ID: 1011118585

View in Genome Browser
Species Human (GRCh38)
Location 6:83924694-83924716
Sequence GGGTCCTTGTATCTACTGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 86}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011118582_1011118585 12 Left 1011118582 6:83924659-83924681 CCAGAGTTTGGAAGGCTGCTTTG 0: 1
1: 0
2: 0
3: 23
4: 173
Right 1011118585 6:83924694-83924716 GGGTCCTTGTATCTACTGCTAGG 0: 1
1: 0
2: 0
3: 4
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011118585 Original CRISPR GGGTCCTTGTATCTACTGCT AGG Intronic
905244624 1:36603910-36603932 GTGTCCTCTCATCTACTGCTTGG - Intergenic
913155384 1:116092182-116092204 TGGTGCTGGTATCTGCTGCTGGG - Intergenic
919430649 1:197487365-197487387 GGGTGCTGGTACCTACTGCTGGG + Intergenic
924699376 1:246435803-246435825 GTTTCCTTGTATCTTCTCCTTGG - Intronic
1063313862 10:4983027-4983049 TGGTGCTGGTATCCACTGCTGGG + Exonic
1069328834 10:67265598-67265620 TGGTGCTTGTATCTAGTGCAGGG - Intronic
1070747770 10:78945157-78945179 CAGGCCTTGTAGCTACTGCTGGG - Intergenic
1072166547 10:92818896-92818918 GGGCCCTTGTATCTTCTAGTTGG + Intergenic
1075812037 10:125231419-125231441 AGGTCCCTGTAACTGCTGCTAGG + Intergenic
1078100434 11:8327428-8327450 GGGTCCTTGTCTTTACATCTTGG - Intergenic
1083855757 11:65392297-65392319 GGGTCCTTGTCTCTGCTCTTTGG - Intronic
1084596198 11:70118431-70118453 CAGGCCTTGTATCCACTGCTGGG - Intronic
1091149248 11:133311693-133311715 GGGCCCTTCTATCTGCTGCTAGG - Intronic
1093659010 12:21732644-21732666 ATGTCATTTTATCTACTGCTGGG + Intronic
1107290013 13:38841342-38841364 AGGTCTCTGTATCTTCTGCTCGG + Intronic
1115197239 14:30814589-30814611 GGGTGTGTGTATGTACTGCTTGG - Intergenic
1118913519 14:70081637-70081659 GTCTCCTTGTATCTGCTGTTAGG - Intronic
1127272849 15:57416643-57416665 AGGAACTTGTCTCTACTGCTGGG + Intronic
1134233946 16:12450965-12450987 GGGTCCCTGACTCAACTGCTTGG - Intronic
1135295604 16:21277259-21277281 GTGTCCATGTATCTATTTCTAGG - Intronic
1139772179 16:69286914-69286936 GAGTCCATGTATCTAGTACTTGG - Intronic
1142131403 16:88433135-88433157 GGGTCCTGGGACCTCCTGCTAGG - Exonic
1142940372 17:3375964-3375986 AGGTACTTGTATCCACTGCTGGG - Intergenic
1143260435 17:5594625-5594647 GGCTCCCTGTATCCACTTCTTGG - Intronic
1145825021 17:27870434-27870456 GGTTCCTGTTATCTATTGCTGGG - Intronic
1147833970 17:43316926-43316948 GGCTCCTGGGATCGACTGCTTGG + Intergenic
1148844462 17:50521088-50521110 GGGTCCTTGGACCTCATGCTAGG + Exonic
1150457009 17:65314250-65314272 GGGTCCCTGAACCTGCTGCTAGG + Intergenic
1152761912 17:82112935-82112957 TGGTCCTTGTAACTACGGCCTGG + Intronic
1154093777 18:11390759-11390781 CAGTCCTTGTATATACTGATAGG + Intergenic
1166953726 19:46447920-46447942 GGGTCCTGGAATCTGGTGCTGGG + Intergenic
1167390198 19:49189910-49189932 GGGTACTAGTATCTCCTCCTTGG - Intronic
928480177 2:31675436-31675458 TGGTGCTGGTACCTACTGCTGGG - Intergenic
929562190 2:42962869-42962891 GGGACCATGTATCTGCTGCAAGG + Intergenic
931345508 2:61441554-61441576 GTGTCCCTGTAACTTCTGCTCGG + Intronic
932612777 2:73212153-73212175 GAGTCCTTGTCTTTGCTGCTGGG - Exonic
935445730 2:103154554-103154576 GGGTCCTAGTATTCCCTGCTGGG + Intergenic
935647328 2:105350233-105350255 GGGACCTGTTAACTACTGCTGGG - Intergenic
935949684 2:108317286-108317308 AGGTGCTGGTATCCACTGCTGGG + Intergenic
936776837 2:115984582-115984604 GGGTGCTAGTACCTACTGCTGGG - Intergenic
943809700 2:192169473-192169495 TGGTCTTTGTATCTCCTGTTGGG + Intronic
1169678451 20:8181596-8181618 GAATCCTTGTATATACTTCTAGG - Intronic
1174700504 20:52603641-52603663 GGGTCCTTCTGTCTTCTGGTGGG + Intergenic
1178891096 21:36521764-36521786 GGGTCCTTGTGTCAGCTGATGGG + Intronic
1181425329 22:22833842-22833864 GGAACCTTGTCTCTGCTGCTTGG + Intronic
950378292 3:12590204-12590226 GGGTGCATGTACCTTCTGCTTGG - Intronic
959727462 3:109560495-109560517 AGGTGCTGGTATCTACAGCTGGG - Intergenic
963065174 3:141258078-141258100 AGGGCCTTGTTTCTGCTGCTGGG - Intronic
966565493 3:181376158-181376180 GGGTCAGTGTTGCTACTGCTTGG - Intergenic
969102991 4:4784158-4784180 GGGTCCCTGTAAGTACTACTGGG + Intergenic
969450649 4:7271172-7271194 GGGTCCTTCTGGCTGCTGCTGGG - Intronic
969565929 4:7978138-7978160 GGGTCCCTTTCTCTCCTGCTGGG + Intronic
969940696 4:10728095-10728117 GGCTTCTGGTATCTACTGATGGG + Intergenic
971721268 4:30247571-30247593 AGGTACTGGTATCCACTGCTGGG - Intergenic
972018718 4:34281071-34281093 TGGTGCTGGTATCCACTGCTGGG - Intergenic
983661542 4:170134737-170134759 AGGTGCTGGTATCCACTGCTGGG - Intergenic
986659793 5:10048854-10048876 TGGTCCATGAATCTAATGCTTGG - Intergenic
990326214 5:54678155-54678177 GGAGCCTTGAATTTACTGCTTGG - Intergenic
993796622 5:92275490-92275512 AGGTGCTGGTATCTACTACTGGG + Intergenic
994550701 5:101231472-101231494 TGGTACTGGTATCCACTGCTGGG - Intergenic
995192174 5:109329555-109329577 GGGGTCTTGTATATACTCCTGGG + Intergenic
995424655 5:112007031-112007053 AGGTCCCTGTCTCTACAGCTGGG + Intergenic
997849362 5:137317084-137317106 TGGTCCTTGATTTTACTGCTTGG + Intronic
997948617 5:138224132-138224154 TGGTCATTGTCTATACTGCTGGG - Intergenic
1011118585 6:83924694-83924716 GGGTCCTTGTATCTACTGCTAGG + Intronic
1012696551 6:102391438-102391460 AGGTGCTGGTATCCACTGCTGGG + Intergenic
1014263817 6:119251685-119251707 GGGTCTTTTTCTCTACTTCTAGG - Intronic
1014420967 6:121245232-121245254 AGGTGCTGGTATCCACTGCTGGG + Intronic
1014531989 6:122569604-122569626 TGGTGCTGGTATCCACTGCTGGG + Intronic
1017158791 6:151345996-151346018 AGGTCATTGTATATACTGTTTGG + Intronic
1018964227 6:168471660-168471682 GAGTCCTTGTATATTCTGGTGGG - Intronic
1025144132 7:56490340-56490362 GAGACCTTGTGTCTGCTGCTGGG - Intergenic
1026664591 7:72331426-72331448 GGGTCCCTGTATCTAGGGGTAGG - Intronic
1027838620 7:83278888-83278910 TGGTACTGGTATCTGCTGCTGGG - Intergenic
1030592221 7:111495933-111495955 GGGTCCTTGTGGCTGCAGCTGGG - Intronic
1031607700 7:123789494-123789516 GTGTCATTGTATTTCCTGCTTGG + Intergenic
1035962351 8:4151103-4151125 GGATCCTAATATCTTCTGCTGGG - Intronic
1055182200 9:73402011-73402033 AGGTGCTGGTATCCACTGCTGGG - Intergenic
1055593524 9:77842816-77842838 GGGTACGTGTATCTTCTGCCAGG + Intronic
1056324964 9:85469575-85469597 GGGTCCTTGTATCTCCCTATTGG + Intergenic
1056715132 9:89022243-89022265 GTGTCCTTGAATCTCCTTCTAGG - Intronic
1060441861 9:123647379-123647401 TGGTCCTTGTTGCCACTGCTGGG - Intronic
1187996161 X:24929177-24929199 GGATCCTTGGATCTAATACTTGG + Intronic
1193076629 X:77362646-77362668 AGGTGCTTGTATCCACAGCTGGG - Intergenic
1193791702 X:85822146-85822168 AGGTGCTGGTATCTACAGCTGGG + Intergenic
1194335754 X:92644238-92644260 GGGTGCTTGTAAACACTGCTGGG - Intergenic
1197660335 X:129164001-129164023 GTGTCATTGTTTCTAATGCTGGG - Intergenic
1197702303 X:129608497-129608519 AGGTCTTTGTAGATACTGCTGGG - Intergenic
1197828145 X:130612726-130612748 GGGTCATTGTTTCTAATGCCTGG + Intergenic
1197949757 X:131881471-131881493 GGGGCCTTTTCACTACTGCTGGG - Intergenic
1200644180 Y:5760989-5761011 GGGTGCTTGTAAACACTGCTGGG - Intergenic