ID: 1011124015

View in Genome Browser
Species Human (GRCh38)
Location 6:83986995-83987017
Sequence CCAGGTGAGATGAGGGCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011124015_1011124023 12 Left 1011124015 6:83986995-83987017 CCATCTGCCCTCATCTCACCTGG No data
Right 1011124023 6:83987030-83987052 GTCTCAAATGACTGATGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011124015 Original CRISPR CCAGGTGAGATGAGGGCAGA TGG (reversed) Intergenic
No off target data available for this crispr