ID: 1011121536

View in Genome Browser
Species Human (GRCh38)
Location 6:83959010-83959032
Sequence ATTCACCAGTTTTCAAAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 639
Summary {0: 1, 1: 0, 2: 4, 3: 63, 4: 571}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011121536 Original CRISPR ATTCACCAGTTTTCAAAGAA AGG (reversed) Intronic
900270488 1:1784760-1784782 AATCACCAGTTTGGAAAGCAGGG + Intergenic
900508856 1:3047642-3047664 ATTCTATAGTTTTCAAAGAAGGG - Intergenic
900833549 1:4982438-4982460 AATCACCAACTTTGAAAGAAAGG + Intergenic
903150205 1:21402208-21402230 ATTCATGAGTTTTCCATGAAAGG - Intergenic
903207210 1:21791588-21791610 ATTCATGAGTTTTCCGAGAAAGG + Intergenic
903618327 1:24678954-24678976 ATTCATGAGTTTTCCAGGAAAGG - Intergenic
903678154 1:25079211-25079233 ATGAAACAGTATTCAAAGAAAGG + Intergenic
904059233 1:27695035-27695057 ATTCATTAGTTTTCCAGGAAGGG + Intergenic
905292542 1:36932313-36932335 ATTCACCAGGTTTCTACGATTGG - Intronic
905571206 1:39007228-39007250 ATTCACCAGGTTTGAAAGATTGG - Intergenic
905749959 1:40453589-40453611 ATCCACATGTATTCAAAGAATGG + Intronic
908748777 1:67400161-67400183 ATTCATGAGTTTTCCAGGAAAGG - Intergenic
908851902 1:68385381-68385403 ATTCATGAGTTTTCCAGGAAAGG - Intergenic
909014300 1:70366664-70366686 ATTCATGAGTTTTCCAGGAAAGG + Intronic
909226996 1:73038249-73038271 ATTCAGCATTTATCAAAGAAAGG + Intergenic
909967864 1:81940099-81940121 ATTCAGCCATTTTCAATGAATGG + Intronic
910220888 1:84888772-84888794 ATTGACCAGTTATCAAGGGATGG - Intronic
910592462 1:88940979-88941001 ATTCCCCAGTGTTTAAGGAAAGG - Intronic
913678716 1:121167512-121167534 ATTTACCAGTTTTAAAAAAAAGG + Intergenic
914030547 1:143955156-143955178 ATTTACCAGTTTAAAAAAAAAGG + Intronic
914158900 1:145112805-145112827 ATTTACCAGTTTAAAAAAAAAGG - Intergenic
915219042 1:154359281-154359303 ATTCATGAGTTTTCCAGGAAAGG - Intergenic
916226628 1:162495646-162495668 ATTCATGAGTTTTCCAGGAAAGG + Intergenic
916436500 1:164782572-164782594 ATTCAGCAATTTTCAAAAACTGG + Intronic
916869190 1:168893866-168893888 ATTTACCAGTTTTCAGAGCAAGG + Intergenic
917181593 1:172303581-172303603 ATTCACCAAAGTTCAAATAAAGG + Intronic
917238487 1:172920345-172920367 ATTCATCAATTTTCATAGGAAGG - Intergenic
917532619 1:175850347-175850369 ATGCAACAATTTTCATAGAATGG - Intergenic
917566793 1:176220671-176220693 ATTCATGAGTTTTCTAGGAAAGG - Intergenic
918415476 1:184301870-184301892 TTTCATCAGTTTTGAAAAAATGG - Intergenic
918719786 1:187838569-187838591 ATTCCCCAGTTTTTACAAAAGGG - Intergenic
918926906 1:190798243-190798265 ATTCAACAGATTTAACAGAAAGG - Intergenic
919867030 1:201790037-201790059 ATTCTCCATTTTTCAAAGGAGGG - Intronic
920117699 1:203632141-203632163 TTTAACCATTTTTTAAAGAATGG - Intronic
920466014 1:206186048-206186070 ATTTACCAGTTTAAAAAAAAAGG + Intergenic
920918558 1:210278786-210278808 ATTCATGAGTTTTCAGGGAAAGG - Intergenic
921650102 1:217667504-217667526 AATGACCAGTTTTCTAAGAATGG + Intronic
921978882 1:221233546-221233568 TCTCACAAGTTTTAAAAGAATGG + Intergenic
922216598 1:223525136-223525158 ATTCATGAGTTTTCCAGGAAAGG + Intergenic
923294442 1:232580110-232580132 ATTCATGAGTTTTCCAGGAAAGG + Intergenic
923804294 1:237241705-237241727 ATTCATGAGTTTTCCAGGAAGGG + Intronic
924050431 1:240075034-240075056 ATTCATGAGTTTTCTGAGAAAGG + Intronic
924903068 1:248422816-248422838 ATTCACCAGCTTGCAAAAGATGG + Intergenic
924924788 1:248668991-248669013 ATTCACCAGCTTGCAAAAGATGG - Intergenic
1063719854 10:8569018-8569040 AATCCACTGTTTTCAAAGAAAGG - Intergenic
1063882078 10:10541528-10541550 ATTCATAAGTTTTCCAGGAAAGG + Intergenic
1063884850 10:10567231-10567253 ATTCTCTAGTTTTAAAATAAAGG - Intergenic
1064772472 10:18737802-18737824 ATTCACCTGTTTTCTGAGAAGGG + Intergenic
1064781798 10:18848200-18848222 ATTCAACAATTTAGAAAGAATGG + Intergenic
1065578770 10:27150745-27150767 ATTCATAAGTTTTCAGGGAAAGG - Intronic
1065838770 10:29682820-29682842 ATTCACCTGTCCTCATAGAATGG + Intronic
1065889297 10:30107508-30107530 ATTCATGAGTTTTCCAGGAAAGG - Intronic
1066387247 10:34951692-34951714 ATTCATGAGTTTTCCAGGAAAGG - Intergenic
1066800260 10:39180486-39180508 ATTCAGCAATTTTGAAACAAAGG + Intergenic
1068589036 10:58834697-58834719 ATTTTCCAGTTTTCTAAGATTGG + Intergenic
1068647391 10:59482596-59482618 TTTAACCAGATTTCAAAGAATGG - Intergenic
1068907191 10:62340021-62340043 ATTCATGAGTTTTCCAGGAAAGG + Intergenic
1069405458 10:68093878-68093900 ATTCACGAGTTTTCCAGGAAAGG + Intergenic
1069437025 10:68393764-68393786 ATTCACAAGTTTGCAAATACTGG - Intronic
1069484175 10:68810561-68810583 ATTCACGAGTTTTCCAGGAAAGG + Intergenic
1069785518 10:70985545-70985567 ATTCATGAGTTTTCAGGGAAAGG - Intergenic
1070481765 10:76889919-76889941 AATCACCATTTTGCAGAGAAGGG - Intronic
1070575988 10:77679406-77679428 ATTCATGAGTTTTCCAGGAAAGG - Intergenic
1070745678 10:78932270-78932292 ATTCACCACTCTTACAAGAAAGG - Intergenic
1070786551 10:79165537-79165559 ATTCATGAGTATTCAAGGAAAGG + Intronic
1071082216 10:81825936-81825958 ATTCATGAGTTTTCTGAGAAAGG + Intergenic
1071323973 10:84493594-84493616 ATTCATGAGTTTTCCGAGAAAGG + Intronic
1071331653 10:84566428-84566450 ATTCACGAGTTTTCCAGGAAAGG - Intergenic
1071671724 10:87615317-87615339 AATCACCTCTTTTCAAATAAAGG + Intergenic
1071675441 10:87651405-87651427 ATTCATCAGTTTTCCTGGAAAGG - Intergenic
1071715308 10:88089531-88089553 GTTCACCTGTTTTCAATTAATGG + Intergenic
1071743653 10:88390581-88390603 GTGCACCAAGTTTCAAAGAAAGG - Intronic
1071882442 10:89914159-89914181 ATTCACTACATTACAAAGAATGG - Intergenic
1072375550 10:94812312-94812334 ATTCACCAAGGTTAAAAGAAAGG - Intronic
1072389418 10:94967958-94967980 ATTCACCAAGGTTAAAAGAAAGG - Intronic
1074111545 10:110426287-110426309 ATTGCCCAGATTTAAAAGAAAGG + Intergenic
1074467426 10:113695903-113695925 ATTCACAAGTTTTCCAAGGAAGG - Intronic
1074614278 10:115050918-115050940 ATTCACAAGTTTTCCAGGAAAGG - Intergenic
1074648337 10:115490164-115490186 ATTCACCAATGTTCAAATGAAGG - Intronic
1074908853 10:117888922-117888944 TTTAACCAGTTTGCAAATAAGGG - Intergenic
1076233668 10:128846547-128846569 ATACACCATTTCTCAAACAAAGG + Intergenic
1077084441 11:741709-741731 ATTCATGAGTTTTCCAGGAAAGG + Intergenic
1078072562 11:8126528-8126550 ATTAACCAGTTTTAAATGTACGG - Intronic
1079235114 11:18682741-18682763 ATTCATAAGTTTTCTAGGAAAGG - Intergenic
1079947996 11:26767333-26767355 ATTCATGAGTTTTCCAGGAAAGG - Intergenic
1080253058 11:30257691-30257713 ATTCACAAGTTTTCTGGGAATGG - Intergenic
1080321176 11:31011517-31011539 CTTCACCAGTAGTCAGAGAAGGG + Intronic
1080400815 11:31934079-31934101 ATTCCCAAATTTTCAAACAATGG + Intronic
1080845938 11:36026835-36026857 ATTCATAAGTTTTCTAGGAAAGG - Intronic
1082291213 11:50373943-50373965 ATTCAGCAGTTTGGAAACAATGG + Intergenic
1082297171 11:50455724-50455746 ATTCAGCAGTTTGCAAAAACTGG + Intergenic
1082298064 11:50468758-50468780 ATTCAGCAGTTTGCAAACACTGG + Intergenic
1082304864 11:50559873-50559895 ATTCAGCAGTTTGCAAACACTGG - Intergenic
1082580811 11:54865994-54866016 ATTCAGCAGTTTGGAAACAAAGG - Intergenic
1082594317 11:55056477-55056499 ATTCAGCAGTTTGCAAACACTGG - Intergenic
1082595841 11:55080779-55080801 ATTCAGCAGTTTGGAAACAATGG - Intergenic
1083283206 11:61640299-61640321 ATTCATGAGTTTTCCCAGAAAGG - Intergenic
1084277686 11:68063069-68063091 TCTCAACAGTTTTCAAAGCAGGG - Intronic
1084758758 11:71255020-71255042 ATTCACCAGGTTTTGCAGAAAGG + Intergenic
1084991292 11:72927677-72927699 GTTCAGTAGTTTTCAAAGTATGG - Intronic
1085505124 11:77054279-77054301 ATTCATGAGTTTTCCAGGAAAGG - Intergenic
1086190000 11:84067839-84067861 ATTTAGCATTTTTCCAAGAAAGG + Intronic
1086312462 11:85549927-85549949 ATTCATGAGTTTTCTAGGAAAGG - Intronic
1086808658 11:91276496-91276518 TTTCACCATTGTTCAATGAATGG + Intergenic
1087052996 11:93905090-93905112 TTTCACCAGTTTTGAAGGGAGGG + Intergenic
1087265066 11:96051639-96051661 ATTCAACAGTTTTCTATGCAGGG + Intronic
1087361057 11:97160101-97160123 ATTCACTATTTTTTAAATAATGG - Intergenic
1089597727 11:119592274-119592296 ATTCATGAGTTTTCCAGGAAAGG - Intergenic
1089662539 11:119994694-119994716 AGTCACCAGTTTTGGAGGAATGG - Intergenic
1090032464 11:123218885-123218907 ATTCACGAGTTTTCTGGGAAAGG - Intergenic
1090099424 11:123778519-123778541 TTTCTCCAGTTTTCAAGGTAAGG - Intergenic
1092005760 12:5068870-5068892 AATCACCATTTTACAAATAAGGG - Intergenic
1092344209 12:7702116-7702138 TCTTACTAGTTTTCAAAGAAAGG + Intergenic
1092532774 12:9359432-9359454 ACTCACCAGGGTTCAAATAAAGG - Intergenic
1093139318 12:15489438-15489460 ATTCATGAGTTTTCCAAAAAGGG + Intronic
1093276185 12:17130773-17130795 AAACAGCAGTTTTCTAAGAAGGG + Intergenic
1093335870 12:17904510-17904532 ATTCACCAATGTTGAAACAAAGG - Intergenic
1093788271 12:23217007-23217029 ATTCACGAGTTTTCTGGGAAAGG + Intergenic
1095124123 12:38455448-38455470 ATTGATGATTTTTCAAAGAATGG + Intergenic
1095305817 12:40637838-40637860 ATTCATGAGTTTTCCAGGAAAGG - Intergenic
1095543827 12:43342066-43342088 ATTCATGAGTTTTCTAGGAAAGG - Intergenic
1095996112 12:48086187-48086209 CATTACCAGTTTTCAAAGCAAGG - Intronic
1097964277 12:65562390-65562412 ATTCATGAGTTTTCCAGGAAGGG - Intergenic
1098175952 12:67791752-67791774 ATTCACCAGTGTTGAAATGAAGG - Intergenic
1098569574 12:71973536-71973558 ATTCATGAGTTTTCTAGGAAAGG - Intronic
1098997477 12:77137341-77137363 ATGCTCTAGCTTTCAAAGAAAGG - Intergenic
1099247611 12:80213145-80213167 ATTCATGAGTTTTCCAGGAAAGG + Intronic
1099868320 12:88313606-88313628 ATTCAGCCTTTTTTAAAGAAAGG + Intergenic
1100701298 12:97151449-97151471 ATTCACGAGTTTTCTGGGAAAGG + Intergenic
1101010301 12:100442746-100442768 AGGCACCAGTTTTAAAAGCATGG - Intergenic
1101557111 12:105820678-105820700 ATTCAAAAGTTTTCATAGGATGG + Intergenic
1102757150 12:115351011-115351033 ATTCAGCAGGTCTGAAAGAAGGG + Intergenic
1102842390 12:116139371-116139393 ATTCTTCTTTTTTCAAAGAAGGG + Intronic
1103144434 12:118582407-118582429 ATTCATGAGTTTTCTAGGAAAGG + Intergenic
1103628099 12:122235969-122235991 TTTCTGCAATTTTCAAAGAAGGG + Intronic
1104150448 12:126077148-126077170 TTTCATCATTTTGCAAAGAATGG - Intergenic
1104233456 12:126908122-126908144 ATTCATGAGTTTTCCAGGAAAGG + Intergenic
1106653180 13:31714395-31714417 CGTCAACAGTTTTTAAAGAAAGG + Intergenic
1106881349 13:34134528-34134550 TTTAACCAGGTGTCAAAGAAAGG + Intergenic
1107708645 13:43131573-43131595 ATTCACGAATTTTCCAGGAAAGG + Intergenic
1107766271 13:43738531-43738553 ATTTACTACTTTTCAAAGAGAGG + Intronic
1109859046 13:68172878-68172900 ATTTACTTGTTTTCAGAGAATGG + Intergenic
1109865781 13:68261084-68261106 TTTCACCAGTTTGCACAGGAAGG - Intergenic
1110157637 13:72337725-72337747 ATTCACCTGTCTTCAAAGGATGG + Intergenic
1110191509 13:72734850-72734872 ATTTGCCAGTTTTCAATGAAGGG + Intronic
1110263999 13:73518006-73518028 ATTCACAAGTTTTCTGGGAAAGG + Intergenic
1110632914 13:77730314-77730336 GTTCACCAGATTTCCAAAAAAGG - Intronic
1110927679 13:81175879-81175901 ATTGACAAGATTTCAAATAAAGG + Intergenic
1111266668 13:85824025-85824047 ATTCATGAGTTTTCCAGGAAAGG - Intergenic
1111886589 13:94029201-94029223 ATTCACCATTTTGCTTAGAAAGG + Intronic
1112536098 13:100257180-100257202 AATCACCATTTTTGAAAAAAGGG + Intronic
1112816995 13:103284271-103284293 ATCCAACAGTTATCAAAGATGGG + Intergenic
1113035766 13:106047218-106047240 AATCCCCACTTTTCAAAGGAGGG + Intergenic
1114297669 14:21344535-21344557 TTTCAGTAGTTTTTAAAGAAAGG + Intronic
1115702264 14:35965421-35965443 ATTCATCAGTGTTCACACAAAGG + Intergenic
1115721568 14:36167312-36167334 TTTCACCAGTGTGCAGAGAAAGG - Intergenic
1116093402 14:40336941-40336963 ATTCATGAGTTTTCCAGGAATGG + Intergenic
1116112017 14:40597093-40597115 ATTATCCCCTTTTCAAAGAAAGG - Intergenic
1116345710 14:43790697-43790719 ATTCATGAGTTTTCAGAGAAGGG + Intergenic
1116787826 14:49307674-49307696 ATTCATAAGTTTTCCAGGAAAGG + Intergenic
1117356373 14:54927298-54927320 ATTTGCCAGTTTTCAGAGACAGG + Intergenic
1117356421 14:54927943-54927965 ATTTGCCAGTTTTCAGAGACAGG - Intergenic
1117666154 14:58058487-58058509 ATTCATGAGTTTTCCAGGAAAGG + Intronic
1117743663 14:58845478-58845500 AATCACTAGTTTTCATAAAATGG - Intergenic
1118030549 14:61813452-61813474 CTTAACCAGTTTTCACAGACGGG - Intergenic
1118675048 14:68175020-68175042 ATTCCCCAGGATTCAAAGTATGG - Intronic
1119101472 14:71883896-71883918 ATTCATGAGTTTTCCAGGAAAGG - Intergenic
1120061258 14:79985620-79985642 ATTCATGAGTTTTCTAGGAAAGG + Intergenic
1120159462 14:81130067-81130089 AATCATCAGTTTTCCAAGAAAGG - Intronic
1120478120 14:85014637-85014659 AGTCTCCAGTGTTGAAAGAATGG + Intergenic
1121462757 14:94094620-94094642 ATTCACGAGTTTTCTGGGAAAGG - Intronic
1121477655 14:94226052-94226074 ATTCAAAACTTTGCAAAGAAAGG - Intronic
1121666926 14:95679677-95679699 ATTCATGAGTTTTCCAGGAAAGG - Intergenic
1121934578 14:98005672-98005694 ATTCATCAGCTTTCAAAGCCTGG + Intergenic
1122080078 14:99261040-99261062 GTTCACCCGATTCCAAAGAACGG + Intronic
1122238902 14:100348848-100348870 AATGACCAGTCTTCTAAGAAAGG - Intronic
1202830354 14_GL000009v2_random:21507-21529 ATTCACCTCTCATCAAAGAAAGG - Intergenic
1124418545 15:29494837-29494859 ATTAGCCAGCCTTCAAAGAAAGG - Intronic
1124419922 15:29512066-29512088 ATTTACCATTTTTCAAATATTGG - Intronic
1124438886 15:29672995-29673017 ATACACGAGTTTTCCAGGAAAGG + Intergenic
1124446036 15:29733617-29733639 AATCAGCAGTTCTCAAATAAAGG + Intronic
1124607653 15:31183105-31183127 AATCCCCAGTGTTAAAAGAAGGG - Intergenic
1124824900 15:33084052-33084074 ATTCATGAGTTTTCCAGGAAAGG - Intronic
1125396554 15:39255006-39255028 CTTCACTAGTTTTCAAACCAAGG + Intergenic
1125661071 15:41395284-41395306 ACTCACCTGTGTTCAATGAATGG + Intronic
1126431359 15:48588794-48588816 CTTCACCAGTTTCCCAGGAAGGG - Intronic
1126726165 15:51634678-51634700 ATTCACGAGTTTTCCAGGAAAGG + Intergenic
1127431173 15:58910236-58910258 CTTCAGCTGTTTTCAAATAATGG - Intronic
1127579674 15:60326760-60326782 CTCCATCAGTTTTCAAAAAAGGG - Intergenic
1127759201 15:62121427-62121449 ATTCACAAGTTTTCCGGGAAAGG + Intergenic
1128342059 15:66829366-66829388 ATTCATGAGTTTTCCAGGAAAGG - Intergenic
1129154003 15:73706401-73706423 TTTATCCAATTTTCAAAGAAGGG - Intronic
1130308627 15:82733195-82733217 ATTCACAAGTTTTCCAGGAAAGG - Intergenic
1131063643 15:89419414-89419436 AAACACAAGTTTTCAGAGAAAGG + Intergenic
1131352126 15:91710517-91710539 ATTCATAAGTTTTCAGAGAAAGG - Intergenic
1131626150 15:94122971-94122993 ATTCATGAGTTTTCCCAGAAAGG + Intergenic
1133081090 16:3320742-3320764 ATGCAGGAGATTTCAAAGAATGG + Intergenic
1134388787 16:13799120-13799142 TTTCACCAGTTTTCTACTAATGG + Intergenic
1135667644 16:24349492-24349514 ATTCATAAGTTTTCCAGGAAAGG + Intronic
1135809181 16:25571948-25571970 ATTCATGAGTTTTCCAGGAAAGG - Intergenic
1135820335 16:25679629-25679651 ATTCATGAGTTTTCCAGGAAAGG + Intergenic
1136901656 16:34045961-34045983 AATGTCCAGTTTTCAAAAAAAGG + Intergenic
1137045388 16:35653013-35653035 ATTCACCAGTTTGGAAACACTGG + Intergenic
1137277153 16:46943173-46943195 ATTCATGAGTTTTCCAGGAAAGG + Intergenic
1138334882 16:56245243-56245265 GCTCACCAGATTTCTAAGAATGG - Intronic
1138980305 16:62259658-62259680 ATTCATGAGTTTTCCAGGAAAGG - Intergenic
1139204775 16:65016866-65016888 ATTCATAAGTTTTCCAGGAAAGG + Intronic
1139280370 16:65765324-65765346 ATTCATGAGTTTTCCAGGAAAGG - Intergenic
1139934488 16:70559310-70559332 GTTCACCTGTTTTCAGAGTAAGG + Intronic
1140023703 16:71263813-71263835 ATTCATGAGTTTTCCAAGAAAGG - Intergenic
1140358040 16:74322507-74322529 ATTCATGAGTTTTCCAGGAAAGG - Intergenic
1140717424 16:77739334-77739356 ATTCATGAGTTTTCCAGGAAAGG + Intronic
1141011460 16:80404352-80404374 ATTCACCATTTTTTAAAATAGGG + Intergenic
1141964592 16:87433274-87433296 ATTCAGCAGTTTTCAAAACCAGG + Intronic
1142208880 16:88798033-88798055 ATACACTAGATTTCAAAGACCGG + Intergenic
1203011761 16_KI270728v1_random:298713-298735 ATTCAGCAGTTTTGAAACACTGG + Intergenic
1203030096 16_KI270728v1_random:571872-571894 ATTCAGCAGTTTTGAAACACTGG + Intergenic
1203041625 16_KI270728v1_random:762559-762581 ATTCAGCAGTTTTGAAACACTGG - Intergenic
1143681858 17:8481692-8481714 AAGCACCAGCTTTCCAAGAAGGG - Intronic
1144084541 17:11797243-11797265 TTTCACCAGTATTGAATGAAGGG - Intronic
1145180579 17:20747419-20747441 GTTCAGCAGTTTTACAAGAATGG - Intergenic
1146563395 17:33891021-33891043 AATCAGCATTCTTCAAAGAAGGG - Intronic
1147817911 17:43223644-43223666 ATCCAGCAGTTTTCCAAGGATGG + Intergenic
1148592317 17:48825574-48825596 ATTCATGAGTTTTCTAGGAAAGG + Intergenic
1149215090 17:54345276-54345298 ATTCATCAGTTTTCCAGGAAAGG - Intergenic
1149694619 17:58607200-58607222 TGTTACCAGCTTTCAAAGAAGGG + Intronic
1149840179 17:59956402-59956424 GTTCAGCAGTTTTACAAGAATGG - Intronic
1151052050 17:70989455-70989477 ATTCATGAGTTTTCTGAGAAAGG + Intergenic
1151401667 17:73859706-73859728 ATTCATCAGTTTTCCAGGAAAGG - Intergenic
1151402065 17:73862258-73862280 ATTCATCAGTTTTCGGGGAAAGG + Intergenic
1155400358 18:25432297-25432319 ATTTACCAATTTTCAAAATAAGG - Intergenic
1155522679 18:26685057-26685079 ATTCACCAGCTTCCATGGAATGG - Intergenic
1156137013 18:34053723-34053745 AATAACCAGTTTCCAAAAAAGGG + Intronic
1157265680 18:46218881-46218903 ATTCAGCTGTTTACACAGAATGG + Intronic
1157321440 18:46637682-46637704 CCTCACCAGTAATCAAAGAAAGG + Intronic
1158569029 18:58580904-58580926 ATTCATGAGTTTTCCAAGAAAGG - Intronic
1158595675 18:58813908-58813930 ATTCTCCAAGTTTCCAAGAAGGG + Intergenic
1159134490 18:64321314-64321336 ATTCATGAGTTTTCCAGGAAAGG + Intergenic
1159152651 18:64539866-64539888 ATTCATGAGTTTTCCAGGAAAGG + Intergenic
1159226820 18:65549023-65549045 ATTCAACAACTTTTAAAGAAAGG + Intergenic
1164612811 19:29644441-29644463 ATTCATGAGTTTTCTAGGAAAGG - Intergenic
1164770700 19:30806569-30806591 ATTCATGAGTTTTCCAGGAAAGG - Intergenic
1166119483 19:40677123-40677145 ACTCAACAGTTTACAAAGTAGGG - Intronic
1166401840 19:42487302-42487324 ATTCATGAGTTTTCCAGGAAAGG + Intergenic
1166402887 19:42496546-42496568 ATTCATGAGTTTTCCAAGGAAGG + Intergenic
1168547795 19:57268073-57268095 ATTCACGAGTTTCCCAGGAAAGG - Intergenic
1202642335 1_KI270706v1_random:106266-106288 ATTCACCTCTCATCAAAGAAAGG + Intergenic
925068095 2:945171-945193 ATTCATGAGTTTTCAGGGAAAGG + Intergenic
925223488 2:2161930-2161952 CTAAACCAGTATTCAAAGAACGG - Intronic
926259561 2:11245886-11245908 ATTTACCAGTTTTCAAAATAAGG - Intronic
926442478 2:12904307-12904329 TTTCACCAGTTTTATAAGAACGG + Intergenic
926873856 2:17453009-17453031 AATCACCAGTTTTCAAGTTAAGG - Intergenic
930454846 2:51593721-51593743 ATTCAACATATTTAAAAGAAGGG + Intergenic
931004273 2:57829665-57829687 ATTCACCAATGTTGAAATAAAGG + Intergenic
934161456 2:89253389-89253411 ACTGAGCAGTTTTCATAGAAGGG - Intergenic
935336842 2:102024075-102024097 AAACACGAGTTTTTAAAGAAGGG + Intronic
936429648 2:112451132-112451154 ATTCATGAGTTTTCCAGGAAAGG + Intergenic
937009578 2:118550602-118550624 AGTCAACAGTCTTCAAACAATGG + Intergenic
937099525 2:119258069-119258091 ATTCATGAGTTTTCCAGGAAAGG + Intronic
937712496 2:124994359-124994381 ATTCATGAGTTTTCCAGGAAAGG - Intergenic
939201532 2:139042096-139042118 ATGCACCAGTTTTCAAGAAAAGG + Intergenic
939207383 2:139124714-139124736 TTTCTCCATTTTTCAAAGCACGG - Intergenic
939292231 2:140211524-140211546 ATTCATGAGTTTTCTGAGAAAGG + Intergenic
939295551 2:140259514-140259536 ATTAATAAATTTTCAAAGAATGG - Intronic
939323812 2:140660726-140660748 CTCCAACAGCTTTCAAAGAAAGG + Intronic
939774730 2:146370450-146370472 AATCAATAGTTTTCAAAAAAAGG + Intergenic
941638045 2:167957228-167957250 ATTAATCAGTATTTAAAGAAAGG + Intronic
941993375 2:171578233-171578255 ATTCATGAGTTTTCCAGGAAAGG + Intergenic
942159565 2:173168688-173168710 ATTCAGTATTTTTCAATGAAAGG - Intronic
942938125 2:181583008-181583030 AATTACCAGTTTTCACAGTAAGG - Intronic
943416138 2:187607011-187607033 AAGCACCAGTTTTCTAAGAAAGG + Intergenic
943924748 2:193759762-193759784 ATTCACCATGTTTCAAGGAAGGG - Intergenic
944476026 2:200107661-200107683 ATTCCTCAGTTTTCCAGGAAAGG + Intergenic
944823255 2:203453132-203453154 ATTCAGCAGTTTTCAAAATGAGG - Intronic
944898174 2:204187381-204187403 ATTCATGAGTTTTCCAGGAAAGG + Intergenic
945298680 2:208195725-208195747 ATTCATGAGTTTTCCAGGAATGG - Intergenic
946091127 2:217224970-217224992 ATTCACCATTTATCAAGGCAAGG - Intergenic
946259716 2:218477154-218477176 GTTGTCCAGTTTTCAAAGCATGG - Intronic
946444446 2:219726346-219726368 ATTCATGAGTTTTCCAGGAAAGG + Intergenic
946646197 2:221837248-221837270 ATTCACCAGTTTTGAATTATAGG - Intergenic
946796945 2:223364541-223364563 ATTTTCCAGCTTTCACAGAAAGG + Intergenic
947097250 2:226580224-226580246 ATTCAGGAGTTTTCAGGGAAAGG + Intergenic
948211412 2:236195987-236196009 CTTAACCAGTGTCCAAAGAAAGG - Intronic
948286397 2:236789157-236789179 ATTAACAATTTTTCAAAAAAAGG + Intergenic
948580495 2:238984571-238984593 TTTCACCTGTTTTCCAAGAAAGG + Intergenic
1169044693 20:2525800-2525822 ATTCAGGAGTTTTCCAGGAAAGG + Intergenic
1169278972 20:4251116-4251138 ATTGGCCAGTTTTCAAAGACTGG + Intergenic
1169565793 20:6852296-6852318 ATTCATGAGTTTTCCAGGAAAGG + Intergenic
1169675829 20:8153565-8153587 CTCCACCGGTTTTGAAAGAAAGG + Intronic
1169679126 20:8190231-8190253 ATTAACCAGGTTTCACAAAAAGG - Intronic
1169782035 20:9320194-9320216 ATTCATGAGTTTTCCAGGAAAGG + Intronic
1171889441 20:30696448-30696470 ATTCACCTCTCATCAAAGAAAGG + Intergenic
1172798499 20:37559858-37559880 ATTCATGAGTTTTCCAGGAAAGG - Intergenic
1173731479 20:45331806-45331828 ATTCATGAGTTTTCCAACAAAGG - Intronic
1174105274 20:48157503-48157525 ATTCATGAGTTTTCCAGGAAAGG - Intergenic
1174516124 20:51093724-51093746 ATTCATGAGTTTTCCAGGAAAGG - Intergenic
1174916697 20:54661071-54661093 ATTCATGAGTTTTCCAGGAAAGG + Intergenic
1175058212 20:56217481-56217503 ATTCATGAGTTTTCCAGGAAAGG - Intergenic
1176609541 21:8866345-8866367 ATTCACCTCTCATCAAAGAAAGG - Intergenic
1178077294 21:29023903-29023925 ACTTACAAATTTTCAAAGAATGG + Intergenic
1178080538 21:29059130-29059152 TTTCACTAGTTCTCAAAGTATGG - Intronic
1178602418 21:34005992-34006014 ATCCAGCATTTTTCAAAGCATGG + Intergenic
1179515615 21:41904326-41904348 ATTCACGAGTTTTCTACGAGGGG - Intronic
1181504865 22:23346645-23346667 TTTCAATAGTTTTTAAAGAAAGG + Intergenic
1181655978 22:24299266-24299288 TTTCAATAGTTTTTAAAGAACGG + Intronic
1182102463 22:27667742-27667764 ATTCACCAATCTCCAGAGAAGGG - Intergenic
1182538389 22:31023413-31023435 ATTCATGAGTTTTCCAGGAAAGG + Intergenic
1182870482 22:33642084-33642106 ATTCTCCAGGTTTGAAACAAAGG + Intronic
1182965503 22:34517794-34517816 ATTCATGAGTTTTCCAGGAAAGG - Intergenic
1182985241 22:34710108-34710130 ATTCATGACTTTTTAAAGAAAGG - Intergenic
1183325470 22:37189057-37189079 ATTCATGAGTTTTCCAGGAAAGG + Intronic
1183326155 22:37195688-37195710 ATTAATCAGTTTTCCAAGAAAGG + Intronic
1183438160 22:37807450-37807472 ATTCTCCAGTCTTCAAAGTGAGG - Intergenic
1184297487 22:43534131-43534153 AATCACCAGTTGTCAAGGGAGGG + Intronic
949094939 3:74818-74840 ATTCATGAGTTTTCAGGGAAAGG + Intergenic
949439409 3:4064433-4064455 ATTCATGAGTTTTCCAGGAAAGG - Intronic
949643321 3:6065099-6065121 ACTCACCTGGTGTCAAAGAAGGG - Intergenic
949673534 3:6426496-6426518 ATTCATGAGTTTTCCAGGAAAGG + Intergenic
951700233 3:25488853-25488875 GTTCTCCAGTTTTCAATTAAAGG - Intronic
952117133 3:30196229-30196251 ATTCAGCAGTTCTCAAAGAATGG - Intergenic
952219564 3:31311743-31311765 ATTCATGAGTTTTCCAAGACAGG + Intergenic
952294230 3:32047407-32047429 ATTCACGAGTTTTCCCGGAAAGG + Intronic
952653825 3:35759826-35759848 ATTCTTCAGTTTAAAAAGAATGG - Intronic
953730862 3:45446742-45446764 TTTCACCAGTTTGTAAAGTAAGG - Intronic
954484150 3:50830936-50830958 ATTCAAGAGTTTTCTAGGAAAGG + Intronic
955197686 3:56820337-56820359 ACTCACCAGTTTACAGAAAACGG + Intronic
955417609 3:58706958-58706980 ATTCATGAGTTTTCCAGGAAAGG - Intergenic
956117248 3:65930902-65930924 ATTCATGAGTTTTCCAGGAAAGG - Intronic
956189334 3:66593696-66593718 ATTTCCCAGTTTGCAAGGAAGGG - Intergenic
956390730 3:68770531-68770553 AAACACCAGTTTTCAAACTAGGG + Intronic
956738103 3:72254397-72254419 AATCAGCAGTTCTCAAAGCATGG + Intergenic
958138479 3:89528553-89528575 ATTAGCCAGTGTTCAAACAAAGG + Intergenic
959053410 3:101546067-101546089 ATTCATGAGTTTTCCAGGAAAGG + Intergenic
959574811 3:107923484-107923506 ATTCTAAAATTTTCAAAGAATGG + Intergenic
959649103 3:108734575-108734597 ATTCATGAGTTTTCCAGGAAAGG - Intergenic
959673501 3:109007167-109007189 ATTCTCCATTTCTTAAAGAAGGG + Intronic
959903635 3:111686788-111686810 ATTGAACAATTTTAAAAGAAAGG - Intronic
960151499 3:114253354-114253376 AATCACTAGTTTTCAAAGTTTGG - Intergenic
960172661 3:114480873-114480895 ATTTTCCATTTTTCAAACAATGG + Intronic
960449555 3:117789778-117789800 ATACACCAGTTTTCATACAGCGG + Intergenic
960704626 3:120469998-120470020 ATTCATGAGTTTTCCAGGAAAGG - Intergenic
961989540 3:131173065-131173087 ATTCATGAGTTTTCCAGGAAAGG - Intronic
962060547 3:131922526-131922548 TATGACCAGTTATCAAAGAATGG + Intronic
963766543 3:149342361-149342383 TTTCACCAGTTTTCTATGGATGG - Intergenic
964250457 3:154710444-154710466 ATTCATTATTTTCCAAAGAAGGG - Intergenic
964281880 3:155076731-155076753 ATTCATGAGTTTTCAGGGAAAGG + Intronic
964991229 3:162815159-162815181 CTTCAACAGTTTTTTAAGAACGG + Intergenic
965365500 3:167794068-167794090 ATTCACCTGATTTTTAAGAAGGG - Intronic
966001631 3:174955904-174955926 AATCACAAGTTTTCAAAGTGTGG - Intronic
966224546 3:177583936-177583958 AAACACCAGTTTTCAAAAAGTGG - Intergenic
966241519 3:177759480-177759502 ATTCACAAGTTTTCTGGGAAAGG - Intergenic
967255952 3:187591944-187591966 CTTCAAAAGTTTTCAAAGCAGGG - Intergenic
967391378 3:188959097-188959119 ATTCACCAGTTTTTCAACACTGG + Intronic
968042811 3:195601906-195601928 ATTCACGAGTTTTCTGGGAAAGG + Intergenic
968208919 3:196830403-196830425 ATCCAACTGTTTACAAAGAATGG - Exonic
1202736221 3_GL000221v1_random:1114-1136 ATTCACCTCTCATCAAAGAAAGG - Intergenic
969909827 4:10433592-10433614 ATTGACCAAGTTGCAAAGAATGG - Intergenic
970221182 4:13812630-13812652 ATTCACGAGTTTTCTGGGAAAGG - Intergenic
970808149 4:20060208-20060230 TTTTACCAGTTTTCAAATATTGG + Intergenic
971599931 4:28580006-28580028 TTTCAAAAGATTTCAAAGAATGG + Intergenic
971768184 4:30861513-30861535 ATTCACAAGTGTTGAAATAAGGG - Intronic
971850122 4:31974779-31974801 ATTCATGAGTTTTCCAGGAAAGG - Intergenic
971942162 4:33229311-33229333 TTTAACCAGTTTTCAAACAAGGG + Intergenic
971957859 4:33445607-33445629 ATTCCCCAGTTATTAAAGAAAGG + Intergenic
971978688 4:33725264-33725286 ATTCATGAGTTTTCCAGGAAAGG - Intergenic
971984046 4:33795935-33795957 ATTCACCAGACTTTAAAAAATGG - Intergenic
972864979 4:43220742-43220764 AGTCACCAGTTGACAGAGAAGGG + Intergenic
973148597 4:46860550-46860572 ATTCACCAGATGTCAAAGAAGGG - Intronic
973316580 4:48766811-48766833 AAATACCAGTTTTCAAAGTAAGG + Intronic
973541987 4:51944143-51944165 ATTCATGAGTTTTCTGAGAAAGG - Intergenic
973560554 4:52130959-52130981 AATCATCAGTACTCAAAGAAGGG - Intergenic
973834260 4:54793318-54793340 ATCCAACAATTTTCAAAGCAGGG + Intergenic
973942560 4:55925414-55925436 ATTCATTAGTTTTCCAGGAAAGG + Intergenic
974072356 4:57135884-57135906 ATTCACCAGTTTTTAAGGAAAGG + Intergenic
974304128 4:60109542-60109564 ATTCACATTTTTTCAAAGTAGGG - Intergenic
974721493 4:65744604-65744626 ATTCATGAGTTTTTCAAGAAAGG - Intergenic
975415042 4:74096307-74096329 ATTCATGAGTTTTCTAGGAAAGG + Intergenic
975586066 4:75950682-75950704 ATTTACCAATTTTCAGAGCAAGG + Exonic
975781880 4:77848671-77848693 ATTCATGAGTTTTCCAGGAAAGG + Intergenic
977163522 4:93666542-93666564 ATTCAACAGTGTTTATAGAATGG - Intronic
977203703 4:94146923-94146945 ATTCACCAAGTTTGAAATAAAGG - Intergenic
977404751 4:96582289-96582311 ATTCATAATTTTTAAAAGAAAGG + Intergenic
977615586 4:99084517-99084539 ATTCGTGAGTTTTCCAAGAAAGG - Intronic
977971660 4:103219636-103219658 CTGCACTAGTTCTCAAAGAAGGG + Intergenic
978245772 4:106570899-106570921 GTTCACAGGTTTTCTAAGAATGG - Intergenic
978653774 4:111041538-111041560 CTTCACCTGTTTTCACACAAAGG + Intergenic
978725074 4:111959986-111960008 ATTCACCAGTTTATTAAGCAGGG + Intergenic
979067462 4:116156493-116156515 ATTCATGAGTTTTCCAAAAAAGG + Intergenic
979211468 4:118109415-118109437 ATTCCCCAGTATTCAACGATGGG - Intronic
979631421 4:122907008-122907030 ATTCATGAGTTTTCCAGGAAAGG - Intronic
980224846 4:129969318-129969340 ATTAAACACTTTTCAAAAAAAGG + Intergenic
980571813 4:134629621-134629643 AATCACCACTATTCTAAGAACGG + Intergenic
981289443 4:143056993-143057015 AATCACCAGTTTGGGAAGAAGGG + Intergenic
981318200 4:143362505-143362527 ATTCATGAGTTTTCCAGGAAAGG + Intronic
982150296 4:152446908-152446930 GTTCATCAGTGTTCACAGAAGGG + Intronic
982201432 4:152965012-152965034 ATTTATCAGTTTTCATAAAAAGG - Intronic
982409550 4:155059078-155059100 ATTCATGAGTTTTCCAAGAAAGG + Intergenic
982472584 4:155811215-155811237 ATTCATGAGTTTTCCAGGAAAGG - Intergenic
982651690 4:158095143-158095165 ATTCATGAGTTTTCTAAGAAAGG - Intergenic
982673682 4:158351146-158351168 ATTCAGAAGTTTTCCAGGAAAGG + Intronic
983022440 4:162694734-162694756 ATTCAACAGTTTTGAAATTACGG - Intergenic
983047298 4:163003154-163003176 ATTCACCAATGTTGAAATAAAGG - Intergenic
983771466 4:171555023-171555045 ATTCATGAGTTTTCAGGGAAAGG + Intergenic
983803284 4:171962613-171962635 ATTCATGAGTTTTCCAGGAAAGG - Intronic
984250064 4:177320828-177320850 ATTCTCCAGTTCTTAAACAAAGG + Intronic
984807520 4:183765392-183765414 CTTCAGCACATTTCAAAGAATGG - Intergenic
985077827 4:186235063-186235085 TTTAACCAGTTATCAAAGGATGG + Intronic
985341336 4:188957635-188957657 AATCACCAGATTGCAATGAAGGG + Intergenic
1202769700 4_GL000008v2_random:192156-192178 ATTCACCTCTCATCAAAGAAAGG + Intergenic
986782390 5:11078699-11078721 TTTCTCCATTTTTCAGAGAAGGG + Intronic
988069957 5:26275288-26275310 ATCCACCTATTTTCAAAGCAGGG + Intergenic
988243345 5:28643118-28643140 AATGACCAATTTTCAAAGAAGGG + Intergenic
988831345 5:34990285-34990307 ATTCATGAGTTTTCAGGGAAAGG - Intergenic
989339378 5:40355983-40356005 ATTCATGAGTTTTCAGGGAAAGG + Intergenic
989445884 5:41527734-41527756 ATTCATGAGTTTTCTCAGAAAGG - Intergenic
989641915 5:43590829-43590851 ATTCACAAATTTTCTATGAAAGG - Intergenic
989832774 5:45941104-45941126 ATTCAGCAGTTTTTAAACACTGG + Intergenic
990691565 5:58370021-58370043 ATTCATGAGTTTTCCAGGAAAGG - Intergenic
991285246 5:64967056-64967078 AATAAGCAGTTTTCATAGAATGG - Intronic
991528815 5:67593173-67593195 ATTCTACAGTTTTCAAAAGAGGG - Intergenic
993516656 5:88844561-88844583 TTTTCCCAGTTTTCAAAGAGTGG - Intronic
993889081 5:93451292-93451314 ATTCACCAGGTTTTAGAGTAGGG + Intergenic
994193388 5:96894264-96894286 ATTCACCGGTTTTCAAATTGAGG + Intronic
994694533 5:103057672-103057694 ATTCATGAGTTTTCCAGGAAAGG - Intergenic
994890786 5:105632567-105632589 ATTCACCTGTTTTCTAACACAGG + Intergenic
995409377 5:111837532-111837554 AATTACCACTTTTCAAAGTAAGG - Intronic
995586401 5:113653186-113653208 ATTCATGAGTGTTCCAAGAAAGG + Intergenic
995812673 5:116125489-116125511 ATTCACCAGAGTTGAAACAAAGG - Intronic
996689975 5:126329999-126330021 ATTCACCAGTTTTCTAACTGTGG + Intergenic
996827672 5:127703654-127703676 AGACAGCAGCTTTCAAAGAAAGG - Intergenic
997033356 5:130157835-130157857 ATTCATGAGTTTTCCAAGAAAGG + Intronic
997073514 5:130644778-130644800 TTCCACAAGTTTTCAAAGGAAGG - Intergenic
997320279 5:132972377-132972399 ATTCATGAGTTTTCCAGGAAAGG - Intergenic
998982979 5:147725244-147725266 ATTCATGAGTTTTCCAGGAAAGG - Intronic
1001070569 5:168581319-168581341 ATTCACGAGTTTTCCAGGAAAGG - Intergenic
1001293406 5:170482297-170482319 TTTCCCCAGGGTTCAAAGAAGGG + Intronic
1001530589 5:172458729-172458751 ATTCACGAGTTTTCTAAGAAAGG - Intergenic
1002708081 5:181176395-181176417 ATTCATCAGTTTTCCAGGAAAGG + Intergenic
1002833073 6:841801-841823 ATTCATGAGTTTTCCAGGAAAGG - Intergenic
1003372439 6:5541867-5541889 ATTCATGAGTTTTCCAGGAAAGG + Intronic
1003683049 6:8274703-8274725 GTTTACCAGTTTTCCAACAATGG - Intergenic
1003733292 6:8850197-8850219 ATTCAACATTTGTCAAAGAAGGG + Intergenic
1003839251 6:10103330-10103352 TTTCAGCAGTTTCAAAAGAAAGG + Intronic
1004063759 6:12223123-12223145 CTTCCCCAATTTTCAAAGAGAGG + Intergenic
1004071995 6:12307870-12307892 TTTCCCCTGTTTTCAAAGAGTGG + Intergenic
1004113243 6:12742237-12742259 ATTCATGAGTTTTCCAGGAAAGG + Intronic
1004243606 6:13951616-13951638 TTTAACCAGTTTTCACAGACAGG + Intronic
1004257387 6:14077717-14077739 ATTCATCAGTTTTCTGGGAAAGG - Intergenic
1004432887 6:15562047-15562069 ATTCATGAGTTTTCCAGGAAAGG - Intronic
1005331643 6:24756407-24756429 ATTCATGAGTTTTCTAGGAAAGG + Intergenic
1005515822 6:26553278-26553300 ATCCATCAGTTTTCAAAGTGTGG - Intergenic
1006345310 6:33476449-33476471 AATTACCAATTTTCAAAGTAAGG - Intergenic
1006999665 6:38298156-38298178 CTGCTCCAGTTTTCTAAGAATGG + Intronic
1007340642 6:41189179-41189201 ATTCATGAGTTTTCCAGGAAAGG + Intergenic
1007533327 6:42562750-42562772 ATTAACCAGTTTTTTAAAAAAGG - Intergenic
1007802630 6:44409886-44409908 ATTCAGTAGCTTTCAGAGAAAGG + Intronic
1008736384 6:54549565-54549587 ATAAACCAATGTTCAAAGAATGG - Intergenic
1009387128 6:63098999-63099021 ATTCACGAGTTTTCTGGGAAAGG - Intergenic
1009413721 6:63394520-63394542 ATTCATGAGTTTTCCAGGAAAGG - Intergenic
1009489295 6:64267944-64267966 ATTAACCAAATTTCAAAAAAAGG - Intronic
1009916555 6:70004170-70004192 ATTCAACATTCTTAAAAGAAAGG - Intronic
1010234620 6:73564990-73565012 ATTCATGAGTTTTCCAGGAAAGG - Intergenic
1010293824 6:74172188-74172210 TTTCAGCAGTTTTCTGAGAAAGG + Intergenic
1010627322 6:78154228-78154250 ATTCATGAGTTTTCCAAGAAAGG - Intergenic
1010943160 6:81943556-81943578 ATTCATTATTTTTCAAAGAAAGG + Intergenic
1010980921 6:82368081-82368103 ATTCAGAAATTTTCAAAGTAGGG + Exonic
1011121536 6:83959010-83959032 ATTCACCAGTTTTCAAAGAAAGG - Intronic
1011897803 6:92253603-92253625 ATTCAACAATTTTTAGAGAATGG - Intergenic
1011928953 6:92685697-92685719 ATTCATAAGTCTTCAAAGGAAGG + Intergenic
1013666921 6:112358767-112358789 ATTCATGAGTTTTCCAGGAAAGG + Intergenic
1014028926 6:116679548-116679570 ATTCATGAGTTTTCAAGGAAGGG - Intergenic
1014621210 6:123669091-123669113 ATTCATGAGTTTTCCAGGAAAGG + Intergenic
1014654165 6:124078707-124078729 TTTCACCAGTTTTGAAAATAGGG + Intronic
1015044473 6:128761138-128761160 ATTCACGAGTTTTCCAGGAAAGG - Intergenic
1015338064 6:132064381-132064403 ATTAACAAGTTTTCAAGCAAAGG - Intergenic
1016509827 6:144829303-144829325 AGTTAACAGTTTTCAATGAAGGG - Intronic
1016686403 6:146887277-146887299 ATTCATAAGTTTTCCAGGAAAGG + Intergenic
1017177645 6:151519710-151519732 ATTCATGAGTTTTCTAGGAAAGG + Intronic
1018124818 6:160671459-160671481 CTGCACCAGTTTTCCAACAAGGG + Intergenic
1018701735 6:166432660-166432682 TTACACTAGTTGTCAAAGAAAGG - Intronic
1019326634 7:441657-441679 ATTGGCCAATTTTTAAAGAAAGG + Intergenic
1019816068 7:3201842-3201864 AATCACTAGTTGTCAAGGAAGGG - Intergenic
1019913263 7:4114465-4114487 CATCACCAGTTTCCAATGAATGG - Intronic
1020008512 7:4795167-4795189 ATTCATGAGTTTTCTAGGAAAGG - Intergenic
1020402583 7:7795638-7795660 ATTCATGAGTTTTTAAGGAAAGG + Intronic
1020531868 7:9348389-9348411 ATTGACCAGCTTTCAAATGAAGG + Intergenic
1020576596 7:9939330-9939352 ATTCATGAGTTTTCCAGGAAAGG + Intergenic
1020746423 7:12084497-12084519 TTTCACCACTTTTCACATAACGG + Intergenic
1020963656 7:14838489-14838511 TTCCTCCAGTTTTAAAAGAAGGG - Intronic
1021779650 7:24090361-24090383 TTTCACAAGTTTTTAAAGAAAGG - Intergenic
1023147176 7:37163078-37163100 ATTCTACACATTTCAAAGAAAGG + Intronic
1023555351 7:41416565-41416587 ATTGACTATTTTTCAAACAAGGG + Intergenic
1023587513 7:41746000-41746022 ATTCAGGAGTTTTCTGAGAAAGG + Intergenic
1024322699 7:48086646-48086668 ATTCCTGAGTTTTCCAAGAAAGG + Intergenic
1024601473 7:50985375-50985397 ATTCATGAGTTTTCCAAGAAAGG - Intergenic
1025223264 7:57134472-57134494 ATTCATGAGTTTTACAAGAAAGG - Intronic
1025264831 7:57448051-57448073 ATTCATGAGTTTTACAAGAAAGG + Intergenic
1025505133 7:61416363-61416385 ATACTCCCGTTTCCAAAGAAAGG - Intergenic
1025505966 7:61430201-61430223 ATACTCCCGTTTCCAAAGAAAGG - Intergenic
1025510480 7:61506784-61506806 ATACTCCCGTTTCCAAAGAAAGG - Intergenic
1025529349 7:61858509-61858531 ATTCAGCAGTTTTGAAACACTGG - Intergenic
1025530247 7:61871293-61871315 ATTCAGCAGTTTTGAAATACTGG - Intergenic
1025576723 7:62653509-62653531 ATTGAGCAGTTTTGAAACAATGG - Intergenic
1025719456 7:63996783-63996805 ATTCATGAGTTTTACAAGAAAGG + Intergenic
1026274370 7:68863845-68863867 CTTCATAAGTTTTCCAAGAAAGG + Intergenic
1026301927 7:69105575-69105597 ATTCATGAGTTTTCCAGGAAAGG - Intergenic
1026302033 7:69106524-69106546 ATTCATGAGTTTTCCAGGAAAGG + Intergenic
1026493093 7:70880134-70880156 ATTCATGAGTTTTCCAGGAAAGG - Intergenic
1026583615 7:71638023-71638045 ATTCATGAGTTTTCCAGGAAAGG + Intronic
1026625729 7:71990336-71990358 ATTCATGAGTTTTCCAGGAAAGG - Intronic
1026849236 7:73714726-73714748 ATTCAGCAGTTCTCAAAGCTGGG + Intronic
1026918050 7:74134479-74134501 ATTCATGAGTTTTCCAGGAAAGG - Intergenic
1026921701 7:74160425-74160447 ATTCATGAGTTTTCCAGGAATGG - Intergenic
1028730119 7:94137441-94137463 ATTCACCTGTCTCCATAGAAAGG - Intergenic
1028847464 7:95497956-95497978 TTTTGTCAGTTTTCAAAGAAAGG + Intronic
1030156504 7:106460779-106460801 ATTCATGAGTTTTCCAGGAAAGG + Intergenic
1030352727 7:108507754-108507776 AGTTACCGGTTTTCAAAGTAAGG - Intronic
1030629240 7:111877636-111877658 AATTGCCAGTTTTCAAAGTAAGG - Intronic
1030763536 7:113380562-113380584 ATAAAGCAGATTTCAAAGAATGG - Intergenic
1030923625 7:115423366-115423388 ATGAGCTAGTTTTCAAAGAAGGG + Intergenic
1030974594 7:116105797-116105819 AGTCACCACTTTACAAAAAAAGG + Intronic
1031625934 7:123992749-123992771 ATTCATGAGTTTTCCAAGAAAGG + Intergenic
1032097851 7:128948355-128948377 ATTCCCCAGTTTTCAAGCCAAGG - Intronic
1032340937 7:131072250-131072272 ATTCATGAGTTTTCCAGGAAAGG - Intergenic
1032500501 7:132396217-132396239 ACTCCCCAATTTTCAAAGCATGG - Intronic
1033838639 7:145346798-145346820 ATTCACCAGCATTCCATGAAGGG - Intergenic
1035587502 8:787192-787214 ATACAGCAGTCTTCAAAGGAAGG - Intergenic
1037024556 8:14018000-14018022 TTTCATCAGATTTCAAAGAGAGG - Intergenic
1037233711 8:16691149-16691171 ATTCATGAGTTTTCCAGGAATGG - Intergenic
1037547462 8:19938940-19938962 AATCACCTGTTTTCCAAGGAGGG - Intronic
1038489708 8:27961564-27961586 TTTCCCCCGTTTTCAGAGAAGGG + Intronic
1038675323 8:29617617-29617639 ATTCACGAGTTTTCTGGGAAAGG - Intergenic
1038825454 8:30994727-30994749 ATTTACCAGTTTTCATAAAATGG + Intergenic
1039287491 8:36058267-36058289 ATTCATCAGTTTTCTGGGAAGGG + Intergenic
1039641968 8:39233290-39233312 ATTCATGAGTTTTCCAGGAAAGG + Intronic
1040596504 8:48842637-48842659 TTTCACCTGTGTTTAAAGAAGGG - Intergenic
1040613302 8:49008694-49008716 ATTCATGAGTTTTCCAGGAAAGG + Intergenic
1040684567 8:49856496-49856518 ATTCAACAGTTGTCAAGGGATGG - Intergenic
1041229191 8:55731798-55731820 ATTCATGAGTTTTCACAGAAAGG + Intronic
1041353167 8:56969904-56969926 ATTTACCAATTTTCAGAGTAAGG - Intronic
1041360515 8:57048275-57048297 GTTCATCATTTTTCAAAGAATGG + Intergenic
1041405610 8:57496087-57496109 ATTTAACAGTTTTCAGAGAGCGG + Intergenic
1041406547 8:57505695-57505717 ATGCACTATTTTTCAAAGAAAGG + Intergenic
1041870084 8:62623951-62623973 ATTCATGAGTTTTCCAGGAAAGG + Intronic
1042309597 8:67367046-67367068 ATTCATCAGTTTTCTGGGAAAGG - Intergenic
1043023790 8:75041146-75041168 ATTCATGAGTTTTCCAAGAAAGG + Intergenic
1043287694 8:78554683-78554705 TTTCACCAGCTTTCTAAGAAAGG + Intronic
1044232657 8:89797259-89797281 ATTCATGAGTTTTCCAGGAAAGG - Intergenic
1044986795 8:97763031-97763053 ATTCATGAGTTTTCCAGGAAAGG - Intergenic
1044991733 8:97802303-97802325 ATTCATGAGTTTTCCAGGAAAGG + Intronic
1045624610 8:104029000-104029022 ATTCATGAATTTTCCAAGAAAGG + Intronic
1046020608 8:108660192-108660214 ATTCACCAGTCATCAAAGACTGG + Intronic
1046330925 8:112713766-112713788 ATTCAACATTCTTAAAAGAAAGG + Intronic
1048085995 8:131180139-131180161 ATTCAACAGTTTCCAGAGCAAGG - Intergenic
1048673967 8:136755942-136755964 ATTCTCCATTTTTCAAAGTTTGG + Intergenic
1049839511 8:144762142-144762164 ATTCACAAGTTTTCTACAAAAGG + Intergenic
1050141974 9:2525379-2525401 ATTCATGAGTTTTCCAAGAAAGG - Intergenic
1050702852 9:8360380-8360402 ATTCACCAGTTTTTAAAATTTGG - Intronic
1050740148 9:8810667-8810689 ATTCTCCAGTTTTTAAATATTGG + Intronic
1050809248 9:9722795-9722817 AATCACTAGTTAACAAAGAAAGG - Intronic
1050932421 9:11347530-11347552 ATTCATGAGTTTTCTAGGAAAGG + Intergenic
1051583816 9:18706131-18706153 ATTCATGAGTTTTCCAGGAAAGG + Intronic
1051720656 9:20033771-20033793 ATTCATGAGTTTTCTAGGAAAGG - Intergenic
1051805289 9:20985923-20985945 ATTCAGTGGTTTTCAAAGTATGG - Intronic
1052714259 9:32096524-32096546 AATTACAAATTTTCAAAGAATGG - Intergenic
1052730233 9:32276687-32276709 CTGCACCATTTTTCAAGGAAAGG - Intergenic
1052742620 9:32408108-32408130 TTTGACCAGATTTCAAGGAATGG - Intronic
1053562935 9:39214908-39214930 ATTCATGAGTGTTCCAAGAAAGG + Intronic
1053828729 9:42052854-42052876 ATTCATGAGTGTTCCAAGAAAGG + Intronic
1054134212 9:61404147-61404169 ATTCATGAGTGTTCCAAGAAAGG - Intergenic
1054601830 9:67134600-67134622 ATTCATGAGTGTTCCAAGAAAGG - Intergenic
1054796499 9:69307155-69307177 ATTCACGAGTTTTCCAGGAAAGG + Intergenic
1054832321 9:69639683-69639705 ATTTACCAGTTTTCAAAATAAGG - Intronic
1055121877 9:72669600-72669622 AATCACCAATTTTAAGAGAAGGG - Intronic
1055200753 9:73657863-73657885 ATTCAGGAATTTTCAGAGAAAGG + Intergenic
1055511614 9:77000781-77000803 ATTAACCACTTTTAGAAGAAGGG + Intergenic
1055907686 9:81313118-81313140 ATTCAAAAGTTTTCAAATATGGG - Intergenic
1056046785 9:82726633-82726655 ATTCATGAGTTTTCCAGGAAAGG + Intergenic
1056150565 9:83783095-83783117 ATTCTCTGATTTTCAAAGAAAGG + Intronic
1056507741 9:87273402-87273424 ATTAACCAGTCTTAAAAGGAAGG + Intergenic
1057142593 9:92736487-92736509 ATTCACAAGTTTTCTGGGAAAGG - Intronic
1057780918 9:98049461-98049483 ATTCATGAGTTTTCCAGGAAAGG + Intergenic
1057888712 9:98851790-98851812 ATTCATGAGTTTTCTGAGAAAGG + Intergenic
1057943143 9:99302301-99302323 ATTCATGAGTTTTCCAGGAAAGG - Intergenic
1057965045 9:99494702-99494724 CTTCACCAGTGATTAAAGAAGGG - Intergenic
1058756252 9:108085485-108085507 ATTCATGAGTTTTCCAGGAAAGG - Intergenic
1058993139 9:110273906-110273928 ATTTACCAGTTGTCATGGAATGG - Intergenic
1059214282 9:112546354-112546376 ATTCATAAGTTTTCTAGGAAAGG - Intronic
1059372476 9:113853841-113853863 AATGATCAGTTTTCAATGAAAGG + Intergenic
1059477215 9:114557211-114557233 ATTCATGAGTTTTCCAGGAAAGG + Intergenic
1060499379 9:124141443-124141465 ATTCATGAGTTTTCCAGGAAAGG - Intergenic
1062130536 9:134890349-134890371 TTTCATGAGTTTTCCAAGAAAGG - Intergenic
1062222021 9:135421566-135421588 ATTCATGAGTTTTCCAGGAAAGG - Intergenic
1203694602 Un_GL000214v1:85879-85901 ATTCACCTCTCATCAAAGAAAGG + Intergenic
1203704948 Un_KI270742v1:31553-31575 ATTCACCTCTCATCAAAGAAAGG - Intergenic
1203559056 Un_KI270744v1:34258-34280 ATTCACCTCTCATCAAAGAAAGG + Intergenic
1203641671 Un_KI270751v1:18184-18206 ATTCACCTCTCATCAAAGAAAGG - Intergenic
1185880010 X:3732474-3732496 ATTCATGAGTTTTCCAGGAAAGG + Intergenic
1185929059 X:4181876-4181898 ATTCATGAGTTTTCCAGGAAAGG + Intergenic
1185955528 X:4484750-4484772 ATTCATGAGTTTTCCAGGAAAGG - Intergenic
1186152230 X:6687676-6687698 ATTCATGAGTTTTCCAGGAAAGG + Intergenic
1186229011 X:7432614-7432636 ATATACCACTTTGCAAAGAAAGG + Intergenic
1186602847 X:11056875-11056897 ATTCATGAGTTTTCCAGGAAAGG + Intergenic
1186900096 X:14045288-14045310 ATTTACCAGTTGTCATAGATTGG + Intergenic
1187070474 X:15882650-15882672 ATTCATGAGTTTTCCAGGAAAGG + Intergenic
1187105556 X:16237920-16237942 AATCACCAGGTTTCAAATAAAGG + Intergenic
1187179677 X:16932056-16932078 ATTCATAAGTTTTCCAAGAAAGG - Intergenic
1187499732 X:19829868-19829890 ATTCATGAGCTTTCCAAGAAAGG + Intronic
1188126546 X:26375247-26375269 ATTCATGAGTTTTCCAGGAATGG + Intergenic
1188388631 X:29592404-29592426 ATTCACCAGTGTCCACAGAGAGG + Intronic
1189140694 X:38602587-38602609 TTTAACCAGTAGTCAAAGAAAGG + Intronic
1189767373 X:44385476-44385498 ATTCATGAGTTTTCCCAGAAAGG - Intergenic
1190244276 X:48680713-48680735 ATTCATGAGTTTTCCAGGAAAGG - Intronic
1190246297 X:48692758-48692780 ATTCACCAGATTTCAGAAATCGG - Intergenic
1190953426 X:55168853-55168875 ACTCACAAGTTCTCAAAGAATGG - Intronic
1191617018 X:63180704-63180726 ATTCATGAGTTTTCCAGGAAAGG - Intergenic
1191619279 X:63198219-63198241 ATTCATGAGTTTTCCAGGAAAGG + Intergenic
1191636860 X:63387901-63387923 ATTCATGAGTTATCCAAGAAAGG - Intergenic
1191870924 X:65744210-65744232 ATTCATGAGTTTTCTAGGAAAGG + Intergenic
1192831743 X:74757399-74757421 ATTCATCAGTGATCCAAGAAAGG + Intronic
1193374277 X:80739873-80739895 ATTCACCTATTTTCAAACCATGG + Intronic
1193393154 X:80953596-80953618 AAGCAGAAGTTTTCAAAGAAAGG - Intergenic
1193886547 X:86988985-86989007 ATTCACAAGTTTTCCAGGAAAGG - Intergenic
1194155474 X:90382585-90382607 ATTCACCATTTTGGGAAGAATGG - Intergenic
1194301683 X:92195042-92195064 ATACATCAGGTTTTAAAGAAGGG - Intronic
1194320047 X:92434969-92434991 CTGCACCAGTTCTCTAAGAAGGG + Intronic
1194896485 X:99447744-99447766 ATTCATGAGTTTTCAGGGAAAGG - Intergenic
1195386693 X:104320310-104320332 ATACAACAGTTGTCAAAAAAAGG + Intergenic
1195481437 X:105350296-105350318 ATTCACCAGTTGCCAAACTATGG + Intronic
1195594180 X:106669026-106669048 AGTCTCCAGTTTTCAAACACAGG + Intronic
1197396130 X:125929650-125929672 ATTCAGTAGTTTTCAAACTATGG - Intergenic
1197620816 X:128745568-128745590 TTTCAGCAGTTTTCAAAGTGTGG + Intergenic
1199402631 X:147416985-147417007 ACTCATGAGTTTTGAAAGAAAGG - Intergenic
1199564786 X:149204154-149204176 ATTCACCAGTTTAGCAAGTAGGG - Intergenic
1200501822 Y:3959519-3959541 ATTCACCATTTTGGGAAGAATGG - Intergenic
1201605002 Y:15774479-15774501 ATTCATGAGTTTTCCAGGAAAGG + Intergenic
1201920401 Y:19227852-19227874 ATTCATGAGTTTTCCAGGAAAGG + Intergenic
1202341213 Y:23870939-23870961 ATTTACCATTTTTCTAAGTAGGG + Intergenic
1202529553 Y:25799147-25799169 ATTTACCATTTTTCTAAGTAGGG - Intergenic