ID: 1011117157

View in Genome Browser
Species Human (GRCh38)
Location 6:83906087-83906109
Sequence CAGTGGAATGCTCAGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 416
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 383}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011117143_1011117157 21 Left 1011117143 6:83906043-83906065 CCAGCCATGGCAGGCATGGTAGG 0: 1
1: 0
2: 1
3: 28
4: 231
Right 1011117157 6:83906087-83906109 CAGTGGAATGCTCAGGTGGAGGG 0: 1
1: 0
2: 1
3: 31
4: 383
1011117145_1011117157 17 Left 1011117145 6:83906047-83906069 CCATGGCAGGCATGGTAGGCAGG 0: 1
1: 1
2: 3
3: 117
4: 379
Right 1011117157 6:83906087-83906109 CAGTGGAATGCTCAGGTGGAGGG 0: 1
1: 0
2: 1
3: 31
4: 383

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011117157 Original CRISPR CAGTGGAATGCTCAGGTGGA GGG Intronic
900159953 1:1218793-1218815 CCGGGGAATGCTCAGGTTCATGG - Exonic
902138958 1:14335444-14335466 CTTTGGAAGGCTGAGGTGGACGG - Intergenic
902386894 1:16081198-16081220 CTTTGGGATGCTGAGGTGGACGG - Intergenic
903176471 1:21584452-21584474 CTTTGGAAGGCTCAGGTGGGTGG + Intergenic
903556694 1:24199117-24199139 TTTTGGAATGCTGAGGTGGATGG - Intergenic
904549736 1:31305683-31305705 CTTTGGAAGGCTGAGGTGGAAGG - Intronic
905087146 1:35390922-35390944 CTTTGGAATGCTGAGGTGGGAGG + Intronic
905964631 1:42081500-42081522 GGGTGGCATGCTCAGGGGGAGGG + Intergenic
906382048 1:45339143-45339165 CACTGGAAGGCAGAGGTGGATGG + Intronic
906986313 1:50687070-50687092 CTTTGGAAGGCTCAGGTGGACGG - Intronic
907941775 1:59095338-59095360 CAGTGGATTGGGCAGTTGGAAGG + Intergenic
908374482 1:63521586-63521608 CATTGGGAGGCTGAGGTGGAAGG + Intronic
908839722 1:68266800-68266822 GAGAGTAATGCTCAGGAGGATGG - Intergenic
909118559 1:71571544-71571566 CTTTGGGATGCTCAGGTGGGTGG + Intronic
909147738 1:71958708-71958730 CACTGGGAGGCTTAGGTGGATGG + Intronic
911251311 1:95579612-95579634 CATTGGTAAGCTCAGGTGGAAGG + Intergenic
915230914 1:154444792-154444814 AAGTGGGAGGCTGAGGTGGAAGG + Intronic
916044533 1:160989542-160989564 CTTTGGAAGGCTGAGGTGGAAGG - Intergenic
918579949 1:186114500-186114522 CTGTGGAAGGCTGAGGTGGGCGG - Intronic
920132311 1:203741649-203741671 CTGTGGACAGCTCAGGTGAAAGG - Exonic
921112859 1:212055711-212055733 CAGTGGAATGCTCAGGTAAGGGG - Intronic
923132429 1:231088163-231088185 CTTTGGAAGGCTGAGGTGGAAGG + Intergenic
924157571 1:241195230-241195252 CTTTGGAAAGCTCAGGTGGGCGG + Intronic
924906947 1:248465161-248465183 CTTTGGAAGGCTGAGGTGGAAGG + Intergenic
1062845898 10:704825-704847 CTTTGGAAGGCTGAGGTGGATGG + Intergenic
1063477423 10:6341039-6341061 GAGGGGACTGCTCAGGTGGAGGG + Intergenic
1064111235 10:12540999-12541021 CTGTGTAATTGTCAGGTGGAGGG + Intronic
1064430537 10:15266620-15266642 CTGTGGAAGGCTGAGGTGGGCGG + Intronic
1064448831 10:15423227-15423249 ACTTGGAAGGCTCAGGTGGAAGG + Intergenic
1065366825 10:24944998-24945020 CAGTGCAAAGCTCAGGAGGCAGG - Intronic
1066280497 10:33912921-33912943 CAGTGGATTGTGCAGGAGGAGGG + Intergenic
1067498370 10:46779066-46779088 CACTGGAAGGCTGAGGTGGGAGG + Intergenic
1067596278 10:47561349-47561371 CACTGGAAGGCTGAGGTGGGAGG - Intergenic
1068388630 10:56362819-56362841 AAGTGGAATTCTCATGTTGATGG + Intergenic
1068601060 10:58957081-58957103 CACTGGAATGCTGAGGGGAAGGG + Intergenic
1069470533 10:68685009-68685031 CTTTGGGATGCTGAGGTGGAAGG + Intronic
1070069282 10:73070936-73070958 CTGTGGGAGGCTGAGGTGGAAGG + Intronic
1070676247 10:78413595-78413617 CAGTGGTTTCATCAGGTGGACGG - Intergenic
1070818226 10:79338751-79338773 CTGTGGAATGCTGAGGCGGGAGG - Intergenic
1071616190 10:87078893-87078915 CACTGGAAGGCTGAGGTGGGAGG + Intronic
1073169903 10:101497455-101497477 CTTTGGAATGCCCAGGTGGAAGG + Intronic
1073271230 10:102265935-102265957 CAGTGTAAGACTAAGGTGGAGGG + Intronic
1075201043 10:120404377-120404399 CAGTTGGATGCACAGGTGGGTGG + Intergenic
1075499562 10:122960512-122960534 CTGTGGAAGGCCCAGGTGGGTGG - Intronic
1075708158 10:124515043-124515065 CTGTGGAAGGCTGAGGTGGGAGG - Intronic
1075988368 10:126809285-126809307 CTTTGGAAAGCTGAGGTGGAAGG - Intergenic
1076266433 10:129112948-129112970 GAGTGGAATGTACAGGTGGCAGG + Intergenic
1076517861 10:131059320-131059342 CAGTGGGAAGCTGAGGTGGGAGG - Intergenic
1076729235 10:132429946-132429968 CAGTGGAGGGCTCAGGTGGGAGG - Intergenic
1077359443 11:2134215-2134237 CACAGCAATGCTCAGCTGGAAGG + Intronic
1077617342 11:3686738-3686760 CATTGGAAGGCTGAGGTGGGCGG + Intronic
1078641791 11:13103648-13103670 CTTTGGGATGCTGAGGTGGATGG + Intergenic
1079227741 11:18622284-18622306 CTTTGGAAGGCTGAGGTGGAAGG + Intronic
1080272012 11:30460374-30460396 CTTTGGAAGGCTGAGGTGGAAGG + Intronic
1080654941 11:34251443-34251465 CAGTGAAATGCTAGGGTGGCTGG + Intronic
1081823291 11:46021792-46021814 CTTTGGGATGCTGAGGTGGAAGG - Intronic
1081900898 11:46626994-46627016 CTGTGGAAAGCCGAGGTGGATGG + Intronic
1083094590 11:60236977-60236999 CTTTGGAAGGCTGAGGTGGATGG - Intronic
1083137007 11:60688556-60688578 CTGTGGAATGCTGAGGTGAGAGG - Intergenic
1083564968 11:63706441-63706463 CTGTGGATGGCTAAGGTGGAAGG - Intronic
1084107816 11:66991666-66991688 CTGTGGGAGGCTGAGGTGGATGG - Intergenic
1084632481 11:70362868-70362890 CATTGGAAGGCTGAGGTGGGAGG - Intronic
1085641728 11:78197037-78197059 GCGGCGAATGCTCAGGTGGAGGG + Intronic
1087442621 11:98206291-98206313 AAGTGGGAAGCTGAGGTGGAAGG - Intergenic
1087746710 11:101956197-101956219 CAGTAGAATGCTGTGCTGGAAGG - Intronic
1089187087 11:116625442-116625464 CTGTGGAAGGATAAGGTGGAAGG + Intergenic
1089231740 11:116983286-116983308 CTTTGGAAGGCTGAGGTGGATGG + Intronic
1089640079 11:119842188-119842210 CAGTGGAATCCTCTGCAGGAAGG - Intergenic
1089939809 11:122404062-122404084 CTTTGGGATGCTGAGGTGGACGG - Intergenic
1091323963 11:134670420-134670442 CAGTGGAATCCCGTGGTGGAAGG - Intergenic
1091535080 12:1399193-1399215 CTTTGGAATGCTGAGGTGGGAGG - Intronic
1092165205 12:6338155-6338177 CAGGGAAATGGTCATGTGGAAGG - Intronic
1094820782 12:34222613-34222635 CATTGAAAGGCTGAGGTGGATGG - Intergenic
1095263199 12:40122295-40122317 CTTTGGAAGGCTCAGGTGGGAGG - Intergenic
1095939751 12:47718222-47718244 CAGGGGAATTCTCAGGTTGTTGG - Intronic
1096302224 12:50440191-50440213 CTTTGGAGTGCTCAGGCGGAAGG + Intronic
1096364811 12:51019886-51019908 CTTTGGAAGGCTGAGGTGGATGG - Intronic
1096452832 12:51758679-51758701 CTTTGGAATGCCCAGGTGGGTGG - Intronic
1097831589 12:64230229-64230251 CTTTGGAAGGCTGAGGTGGAAGG - Intergenic
1098075126 12:66721516-66721538 CTTTGGAAGGCTGAGGTGGAAGG - Intronic
1098253598 12:68594081-68594103 CTTTGGAAGGCTGAGGTGGATGG - Intergenic
1099488258 12:83254694-83254716 CATTTGAAGGCTCAGGAGGAAGG + Intergenic
1100649083 12:96565340-96565362 CACTGGAAGGCTGAGGTGGTAGG - Intronic
1101901701 12:108795610-108795632 CTTTGGAAGGCTGAGGTGGAAGG + Intronic
1102988877 12:117300534-117300556 CAGGCGATGGCTCAGGTGGAAGG + Intronic
1103649446 12:122422065-122422087 CTGAGGAATGCTCAGGTGACAGG + Intronic
1105615047 13:22004190-22004212 CAGTGCAAAGCACAGCTGGAAGG + Intergenic
1106536046 13:30643851-30643873 CTGTGGGAGGCTCAGGTGGCTGG - Intronic
1106988508 13:35385848-35385870 CAGTGCCATGCACATGTGGAAGG + Intronic
1107943092 13:45392096-45392118 CAGTGAAATCCTCACTTGGATGG - Intergenic
1108092454 13:46863377-46863399 CTTTGGAAGGCTGAGGTGGAAGG + Intronic
1110316239 13:74110907-74110929 CATTGGAAGGCTGAGGTGGGCGG + Intronic
1110630417 13:77699209-77699231 GAGTGGAATGAACAGGTGGGAGG + Intronic
1112061182 13:95741578-95741600 CAGTGGATTGGACAGGTGGGTGG + Intronic
1112266062 13:97924920-97924942 CAGTGGAAGGCTGAGCTGGGAGG - Intergenic
1115710941 14:36050015-36050037 CTTTGGAAGGCTGAGGTGGAAGG + Intergenic
1116115754 14:40648000-40648022 CTTTGGAAAGCTGAGGTGGAAGG - Intergenic
1116265209 14:42679566-42679588 CTGTGGAAGGCTGAGGTGTAAGG - Intergenic
1116448347 14:45038148-45038170 CTTTGGAAGGCTGAGGTGGATGG - Intronic
1118635273 14:67743079-67743101 CTTTGGAAGGCTGAGGTGGAAGG - Intronic
1119707956 14:76798368-76798390 CTTTGGAAGGCTGAGGTGGAAGG - Intronic
1121757510 14:96415209-96415231 CATTGGAAGGCTAAGGTGGGAGG + Intronic
1121920124 14:97872777-97872799 CAGTGAAGAGCTCAGGTGGAAGG + Intergenic
1122022437 14:98849843-98849865 CTTTGGAATGCTGAGGTGGGAGG - Intergenic
1123720758 15:23060050-23060072 CTTTGGAAGGCTGAGGTGGATGG + Intergenic
1124010898 15:25837827-25837849 ACGTGGCAGGCTCAGGTGGAAGG + Intronic
1124912195 15:33932581-33932603 CTTTGGAAGGCTGAGGTGGAGGG + Intronic
1125618849 15:41041173-41041195 GATTGGAAGGCTGAGGTGGAAGG - Intronic
1125717811 15:41829530-41829552 CTTTGGAATGCTGAGGTGGAAGG - Intronic
1126308505 15:47288798-47288820 CTGTGGAGTGTACAGGTGGAAGG - Intronic
1126504805 15:49392362-49392384 CAGTGGAATGTGCATGGGGAAGG + Intronic
1127479481 15:59365260-59365282 CTTTGGAAGGCTGAGGTGGAGGG - Intronic
1130033173 15:80333981-80334003 CAGAGGAATGCTGGGGAGGAGGG + Intergenic
1131021067 15:89099354-89099376 CAGTGGGAGGCTAAGGTGGGAGG + Intronic
1131706793 15:95005327-95005349 CAATGGAAGGCTGAGGTGGGAGG - Intergenic
1131735274 15:95325487-95325509 GATTGGAATGCACAGCTGGATGG + Intergenic
1132269818 15:100513778-100513800 CTTTGGAAAGCTGAGGTGGAAGG - Intronic
1132270615 15:100520740-100520762 CAGTGGAGGGCTCAGGCAGAAGG - Intronic
1132626452 16:893977-893999 CAGTGGGGTGGACAGGTGGATGG - Intronic
1132980294 16:2735506-2735528 CTTTGGAATGCTGAGGTGGGAGG - Intergenic
1134376573 16:13681181-13681203 CTGTGGAAGGCTCAGGTTGATGG + Intergenic
1135172977 16:20202899-20202921 CATTGCAATGCTGAGGTGGGTGG + Intergenic
1135566582 16:23515945-23515967 CTGTGGGAGGCTGAGGTGGAAGG - Intronic
1136072528 16:27796590-27796612 CGGTGGAGGGCTCAGGAGGAAGG + Intronic
1136123465 16:28157876-28157898 CAGGAGAATGGTCAGGTGAAAGG - Intronic
1136317289 16:29461749-29461771 CAGGGGAACCCTCAGGTGCATGG + Exonic
1136431864 16:30201092-30201114 CAGGGGAACCCTCAGGTGCATGG + Exonic
1136511347 16:30739743-30739765 CGGTGGAAAGCCTAGGTGGAGGG - Exonic
1136994589 16:35181188-35181210 CAGTGGTAAGCTCAGCTGAATGG + Intergenic
1137394081 16:48104794-48104816 CAGTGGAATGCAGAGGGGGCTGG + Intronic
1138271151 16:55696736-55696758 CTGTGGAAGGCTGAGGTGGAAGG + Intronic
1138579954 16:57934209-57934231 CTTTGGAAGGCTGAGGTGGAAGG + Intronic
1138961258 16:62033156-62033178 CCCAGGAATGCTCAGCTGGATGG - Intronic
1139666506 16:68460627-68460649 CAGTGGAATGGGCTGATGGAAGG - Intergenic
1140400166 16:74665201-74665223 CACTGAAATGCCCAGGCGGATGG + Intronic
1140718545 16:77749371-77749393 CTTTGGAAGGCTCAGGTGGGAGG - Intergenic
1141090280 16:81125505-81125527 CTTTGGCATGCTGAGGTGGACGG + Intergenic
1141326857 16:83068576-83068598 CAGAAGAATGGTCAGGTGGCTGG - Intronic
1141957184 16:87380509-87380531 CTGTGGAAGGCTGAGGTGGGAGG - Intronic
1142803316 17:2358464-2358486 CTTTGGAAGGCTGAGGTGGAAGG + Intronic
1143855069 17:9842428-9842450 CTGTGGCATGCTCAGGGGAACGG + Intronic
1144353204 17:14419156-14419178 CAGTGGAATGCACAGATCAATGG + Intergenic
1144938481 17:18919120-18919142 CTGTGGAAGGCTAAGGTGGAAGG + Intronic
1145836925 17:27961363-27961385 CTCTGGAAGGCTAAGGTGGAAGG + Intergenic
1146738606 17:35261610-35261632 CTTTGGGAAGCTCAGGTGGAAGG - Intronic
1147510812 17:41067488-41067510 CAAGGGTATGCTGAGGTGGAGGG - Intergenic
1148030846 17:44619785-44619807 CCGTGGGATGCTGAGGTGGGAGG - Intergenic
1148333831 17:46828444-46828466 CTGTGGGAGGCTGAGGTGGATGG - Intronic
1149420556 17:56506781-56506803 CATGGAAATGCTAAGGTGGATGG + Intronic
1150578223 17:66449039-66449061 CTTTGGAATGCTGAGGTGGGAGG + Intronic
1151024347 17:70659799-70659821 CATTGGGAGGCCCAGGTGGATGG - Intergenic
1151233534 17:72701855-72701877 CTGTGGGAAGCTGAGGTGGAAGG + Intronic
1152972728 18:179842-179864 CTTTGGAAGGCTGAGGTGGAAGG - Intronic
1153810802 18:8750150-8750172 CAGTGGGAGGCTGAGGTGGGAGG - Intronic
1155976141 18:32133793-32133815 CTGTGGAAGGCTGAGGTGGGCGG - Intronic
1157377457 18:47179428-47179450 CTGTGGGAGGCTGAGGTGGATGG - Intergenic
1157725906 18:49963669-49963691 CTGTGGGAGGCTGAGGTGGATGG - Intronic
1158171863 18:54609009-54609031 AAGTGGAAAGCTCAGGTTAATGG - Intergenic
1158585341 18:58728358-58728380 CAGTGGGAAGCTAAGGTGGGAGG + Intronic
1159202591 18:65206629-65206651 CAGTGGAAGGGTGAGGAGGACGG - Intergenic
1159330601 18:66990098-66990120 CAGTGTAATGCTCAGGAGATGGG + Intergenic
1160352105 18:78192332-78192354 CTGTGAAATGCTCAAGTGCAGGG - Intergenic
1161401799 19:4069085-4069107 CTGTGGGAGGCTCAGGTGGGAGG - Intergenic
1162137546 19:8565014-8565036 CAGTGGGAGGCTGAGGTGGGCGG - Intronic
1163272305 19:16261672-16261694 AAGTGGAATGGACATGTGGAAGG + Intergenic
1163306342 19:16481846-16481868 CTTTGGAAGGCTGAGGTGGAAGG + Intronic
1163668023 19:18612188-18612210 CAGAGGTATGCTCAGGAGCAAGG - Intronic
1165250358 19:34527958-34527980 CTTTGGGAGGCTCAGGTGGATGG - Intergenic
1165396343 19:35565806-35565828 CTCTGGAAGGCTGAGGTGGACGG + Intergenic
1165409428 19:35649863-35649885 CTTTGGAATGCTGAGGTGGGAGG - Intronic
1165747494 19:38238661-38238683 CACTGGGAGGCTGAGGTGGAAGG + Intergenic
1165871547 19:38976308-38976330 CAGGGGAGTCCTAAGGTGGAAGG - Intergenic
1166339464 19:42129074-42129096 CTTTGGAATGCTGAGGTGGGCGG - Intronic
1166707197 19:44914615-44914637 CAGGGGAAGGCTCAGGAGGAGGG + Intronic
1166709302 19:44926711-44926733 CAGGGGAAGGCTCAGGAGGAGGG + Intergenic
1166744735 19:45136024-45136046 CTTTGGAAGGCTGAGGTGGACGG - Intronic
1167199404 19:48053934-48053956 ATGTGGGATGCCCAGGTGGAAGG + Intronic
1168112686 19:54202939-54202961 CTTTGGAAAGCTGAGGTGGATGG - Intronic
1168138665 19:54369517-54369539 TAGAGGAATGCAAAGGTGGAGGG - Intronic
1168159411 19:54499266-54499288 TAGAGGAATGCAAAGGTGGAGGG + Intronic
1168584608 19:57582887-57582909 CATTGGGAGGCTGAGGTGGAAGG - Intronic
1202675151 1_KI270710v1_random:37317-37339 CAGTGGTGTGCTCAGGCGGGAGG + Intergenic
925546037 2:5017726-5017748 CAGTGGAATCCTAAGAGGGAAGG + Intergenic
926066511 2:9844256-9844278 CATTGGAAGGCTGAGGCGGAAGG - Intronic
926975199 2:18508448-18508470 CATTGGGAGGCTGAGGTGGAAGG + Intergenic
927958998 2:27228478-27228500 CTTTGGAAAGCTCAGGTGGGAGG + Intronic
928159560 2:28909627-28909649 CTTTGGAAGGCTGAGGTGGAAGG + Intronic
928408947 2:31038987-31039009 CACTGGAAGGCTGAGGTGGGTGG - Intronic
929034557 2:37678220-37678242 CTCTGGAATGTTCAGATGGAGGG - Intronic
931597744 2:63968466-63968488 CATTGGGAGGCTGAGGTGGACGG + Intronic
931977340 2:67657143-67657165 CCGTGGAAGGTTCAGTTGGAAGG + Intergenic
932388869 2:71366249-71366271 CCTTGGGAGGCTCAGGTGGAAGG + Intronic
932581403 2:72994765-72994787 GAGTGCCTTGCTCAGGTGGAAGG - Intronic
935336073 2:102018177-102018199 CTGTGGGAAGCTGAGGTGGAAGG - Intronic
936948543 2:117953783-117953805 ATGTGGAAGGCTGAGGTGGAAGG + Intronic
940995676 2:160146988-160147010 CACTGGAAGGCTGAGGTGGGAGG + Intronic
941460899 2:165770343-165770365 CATTTGAATCCTGAGGTGGACGG + Exonic
941658985 2:168175096-168175118 CTGTGGAATCCTCAGGAGGAAGG - Intronic
941681795 2:168407662-168407684 CATTGGAAGGCTGAGGTGGGTGG - Intergenic
943191380 2:184682761-184682783 CTTTGGAATGCTGAGGTGGGTGG + Intronic
943276703 2:185876513-185876535 CAGCAAAATGCTCAGGTGGTGGG - Intergenic
943696480 2:190940925-190940947 TAGTGAAATGCTGAGGGGGATGG - Intronic
944260211 2:197668348-197668370 CAGTGGAATGTTCAGATTGGGGG + Intronic
944536748 2:200717726-200717748 CTGTGGGAGGCTGAGGTGGAAGG + Intergenic
944781273 2:203020425-203020447 CACTGGAAGGCTGAGGTGGATGG + Intronic
947401556 2:229736062-229736084 CAGTGGAATGCTCAGGTTGGTGG - Intergenic
948187779 2:236034923-236034945 CACTGGGCTGCTCAGGTGGAAGG + Intronic
948647159 2:239412606-239412628 CAGAGGGATGCTGAGCTGGAGGG - Intergenic
1169012498 20:2262244-2262266 CCTTGGAAGGCTGAGGTGGAAGG - Intergenic
1171064065 20:21995785-21995807 CCGTAGAATGCTCAGGTGAGTGG - Intergenic
1171985910 20:31661236-31661258 CAGTGGGAGGCTGAGGTGGGAGG + Intergenic
1173258662 20:41413713-41413735 GAGAGGAGTGCTCAGGTGAAGGG - Intronic
1173733961 20:45346779-45346801 CAAAGGAATTCTGAGGTGGAAGG - Intronic
1173808694 20:45942854-45942876 CTTTGGAAGGCTAAGGTGGAAGG - Intronic
1173976504 20:47190641-47190663 CAGTTTAATGGGCAGGTGGATGG + Intergenic
1175225536 20:57441874-57441896 CAGAGGAATGGGCAGGGGGAGGG + Intergenic
1175402559 20:58708771-58708793 CAGAAGAATGCTGAGGCGGACGG + Intronic
1175571342 20:60025043-60025065 CAGTGGAATCCTGTGTTGGAAGG + Intronic
1177360048 21:20056469-20056491 CATTGGAAGGCTGAGGTGCACGG - Intergenic
1181315712 22:21969810-21969832 TAGTGGAAGGCTCAGGTAGGAGG + Intronic
1182449572 22:30411017-30411039 CACTGGGAGGCTCAGGTGAAAGG + Intronic
1182989335 22:34752029-34752051 CACTGGAAGGCTGAGGTGGGTGG - Intergenic
1183969592 22:41466933-41466955 CAGTGGCATGATCATGTGCAAGG - Intronic
1184047371 22:41979781-41979803 CGGTGGAAGGACCAGGTGGAGGG + Intronic
1184676998 22:46048948-46048970 CTGTGGAAAGCTGAGGTGGGTGG - Intergenic
1185253440 22:49817917-49817939 CACTGGAAGGCTGAGGTGGGTGG - Intronic
949708671 3:6848314-6848336 CTGTGGGAAGCTCAGGTGGGAGG + Intronic
950245536 3:11413836-11413858 CAGTGGAACCATCAGGTGCAGGG + Intronic
951068385 3:18295467-18295489 CAGTGGAATGTTCAGGTAGGGGG - Intronic
951905637 3:27704190-27704212 AAGTGGATTTCTCAGGTGGGAGG + Intergenic
952138943 3:30456893-30456915 CATTTGAATGATCAGGTGAATGG + Intergenic
952250477 3:31648482-31648504 CTGTGGAATGCTTTGGTGGTAGG - Intergenic
952596335 3:35023068-35023090 CATTGGGAAGCTAAGGTGGATGG + Intergenic
952914702 3:38226002-38226024 CTGTGGAATGTCCAGGTTGAAGG - Intronic
953495768 3:43385810-43385832 CAGTGTAGTGCTCAGGTGATGGG + Intronic
953988773 3:47467359-47467381 CTTTGGAAGGCTGAGGTGGATGG + Intronic
954424755 3:50437531-50437553 CAGGGGAATGTTGAGGGGGAGGG - Intronic
954946128 3:54425795-54425817 CAGTGGGATGCTCCGGGGCAGGG - Intronic
960395407 3:117131176-117131198 CAGTGGGATGCGGAGCTGGAAGG - Intronic
960947152 3:122974561-122974583 CTGAGGACTTCTCAGGTGGATGG + Intronic
961887876 3:130108228-130108250 CATTGGGAGGCTGAGGTGGACGG - Intronic
962306048 3:134287285-134287307 CAGTGCAATGAGCAGGGGGATGG - Intergenic
962522688 3:136211838-136211860 CATTGCCATGCTCAGTTGGAAGG + Intergenic
962605715 3:137031340-137031362 CTTTGGAAGGCTAAGGTGGAAGG - Intergenic
962996407 3:140633163-140633185 CATTGAAATGCTCAAGTGGGTGG - Intergenic
963569764 3:146978763-146978785 CAGTGGAATGCACAGGTAATAGG - Intergenic
963781491 3:149491200-149491222 CTTTGGGATGCTGAGGTGGAAGG + Intronic
963891524 3:150641021-150641043 CATTGGGAGGCTAAGGTGGAAGG - Intergenic
963940255 3:151090082-151090104 GAGTGGAATGCTAAGTGGGAGGG - Intronic
964608588 3:158585916-158585938 CTTTGGGATGCTGAGGTGGATGG + Intronic
964881499 3:161428356-161428378 CTGTGGAAGGCTGAGGTGGAAGG - Intergenic
965242312 3:166217669-166217691 CTGTGGAAGGCTGAGGTGGAAGG - Intergenic
965667542 3:171111176-171111198 CTTTGGAAGGCTCAGGTGGGAGG + Intronic
966695228 3:182783324-182783346 CACTGGAAGGCTGAGGTGGGAGG - Intergenic
968160743 3:196424627-196424649 CTTTGGAATGCCAAGGTGGAAGG - Intronic
968196937 3:196714218-196714240 CATTGGGAGGCTGAGGTGGAAGG + Intronic
968527289 4:1067619-1067641 CTTTGGAAGGCTGAGGTGGATGG + Intronic
968727258 4:2253502-2253524 GAGTGGAATGACCAGGTGAAGGG + Intronic
968756985 4:2421796-2421818 CTTTGGAATGCTCAGGTGGGAGG + Intronic
969057337 4:4410012-4410034 CAGCGGATTGCTCTGGGGGAGGG + Intronic
970014983 4:11503469-11503491 CAGTGGGATGCTCAGGCGGTTGG + Intergenic
970646512 4:18127692-18127714 CTTTGGAATGCTGAGGTGGGTGG + Intergenic
972459344 4:39286375-39286397 CACTGTAATGCTCAGGTTGCTGG - Intergenic
973280687 4:48357940-48357962 CTGTGGAAGGCTGAGGTGGGAGG - Intronic
975858923 4:78655406-78655428 CTCTGGAAGGCTGAGGTGGATGG + Intergenic
977336478 4:95706144-95706166 CTGTGGAAGGCTGAGGTGGGAGG + Intergenic
979190399 4:117849779-117849801 CAGTGAAATTCTCAGGTTGATGG - Intergenic
980901241 4:138907476-138907498 CAGTAGAGAGCTCAGGAGGAAGG - Intergenic
981024076 4:140058333-140058355 CATTGGGAGGCTGAGGTGGAAGG - Intronic
982228111 4:153184037-153184059 CAGTGGAAGGCTAAGCTGCATGG + Intronic
982930009 4:161392918-161392940 CATTGGGATGCTGAGGTGGATGG + Intronic
983347010 4:166539542-166539564 CACTGCAATGCTCTGGTGAATGG - Intergenic
983954921 4:173686330-173686352 CAGAGGAATGTCCTGGTGGATGG - Intergenic
984573978 4:181426008-181426030 CACTGGAAGGCTGAGGTGGGTGG + Intergenic
985185525 4:187310985-187311007 CTTTGGAATGCTGAGGTGGGAGG + Intergenic
985618448 5:938505-938527 GAGAGGAAGGCTCAGGGGGAAGG + Intergenic
987177314 5:15327823-15327845 CACTAGAATTCTCAGGTGAAAGG + Intergenic
988796893 5:34659509-34659531 CTGTGGAAGGCTGAGGTAGAAGG - Intronic
989594069 5:43139970-43139992 CTTTGGAAGGCTGAGGTGGATGG + Intronic
989949094 5:50275706-50275728 CAGTGGGAAGCCCTGGTGGAAGG - Intergenic
990235228 5:53760049-53760071 CTTTGGAAGGCTGAGGTGGATGG - Intergenic
990744979 5:58950323-58950345 CAGTGGAATGCTTGGATGGGAGG - Intergenic
991709944 5:69398927-69398949 CTTTGGAAAGCTGAGGTGGAAGG + Intronic
992436747 5:76761922-76761944 CTTTGGGAGGCTCAGGTGGAAGG + Intergenic
992713995 5:79491186-79491208 CACTGGGAGGCTGAGGTGGATGG + Intronic
994758217 5:103820357-103820379 CTTTAGAATGCTGAGGTGGATGG + Intergenic
994924764 5:106100605-106100627 CTTTGGAAGGCTGAGGTGGAAGG + Intergenic
996570115 5:124924605-124924627 CAGTGGAATGTTCAGCTTCAAGG - Intergenic
996942329 5:129023075-129023097 CAGTGAAAGGCTCAGGGGAAAGG + Intronic
997135751 5:131323267-131323289 CACTTGAATGCCAAGGTGGAAGG - Intronic
997739919 5:136244272-136244294 CACTGGGAGGCTGAGGTGGAAGG - Intronic
998581117 5:143377128-143377150 CAGTGGAATACTGAGGAGTAAGG - Intronic
999061681 5:148642273-148642295 CAGTAGCAGGGTCAGGTGGAGGG - Intronic
999409156 5:151335295-151335317 CAGTGGAGTGGGCAGGTGCATGG + Intronic
999991719 5:157056171-157056193 CTTTGGGATGCTCAGGTGGGTGG - Intronic
1000323292 5:160152161-160152183 CTTTGGAAGGCTCAGGTGGGTGG - Intergenic
1001037852 5:168310727-168310749 TTGTGGAATGCTGAGGTGGAAGG + Intronic
1001563724 5:172686421-172686443 CAGCTGTATGCTCAGCTGGAGGG + Intronic
1001976477 5:176003996-176004018 CTGTGGGAGGCTGAGGTGGATGG + Intronic
1002017957 5:176340901-176340923 CTTTGGGATGCTGAGGTGGATGG + Intronic
1002949013 6:1789781-1789803 CACTGGGAGGCTGAGGTGGAAGG - Intronic
1003812567 6:9801204-9801226 CAGTGGAATTCCCAGGGAGAGGG - Intronic
1004035465 6:11918882-11918904 CACTGGAATGATCAGGAGCAGGG + Intergenic
1004124213 6:12856497-12856519 CTTTGGAAGGCTGAGGTGGACGG - Intronic
1004261804 6:14114935-14114957 CTTTGGAAGGCCCAGGTGGACGG - Intergenic
1004630663 6:17418026-17418048 CTTTGGAATGCTAAGGCGGATGG + Intronic
1004979100 6:21002742-21002764 CATTGGGAGGCTGAGGTGGATGG + Intronic
1005089396 6:22041130-22041152 CTTTGGAAGGCTGAGGTGGATGG + Intergenic
1006323488 6:33335321-33335343 CTTTGGAAGGCTCAGGTGGGAGG - Intergenic
1006535021 6:34692070-34692092 AAGTGGGAGGCTGAGGTGGAAGG - Intronic
1006648177 6:35529559-35529581 CTTTGGGATGCTGAGGTGGATGG + Intergenic
1006947371 6:37793695-37793717 CATTGGGAGGCTGAGGTGGAAGG + Intergenic
1007165582 6:39826499-39826521 CAGTGGAATCCTCAGGTGATCGG + Intronic
1008464411 6:51814695-51814717 CTGTCAACTGCTCAGGTGGAAGG + Intronic
1008598824 6:53068891-53068913 CTTTGGAAGGCTGAGGTGGAAGG - Intronic
1009037407 6:58134319-58134341 CATTGGAAAGCTGAGGTGGGAGG + Intergenic
1009213201 6:60887939-60887961 CATTGGAAAGCTGAGGTGGGAGG + Intergenic
1009420718 6:63461293-63461315 CCGTGGAAGGCTGAGGTGGGTGG - Intergenic
1009979405 6:70709444-70709466 CAGTCGCAGGCTCAGGTGGGAGG - Intronic
1010652749 6:78474331-78474353 CACTGGAAGGCTGAGGTGGGAGG + Intergenic
1011117157 6:83906087-83906109 CAGTGGAATGCTCAGGTGGAGGG + Intronic
1011551547 6:88535281-88535303 TAGAGGAATGCTCAGGAGAAGGG + Intergenic
1012993739 6:105952023-105952045 CTTTGGGAGGCTCAGGTGGACGG + Intergenic
1013386910 6:109640658-109640680 CTTTGGAAGGCTGAGGTGGAAGG - Intronic
1013918658 6:115372349-115372371 CTTTGGAATGCTGAGGTGGGAGG + Intergenic
1014722545 6:124935225-124935247 CAGTGGAGGGATCAGGTGGGAGG - Intergenic
1014806010 6:125830443-125830465 CTTTGGAAGGCTGAGGTGGAAGG + Intronic
1014809134 6:125865929-125865951 CACTGGAAGGCTGAGGTGGGAGG - Intronic
1015552128 6:134422606-134422628 CAGTGGAATGCAGAAGTGGGAGG - Intergenic
1015609509 6:135000745-135000767 CATTGGAAGGCTGAGGTGGGAGG - Intronic
1016142874 6:140634544-140634566 AAGTGGAAGACTAAGGTGGAAGG - Intergenic
1019646889 7:2135616-2135638 CAGAGGAAGGCTCAGGTGGTGGG + Intronic
1019933199 7:4237133-4237155 CTGTGGAAGGCTGAGGTGGGAGG - Intronic
1019984899 7:4648472-4648494 CAGTGGAGAGCCCTGGTGGAAGG - Intergenic
1020036692 7:4967983-4968005 CAGTGGGAGGCTGAGGTGGGAGG - Intergenic
1020054487 7:5107847-5107869 CATTGGAAGGCTGAGGTGGGAGG + Intergenic
1020849733 7:13336844-13336866 CTGTGGAAGGCTGAGGTGGGCGG - Intergenic
1021202510 7:17742047-17742069 AGGTGGAATGCTTAGGTGGTGGG - Intergenic
1022172977 7:27847231-27847253 CTGTGGGATGCTGAGGTGGGTGG - Intronic
1023440037 7:40175986-40176008 CTGTGGGAGGCTGAGGTGGATGG + Intronic
1023479680 7:40620644-40620666 CTTTGGGAGGCTCAGGTGGATGG - Intronic
1025656239 7:63522080-63522102 CAGTGGGAGGCTGAGGTGGGCGG + Intergenic
1026051316 7:66949055-66949077 CTGTGGAAGGCTGAGGTGGGAGG + Intronic
1026688497 7:72532983-72533005 CAGTGGAAGGCCAAGGAGGAAGG - Intergenic
1026723731 7:72854874-72854896 CAGTGGAAGGCCAAGGAGGAAGG - Intergenic
1027248659 7:76384742-76384764 CAGTGGAATGCTGAGGGCTAGGG - Intergenic
1027878590 7:83802703-83802725 CTTTGGAATGCCAAGGTGGATGG + Intergenic
1027890525 7:83967509-83967531 CTTTGGAAGGCTGAGGTGGACGG + Intronic
1030045304 7:105489873-105489895 CTGTGGGATGCTGAGGTGGGTGG + Intronic
1030834233 7:114263560-114263582 CATTGGGAGGCTGAGGTGGAAGG - Intronic
1033156970 7:138965432-138965454 CTGTGGAAGGCTGAGGTGGGCGG - Intronic
1033537678 7:142327398-142327420 CATTGGAAGGCTGAGGTGGGCGG - Intergenic
1033725388 7:144110453-144110475 CTGAGGAATGCTCAGTTGAAGGG + Exonic
1033728088 7:144142879-144142901 CTGAGGAATGCTCAGGTGAAGGG + Intergenic
1033729233 7:144158097-144158119 CTGCGGAATGCTCAAGTGAAGGG + Intergenic
1033941458 7:146660046-146660068 CAGAGGTATGTTCAGGTGAAAGG - Intronic
1034485017 7:151354849-151354871 CAGTGGGAAGCTGAGGTGGGAGG - Intronic
1034681005 7:152927346-152927368 CTGTGGAAGGCTGAGGTGGGTGG + Intergenic
1035392740 7:158516234-158516256 CTTTGGAAGGCTGAGGTGGAAGG + Intronic
1035984485 8:4411616-4411638 GAATGGAATGAGCAGGTGGAAGG - Intronic
1036997953 8:13681138-13681160 CTGTGGAAGGCTGAGGTGGGTGG - Intergenic
1038201949 8:25421175-25421197 CAGTTGCAGGATCAGGTGGAGGG + Intronic
1038456463 8:27674968-27674990 CTTTGGAAGGCTGAGGTGGATGG - Intronic
1038731426 8:30131396-30131418 CTTTGCAATGCTGAGGTGGAAGG - Intronic
1038791103 8:30668921-30668943 CATTGGAAGGCTGAGGTGGGAGG + Intergenic
1038948957 8:32392871-32392893 CAGAAGGATGCTCAAGTGGAGGG + Intronic
1039329336 8:36519688-36519710 CTTTGGAAGGCTGAGGTGGATGG - Intergenic
1041732316 8:61075157-61075179 CTGTGGACTGCTCAAGGGGAAGG + Intronic
1042228524 8:66534182-66534204 CAGAGGCATGCACAGGGGGAAGG + Intergenic
1042238809 8:66641468-66641490 CACTGGGAGGCTGAGGTGGAAGG - Intronic
1042449416 8:68927043-68927065 CTTTGGGATGCTAAGGTGGATGG + Intergenic
1042561610 8:70076049-70076071 CAGTGGGAGGCTGAGGTGGGAGG + Intergenic
1042661753 8:71162052-71162074 GCTTGGAATGCTCAGGTGGCAGG + Intergenic
1043108717 8:76150380-76150402 CTGTGGGAGGCTGAGGTGGATGG - Intergenic
1043451750 8:80374814-80374836 CTTTGGGATGCTCAGGTGGGTGG - Intergenic
1043971307 8:86531703-86531725 CAATGAAAAGCCCAGGTGGAAGG - Intronic
1044420979 8:91995542-91995564 CTTTGGAAGGCTCAGGAGGAAGG + Intronic
1045111406 8:98941440-98941462 CAGTGGAAGGCTGAGGAGAAGGG + Intronic
1045663653 8:104464382-104464404 AAGTGGAATGCTGTGGGGGAGGG - Intronic
1047909356 8:129510560-129510582 CACTGGCAGGCTGAGGTGGAAGG - Intergenic
1048706927 8:137164085-137164107 CTTTGGAAGGCTGAGGTGGACGG - Intergenic
1049662004 8:143823665-143823687 CACTGGAATGCTCTGGAGGCGGG + Intronic
1049916007 9:319172-319194 CATTGGGAGGCTGAGGTGGAAGG + Intronic
1050301659 9:4264921-4264943 CGGTGGGATGCCCAGGTGGGTGG + Intronic
1050360393 9:4825124-4825146 CTTTGGAAGGCTGAGGTGGATGG - Intronic
1052799669 9:32956041-32956063 CGGCGGAATCCTCAGCTGGAGGG - Intergenic
1056399584 9:86213551-86213573 CTTTGGAAGGCTGAGGTGGACGG + Intergenic
1056640702 9:88368073-88368095 CAGGGGGAGGCTGAGGTGGAAGG + Intergenic
1058738797 9:107921908-107921930 CTTTGGAAGGCTGAGGTGGACGG + Intergenic
1059309771 9:113380250-113380272 CTTTGGAAGGCTAAGGTGGAAGG + Intergenic
1060356431 9:122913215-122913237 AAGTAGATTCCTCAGGTGGAGGG - Intronic
1061293221 9:129664209-129664231 CTGTGGAAGGCTGAGGTGGGTGG - Intergenic
1061363922 9:130160688-130160710 CAGCGGGAGGCTCAGGTGAAGGG - Intergenic
1061807225 9:133143254-133143276 CTGTGGAAGGCTCAGGGGTATGG - Intronic
1061818153 9:133208285-133208307 CAGTGGAATTTTCAGGTTGCCGG - Intronic
1062242304 9:135547074-135547096 CAGTGGAATTTTCAGGTTGCCGG + Intronic
1062258054 9:135640054-135640076 CACTGGAAGGCTGAGGTGGGCGG - Intergenic
1062609256 9:137366618-137366640 CAGTGGGATGCTCATCTGCAGGG + Exonic
1062623305 9:137432169-137432191 CCGTGGGAGGCTGAGGTGGAAGG + Intronic
1062642735 9:137529236-137529258 CTGTGGGAGGCTCAGGTGGGAGG - Intronic
1185637133 X:1560970-1560992 CTTTGGAATGCTGAGGTGGATGG - Intergenic
1185827099 X:3261963-3261985 CAGTGGATTGCTCTGGTGATGGG - Intergenic
1186404162 X:9287022-9287044 CTTTGGAAGGCTGAGGTGGAAGG + Intergenic
1186434297 X:9529697-9529719 CTGTGGAATGCCAAGGTGGAAGG + Intronic
1188663568 X:32790863-32790885 TTGTGCAATGCTCAGGTGGAAGG - Intronic
1189270614 X:39748962-39748984 CCTTGGAAGGCTGAGGTGGAAGG + Intergenic
1189659795 X:43285330-43285352 CAGCAGAATGCTCAGGTGGTGGG + Intergenic
1192956556 X:76076588-76076610 AGGTGTAATGCTCAGTTGGAAGG - Intergenic
1193223432 X:78954114-78954136 CATTGGGATGCCCAGGTGGGTGG - Intronic
1193824472 X:86205808-86205830 CTTTGGGAGGCTCAGGTGGAAGG - Intronic
1195840257 X:109168260-109168282 CAGAGTAATGCTCAGGTTGGGGG + Intergenic
1196703549 X:118697185-118697207 CTCTGGAAGGCTGAGGTGGAAGG + Intergenic
1198159442 X:133992213-133992235 CATTGGGAGGCTGAGGTGGAAGG - Intergenic
1198798665 X:140427181-140427203 GAGTGCATAGCTCAGGTGGAGGG + Intergenic
1199004744 X:142682454-142682476 CATTGGGAGGCTCAGGTGGGTGG - Intergenic
1200174183 X:154100893-154100915 CCCTGGAAAGCTGAGGTGGAAGG + Intergenic