Intronic
924418260 1:243882563-243882585 CCGTATGTACAGTGTCAGCAGGG - Intergenic
924448158 1:244153300-244153322 TTGTATGTACAGCGTCAGGCAGG + Intergenic
1064268920 10:13847980-13848002 CTCTATGTAGAGCATAAGGATGG - Intronic
1066219845 10:33324919-33324941 CTGTATGTACAGGCCAGGCACGG - Intronic
1069735091 10:70648788-70648810 CTGTACATACAGCGTCATCAGGG - Intergenic
1069735581 10:70651949-70651971 CCATATGTACAGCATCAGCAGGG - Intergenic
1074225606 10:111481327-111481349 CTGTATGTACAGCATGAGCAGGG + Intergenic
1079478488 11:20857088-20857110 CTGTATGCACAGCATCAGCAGGG - Intronic
1079995516 11:27291379-27291401 CTGTATGTACAGCAACAGCAGGG + Intergenic
1081826885 11:46063241-46063263 CTGTATGTACACTGAAAACAGGG - Intronic
1085040962 11:73326083-73326105 CTGTATGTGCAGGGTTAGCATGG + Intronic
1088871657 11:113895445-113895467 CTGTATGCAGATCGAAAGCAGGG + Intergenic
1089405575 11:118194709-118194731 CTGTGTGTACAGCCTCAGAAAGG + Intronic
1093525751 12:20102243-20102265 CTGTATGAACAGCCTGGGCATGG - Intergenic
1099573539 12:84355823-84355845 CCATATGTACAGTGTTAGCAGGG - Intergenic
1110131667 13:72018973-72018995 CCATATGTACAGCTTTAGCAGGG - Intergenic
1110432693 13:75443541-75443563 CTGTATGTTCTGCGTTAGAAGGG - Intronic
1114931480 14:27474249-27474271 CTATATGTACAGCTTGAGAAGGG - Intergenic
1125576726 15:40761007-40761029 CTGTATGTACAGCAAAGGAAAGG - Intergenic
1126877287 15:53057385-53057407 CTGTATGTACTTCATGAGCAGGG - Intergenic
1129922277 15:79329525-79329547 CTGTATGTGCAATGTCAGCAGGG - Intronic
1137677669 16:50311764-50311786 CTGTCTGGAGAGTGTAAGCAGGG - Exonic
1139725147 16:68891764-68891786 CTGTAGCTACAGCTTAAGGAAGG + Intronic
1140163386 16:72523173-72523195 CTGTATGTACAGTGTGAGAGAGG - Intergenic
1143054467 17:4152471-4152493 CTGTATCCACAGCATAACCAAGG - Intronic
1149169885 17:53796588-53796610 CTGAAGGAACATCGTAAGCAGGG + Intergenic
1151502711 17:74501845-74501867 CCACATGTACAGCGTCAGCAGGG + Intergenic
1152309195 17:79538834-79538856 CTGTATGTAAAGTCAAAGCATGG + Intergenic
1155319880 18:24608806-24608828 CTGTATGTACAGCATCAGCAAGG + Intergenic
1158358050 18:56642066-56642088 CTGTATGTACAGTGTCAGCAGGG - Intronic
1159391994 18:67805556-67805578 CCATATGTACAGCGTTATCAGGG - Intergenic
1159524316 18:69568193-69568215 CCATATGCACAGCGTCAGCAGGG + Intronic
1163528579 19:17836169-17836191 CTGTATGAACAGAGGCAGCAGGG - Intronic
925977601 2:9151969-9151991 CTGTGTGTACAGCAAGAGCATGG - Intergenic
926272762 2:11378967-11378989 CTGTGCGTACAGCCTAAGCCAGG + Intergenic
933641679 2:84769092-84769114 CCATATGTACAGCATCAGCAGGG - Intronic
937064154 2:119004679-119004701 CTGTATGTACAGTGTCTGCAAGG + Intergenic
939057288 2:137380907-137380929 CCATATGTACAGTGTTAGCAGGG - Intronic
939057715 2:137383680-137383702 CCATATGTACAGTGTTAGCAGGG - Intronic
940405794 2:153300403-153300425 CTGGATGTACAGGGAAAGCTGGG + Intergenic
1170894022 20:20398252-20398274 CTGTACGCACAGCATAACCAGGG - Intronic
1172834839 20:37866518-37866540 CTGTATGTACAGTGCTCGCATGG + Intronic
1175053372 20:56175501-56175523 CTTTATGGACAGCGTAAAAACGG + Intergenic
1177603542 21:23347905-23347927 GTGTGTGTATAGCTTAAGCATGG - Intergenic
956553218 3:70485545-70485567 ATGTATGTAGAGTGTGAGCATGG - Intergenic
959649388 3:108737010-108737032 CTGTATGTACAGCATCAACAAGG - Intergenic
964433261 3:156626432-156626454 CTATATGTACAGCGTTAGCAGGG - Intergenic
969834755 4:9831569-9831591 GTGCATGTACAGTGTCAGCAGGG - Intronic
970315254 4:14822895-14822917 TGGTATGTACAGCATAACCAAGG + Intergenic
971292592 4:25358819-25358841 CCATATGTACAGCGTTAGCAGGG - Intronic
972679837 4:41294782-41294804 CCATATGTACAGTGTCAGCAGGG - Intergenic
974341481 4:60619089-60619111 CAGTATGTACAGCATGAGAAAGG + Intergenic
976342615 4:83962534-83962556 CTGTATGTACAGTGTTAGCAGGG + Intergenic
977574868 4:98665034-98665056 CCATATGTACAGCATTAGCAGGG + Intergenic
978016912 4:103755140-103755162 CTGTATGTATAGTGTTAGCAGGG - Intergenic
979082048 4:116358035-116358057 CCGTATGTACAGCATCAGCAGGG - Intergenic
979389571 4:120112238-120112260 CTGTAAGGACAGGGGAAGCAAGG + Intergenic
980716242 4:136633608-136633630 ATGTTTGTACAGTGTAAGCTTGG + Intergenic
981305445 4:143242209-143242231 CTATATGTACAGTGTTAGCAGGG - Intergenic
987347109 5:16988812-16988834 CTCTATGTACAGAGAAGGCATGG + Intergenic
987856473 5:23425406-23425428 CTGTATGTACAGCATTAGCAGGG - Intergenic
990770137 5:59234403-59234425 CTCTAAGTACAGTGTAAACAAGG + Intronic
991658782 5:68930152-68930174 CGGTATGTACAGCATCAGCAGGG + Intergenic
992553819 5:77884416-77884438 CTGTATATACAGAGTGAGAAAGG + Intergenic
994572627 5:101533581-101533603 CTGAATGTACAGAATAAGAAAGG - Intergenic
994788166 5:104189330-104189352 CCGTATGTACAGCATCAGCAGGG - Intergenic
994796169 5:104302508-104302530 CTGTGTGAACAGAGGAAGCATGG - Intergenic
995361199 5:111299322-111299344 CGTTATGTACAGCATTAGCAGGG - Intronic
996324790 5:122260102-122260124 CCATATGTACAGCATCAGCAAGG + Intergenic
997487669 5:134245358-134245380 CTGTATGCACAGTGTCAGCAAGG + Intergenic
999465926 5:151804357-151804379 CTGTATATGCAAAGTAAGCAAGG - Exonic
1001006686 5:168057975-168057997 CTGGATGTACAGCATCAGCAGGG + Intronic
1001610474 5:172997411-172997433 CTGTATATGCAAAGTAAGCAAGG + Intronic
1003917715 6:10803090-10803112 CTGTCTGTACAGTGTCAGCTGGG + Intronic
1009712684 6:67346212-67346234 CTGTATGTACAGTGTTAGCAGGG - Intergenic
1010724095 6:79313336-79313358 CCATATGTACAGCATCAGCAAGG + Intergenic
1011113835 6:83867853-83867875 CTGTATGTACAGCGTAAGCAGGG - Intronic
1012416516 6:99019427-99019449 CTGTATGTACAGTGTTAGCAGGG + Intergenic
1012417563 6:99026233-99026255 CTGCATGTACAGCGTTAGCAGGG + Intergenic
1014178255 6:118353633-118353655 CCATATGTACAGCGTTAGCAGGG + Intergenic
1014645047 6:123962811-123962833 CTGTACGTACAGCGTTAGCAGGG - Intronic
1014752085 6:125268094-125268116 CTATATGTACAGCATCAGCTGGG - Intronic
1014753086 6:125274308-125274330 CCATATGTACAGCATCAGCAGGG - Intronic
1015596391 6:134871540-134871562 CTGTATGTACAGCATCAGTAGGG + Intergenic
1017300089 6:152846899-152846921 CCGTATGTACAGCATCAGCAGGG + Intergenic
1023894185 7:44418368-44418390 TTGTATGTATAGAGTAAGGAGGG + Intronic
1024220549 7:47283167-47283189 CTGAATGCCCAGCATAAGCATGG - Intronic
1027684352 7:81264194-81264216 CTGTATGTACAGCATTAGCAGGG + Intergenic
1027684905 7:81267582-81267604 CTGTATGTACAGCATTAGCAGGG + Intergenic
1027754999 7:82202180-82202202 CCGTATGTACAGCGTCAGCAGGG - Intronic
1027755435 7:82205022-82205044 CTGCATGTACAGTGTCAGCAGGG - Intronic
1028093682 7:86733820-86733842 CCATATGTACAGCATTAGCAGGG + Intronic
1029080375 7:97968995-97969017 CAGCATGTACAAGGTAAGCATGG - Intergenic
1038500142 8:28037023-28037045 CTGTATGTACAGCGTTAGCAGGG - Intronic
1038715236 8:29985481-29985503 TTGTAGGTACAGGATAAGCATGG + Intergenic
1039334383 8:36573907-36573929 TTGTATGTACAGCATTGGCAGGG + Intergenic
1039334728 8:36576309-36576331 CCATATGTACAGCATTAGCAGGG + Intergenic
1043652911 8:82620978-82621000 CTGCATGTACAGAGTATGAAAGG - Intergenic
1044775726 8:95685579-95685601 CTGCCTGTACAGCATCAGCAGGG + Intergenic
1048790741 8:138101048-138101070 CTGTATGTATAGCGTCAGCAGGG - Intergenic
1055336174 9:75235696-75235718 GTATATGTACAGCATCAGCAGGG + Intergenic
1055336725 9:75239240-75239262 CCATATGTACAGCATCAGCAAGG + Intergenic
1188545128 X:31297047-31297069 GTGTATGTATATAGTAAGCATGG + Intronic
1191641181 X:63430965-63430987 CTGTATGTTCATTGTAATCAAGG - Intergenic
1194795675 X:98209028-98209050 CTGTAAGTACAGAGTAATCAAGG - Intergenic
1199523091 X:148759608-148759630 CTGAATGCACAGTGCAAGCATGG + Intronic