ID: 1011115142

View in Genome Browser
Species Human (GRCh38)
Location 6:83881471-83881493
Sequence TACAAGAAGCAGTATGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 220}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011115142_1011115145 22 Left 1011115142 6:83881471-83881493 CCAGCCTCATACTGCTTCTTGTA 0: 1
1: 0
2: 1
3: 20
4: 220
Right 1011115145 6:83881516-83881538 CTATGACTTTCGGAGCTGCCTGG No data
1011115142_1011115144 12 Left 1011115142 6:83881471-83881493 CCAGCCTCATACTGCTTCTTGTA 0: 1
1: 0
2: 1
3: 20
4: 220
Right 1011115144 6:83881506-83881528 ACTTCTTACACTATGACTTTCGG 0: 1
1: 0
2: 1
3: 19
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011115142 Original CRISPR TACAAGAAGCAGTATGAGGC TGG (reversed) Intronic
900841754 1:5054579-5054601 ACCAAGAAGCAGTATGATCCTGG + Intergenic
903744227 1:25575930-25575952 CAAAAGCAGCAGCATGAGGCTGG + Intergenic
904379675 1:30102245-30102267 CACAAGAAGCAGGCTGGGGCCGG - Intergenic
906342613 1:44993922-44993944 TGCTAGAAGCAGTAAGAGCCAGG - Intergenic
907632385 1:56095670-56095692 GAAAAGAAGCAGGATGGGGCAGG - Intergenic
907865112 1:58391737-58391759 TGCAGGAAGCAGTAAGAGGGTGG - Intronic
911477022 1:98386328-98386350 TATACAAAGCAGTATGATGCAGG + Intergenic
911671167 1:100609790-100609812 TCAAAGCAGCATTATGAGGCAGG + Intergenic
911981502 1:104573373-104573395 TCCAAGATTCAGTAGGAGGCTGG - Intergenic
915404214 1:155647041-155647063 TACAAGAAAGTGAATGAGGCTGG + Intergenic
916813329 1:168325757-168325779 TACAAGAAGAATTATGTGGAAGG - Intergenic
916875287 1:168962257-168962279 TAGAAGATGCAGTTTGAGGATGG + Intergenic
919182789 1:194106717-194106739 TAAAAGAAGGAATAAGAGGCTGG + Intergenic
921595447 1:217049297-217049319 TCCAAGAAGGAGAATGAAGCCGG + Intronic
923566789 1:235082500-235082522 TACAACAAGGAGGCTGAGGCAGG + Intergenic
923724912 1:236497358-236497380 TAAATGAAGCAGAAAGAGGCCGG - Intergenic
924044383 1:240012305-240012327 TACCAAAAGCATTATCAGGCTGG - Intergenic
1063057057 10:2517069-2517091 TACAAGAAGCAGGATAAGGAAGG - Intergenic
1064768458 10:18698711-18698733 TACAAGCAGCATTAGGAGGATGG - Intergenic
1065517943 10:26543700-26543722 AACAAGGAGCAATATGAGGTAGG + Intronic
1067446661 10:46353834-46353856 TCAAAGAAGCAATATGAGGCTGG + Intergenic
1067590723 10:47506933-47506955 TCAAAGAAGCAATATGAGGCTGG - Intronic
1067637841 10:48015032-48015054 TCAAAGAAGCAATATGAGGCTGG - Intergenic
1067875650 10:50005313-50005335 TTAAAGAAGCAATAAGAGGCTGG + Intronic
1070134438 10:73679456-73679478 TCAAAGAAGCAATATGAGGCTGG - Intronic
1070187093 10:74074971-74074993 TACAAGATAAAGTATGAGACAGG - Intronic
1071121471 10:82283704-82283726 TCCATGACCCAGTATGAGGCTGG - Intronic
1071607281 10:87004953-87004975 TTAAAGAAGCAATAAGAGGCTGG + Intergenic
1072033470 10:91542823-91542845 TTTAAGAAGCAGAATGTGGCCGG + Intergenic
1072767769 10:98109644-98109666 TAAAAGAAACAGTTGGAGGCTGG - Intergenic
1075055483 10:119215391-119215413 TAAAAGAAGCAGAGGGAGGCAGG + Intronic
1075546613 10:123359764-123359786 TGCCAGAAGTAGTAGGAGGCTGG - Intergenic
1076010618 10:126985329-126985351 TACCAGCAGCCCTATGAGGCAGG + Intronic
1076866997 10:133172127-133172149 GAACAGAAGCAGTGTGAGGCTGG + Intronic
1079451857 11:20604917-20604939 TTCAAGAAGCAGAAGAAGGCGGG - Intronic
1079898732 11:26154371-26154393 GACAAGAAGCAACATGGGGCTGG + Intergenic
1082295509 11:50437440-50437462 TTCAATAAGCAGTTTGGGGCTGG + Intergenic
1083851674 11:65371349-65371371 TAAAAAAAGAAGTATGACGCTGG + Intergenic
1085815293 11:79730999-79731021 TACAGGAACCAGCCTGAGGCAGG - Intergenic
1086732147 11:90263743-90263765 TACAGGAAGCAGTATAAGCAAGG - Intergenic
1088434181 11:109792551-109792573 TACTAGTAGCAGTATGAGGAGGG + Intergenic
1089191232 11:116654768-116654790 CAGCATAAGCAGTATGAGGCTGG - Intergenic
1089609985 11:119663739-119663761 TGTAAGAAGCAGTTTGGGGCAGG + Exonic
1090145384 11:124315981-124316003 TACAAAATGCAGTTTGAGGCTGG + Intergenic
1090484528 11:127101024-127101046 TGCAATAAGCAGGATGAGCCTGG - Intergenic
1090742919 11:129682347-129682369 CACCAGAAGCAGGAAGAGGCAGG - Intergenic
1093002285 12:14010979-14011001 TAAAAGAAACATTATGAGGTTGG + Intergenic
1095820065 12:46468197-46468219 TAAAAGAAACCGTAAGAGGCCGG - Intergenic
1097075053 12:56386822-56386844 TACAAGAAGCATGGTGTGGCTGG + Intergenic
1097323237 12:58247973-58247995 TAGAAGCAGAAGTCTGAGGCAGG + Intergenic
1097333902 12:58360961-58360983 GACAAGAAGCAGCTTGGGGCAGG + Intergenic
1099909793 12:88815620-88815642 TAAAATAAACAGTATGGGGCCGG - Intergenic
1102080675 12:110095526-110095548 TACAAGTATCTGTTTGAGGCTGG + Intergenic
1102142641 12:110628257-110628279 TAGAAGAAGCAGGCTGAGTCTGG + Intronic
1102799154 12:115716469-115716491 TAAAGGAAGCAGGAGGAGGCTGG + Intergenic
1103121668 12:118385403-118385425 TAGAAACAGCAGTATCAGGCTGG - Intronic
1104901548 12:132191980-132192002 TACAGGAAGCAGCATGCGGGGGG - Intergenic
1105590672 13:21790379-21790401 AACAAGAAACAGAATCAGGCTGG + Intergenic
1105899394 13:24742541-24742563 TTCAAGAAGCAGCAAGAGGGAGG - Intergenic
1108889209 13:55232228-55232250 CACAAAAAGCCATATGAGGCAGG - Intergenic
1117124222 14:52603833-52603855 TATGAAAAACAGTATGAGGCTGG - Intronic
1118263018 14:64265826-64265848 TAAAAGAAGCAGGATGGTGCAGG + Intronic
1118907803 14:70035467-70035489 TGCAAAAAGCATTATGATGCGGG + Intergenic
1128109101 15:65065275-65065297 TGCAAGAAGCAGAAAGAGGTTGG + Intronic
1128333193 15:66769702-66769724 TCCAAGAAGAAGTTTAAGGCAGG + Intronic
1129101055 15:73264217-73264239 TAAAGGAAACAGTATGAAGCTGG - Intronic
1131140938 15:89976699-89976721 TATAAGAAGCAAGATGAGGCTGG + Intergenic
1132032520 15:98450322-98450344 TAGAAGGAGCAGCATGAGCCAGG + Intronic
1133631647 16:7627626-7627648 TACAAGCAGCAGTATGGAGAGGG - Intronic
1134148624 16:11787995-11788017 TAAAAAAAGGAGTATGGGGCTGG - Intronic
1134757248 16:16678738-16678760 TACAACAGGTAGTATGGGGCTGG - Intergenic
1134988820 16:18680428-18680450 TACAACAGGTAGTATGGGGCTGG + Intergenic
1136249311 16:28993515-28993537 TACAATAATCAGAATGAGGACGG - Intergenic
1136458241 16:30394663-30394685 TCCGAGGAGCAGTAAGAGGCTGG - Intronic
1136520913 16:30795142-30795164 TAAAAGTACCAGTATGGGGCCGG + Intergenic
1136922743 16:34345618-34345640 TTCAAGAAGCAGCAAGAGGAAGG + Intergenic
1136981830 16:35066188-35066210 TTCAAGAAGCAGCAAGAGGAAGG - Intergenic
1138367144 16:56489498-56489520 TAAAAGAAGTAGTATCAGGCTGG + Intronic
1138962066 16:62038888-62038910 TGCAAAAAGTAGAATGAGGCAGG + Intergenic
1141014590 16:80437148-80437170 AGCAAGAAGCATTATGGGGCTGG + Intergenic
1142571497 17:877842-877864 TCCAAGAAACAGCAAGAGGCAGG + Intronic
1146300047 17:31680840-31680862 GACAAAAAGCAATATGGGGCAGG + Intergenic
1148053964 17:44782475-44782497 TAAAAGAAGCAGTTGGGGGCAGG + Intergenic
1148073617 17:44922704-44922726 TGGAAGAGGCAGGATGAGGCAGG + Intergenic
1148444705 17:47730673-47730695 TACAGGGAGCATTATGAGGCTGG - Intergenic
1148918364 17:51004439-51004461 TATAAGAATGATTATGAGGCTGG + Intronic
1149457606 17:56800831-56800853 TCCACTAAACAGTATGAGGCAGG - Intronic
1149706774 17:58701857-58701879 TAAAACAAACAGTTTGAGGCTGG - Intronic
1149802702 17:59585424-59585446 TTTAAGAAGCATTTTGAGGCTGG + Intronic
1149843789 17:59990067-59990089 TTTAAGAAGCATTTTGAGGCTGG - Intergenic
1149940706 17:60862295-60862317 AACAAAAAACAGAATGAGGCTGG + Intronic
1150309365 17:64115253-64115275 AACAGGAAGAAGTATGAGGCAGG - Intronic
1150702649 17:67461150-67461172 GAGAAGAAGCAGGAGGAGGCAGG - Intronic
1152203969 17:78963867-78963889 TATAAAAATTAGTATGAGGCTGG + Intergenic
1153810059 18:8744536-8744558 CACAAGAAGCAGCAGGAAGCAGG - Intronic
1156424446 18:36994686-36994708 TAAAATAAGCAGAATGAGTCAGG - Intronic
1156595413 18:38542730-38542752 CACATGAAGCAGAATGAGGGAGG - Intergenic
1157261626 18:46180408-46180430 TAAAATAAGCAGTTTGGGGCAGG + Intronic
1157521134 18:48346400-48346422 TACAGGAAGCGGCTTGAGGCAGG - Intronic
1161174243 19:2831060-2831082 TACAAAACCCAGTATGGGGCTGG - Intronic
1162876549 19:13624904-13624926 TATAAGAAGCATCAAGAGGCCGG + Intergenic
1162966196 19:14157246-14157268 GACAAGACTCAGTATGAGGTGGG - Exonic
1163384233 19:16989580-16989602 TCCAAAAAGCAGCATGAGCCAGG - Intronic
1166875679 19:45895827-45895849 TGCAAGAGGCAGTGTGAGCCTGG - Intronic
1167389927 19:49188360-49188382 GTCAAGAAGCAGTTGGAGGCTGG - Intronic
925874901 2:8303284-8303306 TACAAAAAGATGAATGAGGCTGG - Intergenic
926420503 2:12692101-12692123 TACCAGAAACAGGAAGAGGCAGG - Intergenic
926565391 2:14463968-14463990 TACAAGAAGAAGAATGAAACTGG + Intergenic
928097685 2:28414499-28414521 TCCAAGCAGCAGAATGAGCCAGG + Exonic
932697874 2:73971631-73971653 TGCAAAAACCAGTTTGAGGCCGG - Intergenic
935265647 2:101391639-101391661 TATAAGAAGCAGCATCAGGCTGG + Intergenic
936240110 2:110780732-110780754 TACAAAAAGAAGTGTTAGGCTGG + Intronic
936936889 2:117847593-117847615 TACAAGAATCATGATGAGGTAGG - Intergenic
938701741 2:133885716-133885738 TACCAGAAGCTGGAAGAGGCAGG + Intergenic
939318587 2:140585398-140585420 TTCAGGAAGCAGTATGATGTGGG - Intronic
939954627 2:148517282-148517304 GTTAAGAAGCAGTAAGAGGCTGG - Intronic
942601894 2:177649760-177649782 TGCAAAAAGGAGTATGAGGGAGG + Intronic
943821755 2:192332100-192332122 TACAAGCAGGTGTATGAGGAAGG + Intergenic
945673366 2:212828928-212828950 TTTAAGATGTAGTATGAGGCTGG + Intergenic
948664135 2:239523954-239523976 TTCCAGAAGCAGAATGAGGTTGG + Intergenic
948871654 2:240802924-240802946 TAAAAGAATATGTATGAGGCTGG - Intronic
949037675 2:241824828-241824850 AAAAAGAAGAAGAATGAGGCTGG - Intergenic
1170563885 20:17582673-17582695 TACAACATACAGTATGAAGCAGG - Intronic
1170972937 20:21133575-21133597 TCCAGGAAACAGTAAGAGGCTGG - Intronic
1171148711 20:22808328-22808350 TAGAAGCATCAGTTTGAGGCTGG + Intergenic
1171365503 20:24620271-24620293 TTCAAGAAGCAGCATGAGGATGG + Intronic
1175779448 20:61672955-61672977 TAGAAGAAGAAGAAGGAGGCAGG + Intronic
1176660400 21:9629736-9629758 TTAAAGCAGCAGTAGGAGGCAGG - Intergenic
1182741474 22:32571132-32571154 TACAGGAGGCAGTCTGAGGAAGG + Intronic
1183974936 22:41506547-41506569 TATAAAAAACAGAATGAGGCCGG - Intronic
1185363201 22:50421754-50421776 TACAAAAAGGAGGCTGAGGCAGG + Intronic
950623184 3:14224366-14224388 TGAAAGAAGCAGTATCAGGAGGG + Intergenic
951478712 3:23136145-23136167 TAAATGAAGCAGTAGTAGGCTGG + Intergenic
952412856 3:33064935-33064957 TAGAAGAAGGAGAATGGGGCAGG + Intronic
952894244 3:38066376-38066398 TACAAGAAAGAGGAGGAGGCAGG - Intronic
953864083 3:46568879-46568901 TACAAAAACCAGTAGCAGGCTGG + Intronic
954360052 3:50117143-50117165 CGCAAGAAGCAGTTTGATGCCGG + Exonic
954526341 3:51275082-51275104 CACAGGAAGCAGGATGCGGCGGG - Exonic
955065525 3:55530830-55530852 TACAAGCAGCAGTCAGAGGTGGG + Intronic
955903479 3:63782047-63782069 TATAAGAACCAGTAAGAAGCTGG - Intergenic
956445091 3:69318269-69318291 TGCAAGAAGCAGAATCCGGCTGG - Intronic
957785176 3:84873511-84873533 TAGAAAAAGGAGTATTAGGCTGG + Intergenic
957895040 3:86411428-86411450 TATAAGAAGCAGTGTGACACGGG - Intergenic
959975999 3:112460457-112460479 TACCATAAGCAGTGTCAGGCAGG + Intergenic
960018915 3:112926961-112926983 TAGAAGAAGAAGTATGTGGAGGG + Intronic
961228049 3:125271815-125271837 TAAAAGAACCAGAAGGAGGCAGG - Intronic
961781381 3:129322663-129322685 TAAAAGTAACAGAATGAGGCCGG + Intergenic
961865952 3:129953693-129953715 TGAAAGAAGGAGTTTGAGGCAGG - Intergenic
961872713 3:130000370-130000392 CCCAAGAAGCAGTGTCAGGCTGG - Intergenic
962296785 3:134197075-134197097 CACAAGAAGAAGTATCAGGTTGG - Intronic
962300879 3:134242003-134242025 TATAAGAATGAGAATGAGGCCGG + Intronic
966148772 3:176842814-176842836 AACAACAAGAAGTTTGAGGCTGG + Intergenic
970656514 4:18236385-18236407 TACCAGAAGCTGGAAGAGGCAGG + Intergenic
971233174 4:24817319-24817341 TACAAGCAGCCACATGAGGCTGG + Intronic
972217817 4:36916709-36916731 GAGAAGGAGCAGTAGGAGGCAGG - Intergenic
976036964 4:80835342-80835364 TTCAAGAAGCAGGCCGAGGCGGG - Intronic
976199598 4:82564986-82565008 TATAAAAAGGAGTAAGAGGCCGG - Intergenic
976598890 4:86919619-86919641 AAAAAGAAGCAGAATGGGGCCGG - Intronic
980012164 4:127608793-127608815 AACAAGATGCAGTATTATGCAGG + Intergenic
980054167 4:128063481-128063503 GACAAAAAGCAGTATCTGGCCGG + Intronic
982893641 4:160887973-160887995 GACAGGAGGCAGTAAGAGGCTGG - Intergenic
983557767 4:169073757-169073779 TATAAAAAGCAGAATGTGGCCGG + Intergenic
984210446 4:176840750-176840772 TACAAGAAACAGTACTAGCCGGG + Intergenic
984750660 4:183270465-183270487 TATAAGAAGTACTATGAGGCCGG + Intronic
985414957 4:189726681-189726703 TTAAAGCAGCAGTAGGAGGCAGG + Intergenic
986360636 5:6975011-6975033 TACAGGAAGGATGATGAGGCTGG + Intergenic
986418291 5:7550361-7550383 TTAAAGAAGAAGTATGAGTCTGG + Intronic
987320893 5:16768337-16768359 CACAGGAAACAGTATGAAGCAGG + Intronic
989159057 5:38372453-38372475 AAAAAGAAGCAGTATGAGGCCGG - Intronic
989429746 5:41338939-41338961 TAAAAGAACCAGAATGAGGGCGG - Intronic
989711567 5:44403892-44403914 TTCAAAAAGCAGTAGTAGGCTGG + Intergenic
990845652 5:60135534-60135556 TACCAGAAGCAGTAACAGGAAGG + Intronic
992554150 5:77886785-77886807 TACAAGAAGCAGTGAGAGGTGGG - Intergenic
995183750 5:109251425-109251447 GAGAAGACGCAGTGTGAGGCGGG + Intergenic
997294402 5:132760790-132760812 GACAAGAAGAAGTAGGTGGCAGG - Exonic
998163758 5:139828658-139828680 TTTCAGAAGCAGGATGAGGCAGG - Intronic
998588335 5:143451616-143451638 TACAAGTGGCAGAATGAGGGTGG + Intergenic
999865599 5:155697293-155697315 TACCAGAAGCAGTATGTTTCTGG + Intergenic
1001444407 5:171772197-171772219 TCCAAGAAGCAGTCATAGGCTGG - Intergenic
1002843656 6:926979-927001 GACAAGAAGCAGTCAGAGGATGG + Intergenic
1003194873 6:3905829-3905851 AACAAGAAGCTGGATGTGGCTGG + Intergenic
1003373052 6:5547246-5547268 TAAAATAACCATTATGAGGCCGG - Intronic
1003601204 6:7519112-7519134 TACAAGAAGCACAATCAGGCTGG - Intergenic
1005825635 6:29630282-29630304 TGCAAGAGGAAGTTTGAGGCAGG + Intronic
1007917530 6:45575084-45575106 TGCAAGGAGCACTGTGAGGCTGG - Intronic
1010252091 6:73717912-73717934 TACAAGAATCAGTAGAAGCCAGG - Intronic
1010505068 6:76646998-76647020 TACCAGAAGCAGCCTGAGGGAGG - Intergenic
1011115142 6:83881471-83881493 TACAAGAAGCAGTATGAGGCTGG - Intronic
1014215997 6:118753378-118753400 TCCAGGAAGCAGTGGGAGGCTGG - Intergenic
1014498060 6:122152245-122152267 CACATGAAGCAGTAAGAGACAGG + Intergenic
1015404849 6:132825708-132825730 TAAAAGCAGAAGTATTAGGCTGG + Intergenic
1017608886 6:156163344-156163366 TCTATGAAGCAGTATCAGGCAGG + Intergenic
1017646932 6:156547877-156547899 TACAATAAGAAGTAGGAGGTTGG + Intergenic
1017909726 6:158782473-158782495 TTCAAGGAACAGCATGAGGCTGG + Intronic
1019853645 7:3583669-3583691 TAAAACAAGTAGTAAGAGGCAGG + Intronic
1020121595 7:5507148-5507170 TACAGGAAGCAGGAGCAGGCTGG - Intronic
1021178601 7:17479634-17479656 TACAAGAAGCTGGAAAAGGCAGG + Intergenic
1022687455 7:32610081-32610103 TAAAACAAGCAATGTGAGGCTGG + Intergenic
1023053737 7:36275206-36275228 TCCAGGAAGCAGGATGAGGATGG + Intronic
1023607561 7:41943840-41943862 TACAAGAGACAGTATGAGGTGGG - Intergenic
1023934904 7:44732788-44732810 TACCAGATGCAGGAGGAGGCAGG + Intergenic
1024982547 7:55169866-55169888 TACAAGATGCAGTCTTATGCAGG - Intronic
1024997676 7:55285950-55285972 TAAAGGAAACAGAATGAGGCAGG + Intergenic
1025128970 7:56365859-56365881 TACAAGATGGAGTGTGAGGAGGG + Intergenic
1027202951 7:76074340-76074362 TACAGGGACCAGCATGAGGCAGG + Intergenic
1027602807 7:80260252-80260274 TTCATGGAGCAGTAAGAGGCTGG + Intergenic
1028885421 7:95927590-95927612 TACACGAAGAAGTATGGGGATGG + Intronic
1029009910 7:97248853-97248875 TGAAAGCAGCAGTATGAGGAAGG + Intergenic
1031061088 7:117052227-117052249 TACAAAAAGGAGAATGATGCTGG - Intronic
1032126201 7:129195027-129195049 AATAAGCTGCAGTATGAGGCGGG - Intronic
1038679816 8:29656327-29656349 TTCAAGGAGGAGGATGAGGCAGG - Intergenic
1038816950 8:30913677-30913699 TAAAAGATGCAGTATTCGGCCGG + Intergenic
1040797877 8:51306638-51306660 TAAAAGTAGCAGTGTGAGACCGG + Intergenic
1040893634 8:52342632-52342654 TGCAAGAAGCACTCTGATGCAGG + Intronic
1041403317 8:57468090-57468112 TACAAGAATATGTATGGGGCAGG - Intergenic
1045319685 8:101072631-101072653 AACAAGAGGCAGGAAGAGGCAGG + Intergenic
1045603086 8:103740406-103740428 TACAAGAAGCCCTATAAGCCAGG - Intronic
1046156759 8:110301336-110301358 TTCAAAAAGCAGAAAGAGGCCGG + Intergenic
1046324311 8:112620725-112620747 CACAAGATGCAGTAGGAGGCGGG - Intronic
1048676168 8:136783623-136783645 TACAAAAAGCAGCATGAAGCTGG - Intergenic
1054724106 9:68633291-68633313 TACAAGAAGAATTATGATACAGG + Intergenic
1055001570 9:71456211-71456233 TAGAAGAAGCAGTCTGTGTCAGG - Intergenic
1055306964 9:74939765-74939787 TACAAGAAGAAGAAAGCGGCCGG - Intergenic
1055731970 9:79287642-79287664 TACAAGAGGCACTTTGAGGAAGG - Intergenic
1055956704 9:81780483-81780505 TATGAGAAATAGTATGAGGCCGG + Intergenic
1059028875 9:110667903-110667925 TAAAGGAAGCTGAATGAGGCTGG + Intergenic
1060896686 9:127223437-127223459 GAGAAGGAGCAGGATGAGGCTGG + Intergenic
1062678179 9:137760712-137760734 TAAAAGATGCACTAAGAGGCTGG + Intronic
1203637970 Un_KI270750v1:131579-131601 TTAAAGCAGCAGTAGGAGGCAGG - Intergenic
1186827625 X:13356921-13356943 TAGAAGAAGTATTAAGAGGCAGG + Intergenic
1189627690 X:42916893-42916915 AACAAGCAGCAGAATCAGGCTGG + Intergenic
1190415210 X:50174119-50174141 AAAAAGAAGCTGAATGAGGCTGG + Intergenic
1190585170 X:51932573-51932595 TACAAAAAGAAGTTTGAGCCTGG - Intergenic
1192777809 X:74263338-74263360 CATAAGAATGAGTATGAGGCCGG + Intergenic
1193422329 X:81296194-81296216 GACAAGCAGCAGTAGGAGGATGG + Intronic
1193994691 X:88350869-88350891 TGCATGTAGAAGTATGAGGCTGG + Intergenic
1194579215 X:95651041-95651063 TACCAGTAGCAGTCTGTGGCTGG + Intergenic
1196730883 X:118940557-118940579 TAAAAGAAATAGTATCAGGCTGG + Intergenic
1196764482 X:119230388-119230410 TAGAAGAAGCAATCTGGGGCCGG - Intergenic
1198392870 X:136193961-136193983 TTCAAGAAGCAGGATGCAGCTGG - Intronic
1199732804 X:150653277-150653299 TACAAGAAGCTGGAAGAGGCGGG - Intronic
1200118686 X:153780566-153780588 TAGAAGAAGCAGGAAGTGGCTGG + Intronic