ID: 1011125891

View in Genome Browser
Species Human (GRCh38)
Location 6:84007223-84007245
Sequence ATGTGGAAGTCACTGTGATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 0, 2: 0, 3: 49, 4: 287}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011125885_1011125891 25 Left 1011125885 6:84007175-84007197 CCAAGCCTTCGTAAAGAGGTCCT 0: 1
1: 0
2: 0
3: 4
4: 60
Right 1011125891 6:84007223-84007245 ATGTGGAAGTCACTGTGATGTGG 0: 1
1: 0
2: 0
3: 49
4: 287
1011125887_1011125891 5 Left 1011125887 6:84007195-84007217 CCTATTCCTATGTATTTTATGAT 0: 1
1: 0
2: 7
3: 40
4: 474
Right 1011125891 6:84007223-84007245 ATGTGGAAGTCACTGTGATGTGG 0: 1
1: 0
2: 0
3: 49
4: 287
1011125889_1011125891 -1 Left 1011125889 6:84007201-84007223 CCTATGTATTTTATGATTGGAGA 0: 1
1: 0
2: 1
3: 18
4: 296
Right 1011125891 6:84007223-84007245 ATGTGGAAGTCACTGTGATGTGG 0: 1
1: 0
2: 0
3: 49
4: 287
1011125886_1011125891 20 Left 1011125886 6:84007180-84007202 CCTTCGTAAAGAGGTCCTATTCC 0: 1
1: 0
2: 0
3: 4
4: 31
Right 1011125891 6:84007223-84007245 ATGTGGAAGTCACTGTGATGTGG 0: 1
1: 0
2: 0
3: 49
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011125891 Original CRISPR ATGTGGAAGTCACTGTGATG TGG Intergenic
900496667 1:2978893-2978915 AGGGGGAAGTCACTGGGCTGGGG + Intergenic
901336119 1:8450748-8450770 AAGTGGTTGACACTGTGATGGGG - Intronic
901769815 1:11524568-11524590 AGGTGGTAGTCACTGGGATGGGG - Intronic
901769856 1:11524678-11524700 AGGTGGTAGTCACTGGGATGGGG - Intronic
902061065 1:13643384-13643406 GTGTGGTAGTCACTGTGTGGTGG - Intergenic
902396786 1:16136252-16136274 ATGTGCCAGCCCCTGTGATGGGG - Intronic
903853382 1:26321320-26321342 ACGTGGAGGTTAGTGTGATGGGG - Intergenic
903885554 1:26539067-26539089 ATGTGGTAGGCGCTATGATGGGG + Intronic
904982056 1:34513458-34513480 ATGTGTATGTCACTGTCAAGAGG - Intergenic
905131040 1:35757807-35757829 ATGTGAAAGTCACTTTGACCAGG - Intronic
905456420 1:38091269-38091291 ATGTGGTAGATGCTGTGATGTGG + Intergenic
907037770 1:51231450-51231472 CTATGGAAAGCACTGTGATGTGG + Intergenic
908457790 1:64321116-64321138 ATGTGGGAGTCGCTGTGGTGAGG - Intergenic
910375884 1:86569853-86569875 ATGTGCCAGTCACCGTGCTGGGG - Intronic
910433374 1:87180359-87180381 TTGTGAAAGTCACTGTTTTGGGG + Intergenic
912504308 1:110145390-110145412 GTATGTAAGTCACTGTGCTGGGG + Intergenic
912586647 1:110772560-110772582 AGGAGGAAGACAGTGTGATGGGG - Intergenic
912962613 1:114209411-114209433 AGGTGCCAGTCACTGTGCTGAGG - Intergenic
916743202 1:167663862-167663884 ATGTGCCAGGCACTGTGCTGGGG + Intronic
920564121 1:206960296-206960318 ATGTGTATGTCACTGTCTTGTGG + Intronic
920744046 1:208608765-208608787 ATGTTGCAGTCTCTGTGCTGGGG + Intergenic
922889985 1:229054495-229054517 ATGTGAAAGTAAATTTGATGTGG + Intergenic
923912479 1:238463905-238463927 ATGTTGAGGTCACTATGATGGGG - Intergenic
924162633 1:241249077-241249099 CTGTGGAAGACCCTGTGAAGAGG - Intronic
1063931729 10:11035363-11035385 ATGTGGAGGACCCTGAGATGAGG + Intronic
1064141984 10:12798322-12798344 ATGTGTCAGGCAGTGTGATGGGG + Intronic
1065261102 10:23924200-23924222 ATGTGCAAGCCACTGTGTTTGGG + Intronic
1065863887 10:29896447-29896469 ATGTGCTAGGCACTGTGTTGAGG + Intergenic
1066302039 10:34105808-34105830 AAGTGAAATTCCCTGTGATGGGG + Intergenic
1066584420 10:36916756-36916778 ATGTGCAAGACACTGTGCTAGGG + Intergenic
1070299739 10:75194551-75194573 ATGTGTCAGACACTGTGCTGGGG - Intergenic
1072478321 10:95785027-95785049 GAGTGGAAATCACTTTGATGAGG + Intronic
1073385047 10:103119460-103119482 ATCTGGAAGCCAGTGGGATGAGG + Intronic
1074637156 10:115332932-115332954 ATGTGGAAGTTGCTGTGTTCAGG - Intronic
1077187879 11:1243555-1243577 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188300 11:1245226-1245248 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188835 11:1247326-1247348 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077189254 11:1248997-1249019 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1078025786 11:7694345-7694367 AGGTGGAAGTCACTGTATGGAGG - Intronic
1078521534 11:12067821-12067843 AGGTGAAAATCAGTGTGATGAGG - Intergenic
1081411668 11:42765879-42765901 ATGTGCATGTACCTGTGATGTGG + Intergenic
1081871199 11:46383300-46383322 ATGGGGCAGCCATTGTGATGTGG - Intronic
1083174414 11:60940509-60940531 TTGTGGAACTCAGTCTGATGGGG - Intronic
1089069227 11:115686631-115686653 CTGTGGAAGACACAATGATGTGG + Intergenic
1089376388 11:117998071-117998093 GTGTGGAACTCACAGTGAAGGGG - Intronic
1089787320 11:120917367-120917389 ATGTGCCAGTCACTGTGCTGGGG + Intronic
1090992742 11:131834428-131834450 ATGTGGTAGGCACTGTGCTGGGG + Intronic
1092481795 12:8865844-8865866 ATGTCCAAATCACTTTGATGAGG + Intronic
1092804638 12:12208614-12208636 ATGTGCCAGTCATTGTGATGTGG - Intronic
1093928827 12:24934875-24934897 ATGTGGAAAAAACTGAGATGTGG - Intronic
1094293230 12:28875183-28875205 TTGTTGAAGTAATTGTGATGGGG - Intergenic
1097427537 12:59465870-59465892 ATGTGAAATTCACTATTATGTGG + Intergenic
1097636639 12:62130625-62130647 ATGTGGCAGGCACTGTGCTAGGG + Intronic
1097852932 12:64431392-64431414 AGATGGAAGTAATTGTGATGTGG + Intronic
1098300396 12:69048232-69048254 ATCAGGAAGTCACTATGATCTGG - Intergenic
1099845175 12:88019557-88019579 ATTTGGGAGTCACTGACATGTGG + Intronic
1102770490 12:115471896-115471918 ATGTGGAAGTCTTTGGGGTGGGG - Intergenic
1102853749 12:116276794-116276816 ATGTGGAAGTCTCGGAGCTGCGG - Intronic
1103097806 12:118146072-118146094 AGGTGCAAATCACTGTGATTTGG + Intergenic
1107065117 13:36205017-36205039 CTTTGGAGGTCACTGTGAAGGGG + Intronic
1108277023 13:48821272-48821294 ATGTGAAAGTCACTGTACCGTGG + Intergenic
1108557812 13:51612957-51612979 ATGTGAAAGACACTTTGGTGGGG + Intronic
1109683248 13:65781235-65781257 ATGTGCAAGGCACTGTAAAGAGG - Intergenic
1110894180 13:80728613-80728635 ATGTGTTTGTCAGTGTGATGGGG + Intergenic
1111341456 13:86891548-86891570 ATGTGGTAGGCACTGTTCTGAGG - Intergenic
1112690147 13:101884161-101884183 ATGTGAAAGCCTCTGTGATCTGG + Intronic
1113916308 13:113876033-113876055 GTGTGGGTGTCACTGTGGTGTGG + Intergenic
1113916376 13:113876390-113876412 GTGTGGGTGTCCCTGTGATGTGG + Intergenic
1113916381 13:113876407-113876429 ATGTGGGTGTCACTGTGGTGTGG + Intergenic
1113916389 13:113876458-113876480 ATGTGGGTGTCCCTGTGGTGTGG + Intergenic
1113916426 13:113876628-113876650 GTGTGGGTGTCACTGTGGTGTGG + Intergenic
1113916434 13:113876662-113876684 GTGTGGGTGTCACTGTGGTGTGG + Intergenic
1114613090 14:24054765-24054787 ATGTGGAAGTCTCAGAGTTGGGG - Exonic
1115968993 14:38924368-38924390 ATGTTGGAGTAAGTGTGATGAGG - Intergenic
1116375182 14:44190472-44190494 ATGTGGAACACACTTTGATTAGG - Intergenic
1119655344 14:76413401-76413423 ATGTGCAAGTCACAGAGATAGGG - Intronic
1123031907 14:105455943-105455965 GTGGGGAAGTCACTGTGCTGAGG + Intronic
1123046052 14:105515575-105515597 ATGTAAAAGTCACTGTTAAGAGG - Intergenic
1123977056 15:25563587-25563609 GTGTGGAGGGCACTGTGATGTGG + Intergenic
1123979172 15:25583549-25583571 ATATGGAAGTCCCATTGATGCGG - Intergenic
1126743211 15:51799148-51799170 ATGGGGAAGGGTCTGTGATGGGG + Intronic
1128219824 15:65961128-65961150 CTGTGCAAGTCACTCTGCTGAGG - Intronic
1128798987 15:70485219-70485241 TTGTGTAAGTCACTGAAATGTGG - Intergenic
1129128209 15:73464567-73464589 ATGCAGAAGTCACAGTGCTGTGG + Intronic
1129614721 15:77089302-77089324 ATGGGGAGGTCACTGCGATGGGG - Intergenic
1131136114 15:89936996-89937018 ATGACGAAGTCACTGCGAAGTGG - Intergenic
1131422433 15:92318524-92318546 ATGAGGAACTCACTTTGAGGTGG + Intergenic
1131889157 15:96953275-96953297 ATGTGCAAGTCACTGAGCTAAGG + Intergenic
1132059831 15:98682980-98683002 ATGGGGAGGTCACTGATATGAGG - Intronic
1135924326 16:26679318-26679340 ATGACGAAGTCACTGAGGTGTGG + Intergenic
1137308412 16:47229075-47229097 ATGTGTCAGGCACTGTGCTGGGG + Intronic
1137581295 16:49635040-49635062 ATGTGGAAGGCCCTTTGATGTGG - Intronic
1138839529 16:60483115-60483137 ATGCAGAAGTCACTCTGCTGAGG - Intergenic
1139070794 16:63379977-63379999 ATAAGGAAGTGACTGAGATGTGG - Intergenic
1141356470 16:83351129-83351151 TTGTTGCAGTAACTGTGATGTGG + Intronic
1141466175 16:84207154-84207176 ATGTGGATGTCAGGGTGAGGTGG + Intergenic
1141925011 16:87162357-87162379 AGGTGGAAGTCTCTGCAATGGGG - Intronic
1142962546 17:3559623-3559645 GGGAGGAAGTCCCTGTGATGGGG + Intergenic
1143395209 17:6589151-6589173 ATGTGGTAGTATCTGTGGTGGGG + Intronic
1144320929 17:14118613-14118635 ATGTAGAAATCAATGTGAAGAGG + Intronic
1144771322 17:17761190-17761212 ATGTGCCAGTCCCTGTGCTGAGG - Intronic
1148954583 17:51343229-51343251 ATGCGGAATTCACTGTGACCAGG + Intergenic
1149565183 17:57636185-57636207 ATGTGGAAATCAGAGTGAAGGGG + Intronic
1149785523 17:59431480-59431502 ATGTGGAAGGCACTGTGCTCAGG - Intergenic
1150716140 17:67574094-67574116 ATGTGCCAGTCACTGTGCTGGGG + Intronic
1154018253 18:10638846-10638868 TTCTGGGAGTCACTGTGATGAGG - Intergenic
1154179792 18:12124761-12124783 CCATGGAAGTAACTGTGATGTGG + Intronic
1154186619 18:12190736-12190758 TTCTGGGAGTCACTGTGATGAGG + Intergenic
1155179603 18:23332536-23332558 ATGTGGTATTAACTCTGATGTGG - Intronic
1157098566 18:44709532-44709554 TTGTTGATGTCACTGTGGTGAGG + Intronic
1157883826 18:51347197-51347219 ATGTGTAATCCACAGTGATGGGG + Intergenic
1158750820 18:60258059-60258081 ATGTGCAAGACACTGAGATTTGG - Intergenic
1160060622 18:75526033-75526055 ATGTGTCAGGCACTGTGCTGGGG + Intergenic
1161156601 19:2735057-2735079 ATGAGAAGGCCACTGTGATGAGG + Intronic
1161445750 19:4318309-4318331 ACGTGGGAGTCACAGAGATGGGG - Intronic
1161446002 19:4319535-4319557 ATGAGGAAGTCATTGTGGTCAGG + Intronic
1161744794 19:6049487-6049509 ATGTGTAAATGCCTGTGATGTGG - Intronic
1164700499 19:30280986-30281008 CTGTGGAATTCACAGGGATGGGG + Intronic
1164714446 19:30381266-30381288 ATGTGCCAGGCACTGTGCTGGGG + Intronic
1165561105 19:36680787-36680809 AGGTGGAAATCTCAGTGATGGGG - Intergenic
1165712648 19:38023172-38023194 ATGAGGATTTCACTGTGCTGGGG - Intronic
1168231976 19:55038394-55038416 GTGTGCAAGTCACTGTACTGAGG - Intergenic
1168421832 19:56209187-56209209 ATGGTGAAGTCACTGTGAAGTGG - Exonic
926271362 2:11369088-11369110 AATTGGAAGTTACAGTGATGGGG + Intergenic
926307274 2:11647414-11647436 ATGGAGATGTCCCTGTGATGTGG + Intergenic
927251529 2:20998926-20998948 ATGTGTAAGGCACTGTGCAGTGG - Intergenic
927962847 2:27251260-27251282 TTGTGCAAGGCACTGTGGTGCGG - Intergenic
928259866 2:29756843-29756865 ATGTGCCAGTCACTGTGCTAGGG + Intronic
928437007 2:31261228-31261250 AGGTGCCAGACACTGTGATGAGG - Intronic
929147715 2:38721411-38721433 AGGTGGAAGTGACTGGGACGGGG - Intronic
929559199 2:42945292-42945314 ATGTGGGGGTCACTGAAATGCGG - Intergenic
929766393 2:44847439-44847461 ATGTGTAAGTCACTTTGAGATGG + Intergenic
930107614 2:47652461-47652483 ATGTGAAACCCACTTTGATGTGG + Intergenic
930182969 2:48383257-48383279 GTGTGGAAGGGACAGTGATGCGG + Intergenic
930825143 2:55689371-55689393 AAGTGGTATTCACTGTGATTTGG - Intronic
935108443 2:100068841-100068863 GTCTGGAAGTGACTGTCATGGGG - Intronic
935441840 2:103107201-103107223 ATGTGAAAGACACTGTAAAGAGG - Intergenic
936835205 2:116701482-116701504 GCTTGGAAGTCACTGTGAAGAGG - Intergenic
937803753 2:126112945-126112967 GTGTGACAGTCACTGTGATGAGG - Intergenic
938151564 2:128889644-128889666 AGGAGGAAGTGACTGTGATCAGG + Intergenic
938718174 2:134039925-134039947 ATGTGGAAGTCACTGAGGATTGG + Intergenic
939805147 2:146766634-146766656 ATGTGCACATCTCTGTGATGAGG - Intergenic
941258163 2:163259591-163259613 AAGTGCAAGTACCTGTGATGTGG + Intergenic
944137197 2:196412657-196412679 ATGTGGCAGTAATTGTGAAGGGG - Intronic
944945958 2:204685549-204685571 ATGGGGAATTCACTGAGTTGGGG - Intronic
945895262 2:215474150-215474172 ATGTGGATGTCACCCTGTTGTGG - Intergenic
946585757 2:221185768-221185790 AAGTGGAAGCCAAAGTGATGGGG - Intergenic
947525590 2:230874981-230875003 ATGTGGAGGTAACCGTGATAGGG + Intronic
948969488 2:241414074-241414096 ACGGGGAAGACACTGTGCTGTGG + Intronic
1169910676 20:10645236-10645258 AGGTGACAGTCAGTGTGATGAGG - Exonic
1170422492 20:16206804-16206826 ATGTGCGAGTTACTGTGATGAGG + Intergenic
1170933064 20:20786423-20786445 ATCTGGAAGTAACTAGGATGGGG + Intergenic
1172285825 20:33739745-33739767 CTGTTGAAGCCACTGTGACGTGG - Intronic
1173378315 20:42510917-42510939 ATGTGGCAATCACTGAGAGGCGG + Intronic
1173582585 20:44158070-44158092 ATGTGCCAGTCACTGTTCTGAGG - Intronic
1173819301 20:46010394-46010416 ATGTTGAAGTCTCTGCGATATGG + Intronic
1173871575 20:46345336-46345358 TTGTGGTAGACACTGTGATGTGG + Intergenic
1174115850 20:48225911-48225933 ATCTGAAAGACACTGTGATTGGG - Intergenic
1174167635 20:48596437-48596459 CTGTGGAAACCACTGGGATGTGG - Intergenic
1174486349 20:50863791-50863813 AGGTGGATCTCAGTGTGATGGGG + Intronic
1175031932 20:55963325-55963347 ATGTGCAAGGCACTGTGCTATGG + Intergenic
1176656535 21:9592818-9592840 CTGTGGGAACCACTGTGATGGGG + Intergenic
1176938354 21:14893585-14893607 CTGGGGAAGGGACTGTGATGAGG - Intergenic
1177067146 21:16453849-16453871 ATGTCGAAGATACTGTGATTTGG - Intergenic
1177529519 21:22341458-22341480 ATGAGGAAGTTACTGTGAACTGG - Intergenic
1182172532 22:28247322-28247344 GTGTGTAAGTCACTGGGATAAGG + Intronic
1183238124 22:36635608-36635630 ATGTGGGAGTCACTGATATGAGG - Intronic
1184938349 22:47741288-47741310 ATGTGGCAGTCACTGTGAAAAGG - Intergenic
1185114164 22:48921820-48921842 ATGTGGCAGTCGCTGGGTTGTGG + Intergenic
949644942 3:6082590-6082612 ATGTGCTAGTCACTGTGCCGAGG + Intergenic
949763731 3:7502187-7502209 TTGTGGCAGTCACTGAGATGAGG - Intronic
950437739 3:12990868-12990890 ATGTGAAAGCCCCTGTGATCAGG + Intronic
950883555 3:16343500-16343522 AGGTGAAAGTGACAGTGATGCGG - Intronic
950974917 3:17230341-17230363 ATGTGGGAGTCACATTAATGTGG - Intronic
951932417 3:27983099-27983121 ATGTGAAAGTTACTGTTTTGAGG + Intergenic
952133410 3:30390184-30390206 ATCTGGATCTCACTGTGATTGGG - Intergenic
952333130 3:32383012-32383034 ATGTGCCAGGCACTGTGCTGAGG + Intergenic
952512293 3:34069594-34069616 ATGTGTCAGGCACTGTGTTGGGG + Intergenic
952536357 3:34313785-34313807 GTTTGGAAATCACTGTGAAGTGG + Intergenic
953068871 3:39500111-39500133 AAGTACAAGTCACTGAGATGAGG - Intronic
953155366 3:40366484-40366506 ATCTGAAAGGCAGTGTGATGAGG - Intergenic
954037099 3:47856901-47856923 CTGTGGAAGTCGCTGTGCGGAGG - Intronic
955822092 3:62907265-62907287 ATGTGGAAGACACAGGGGTGGGG + Intergenic
956419553 3:69072800-69072822 ATGAGGAAGTTACTGCAATGAGG - Intronic
957388652 3:79532204-79532226 ATGTGGAAGTGACTTACATGAGG + Intronic
958268083 3:91463554-91463576 TTTTGGAAGGCACTGTGGTGTGG - Intergenic
959670312 3:108970085-108970107 ATGGGGAAGTCACTGGCATGTGG + Intronic
960770474 3:121188246-121188268 ATATGGGAGTAAGTGTGATGCGG - Intronic
961635503 3:128330354-128330376 ATGTGGCAGGCACTGTGCTGAGG + Intronic
961928532 3:130509153-130509175 ATGTGGAATCCAGTGTGAAGAGG - Intergenic
962814627 3:138987239-138987261 AAGTGGAAGTCAGTCTGCTGAGG - Intergenic
965301567 3:167011470-167011492 ATGTGGAAGCCACCATGATTTGG + Intergenic
966669006 3:182506102-182506124 ATGTGAAAGGCTCTGTGGTGGGG - Intergenic
967256318 3:187595728-187595750 ATGTAGACGTCAGGGTGATGGGG + Intergenic
971347098 4:25821478-25821500 ATGTGGAAGGCACTGTGCAGAGG + Intronic
971584989 4:28394160-28394182 ATGTTGAAGTCACTGAGATTGGG - Intronic
974410352 4:61533256-61533278 AGGTTGAAATCATTGTGATGTGG + Intronic
979165227 4:117520523-117520545 ATTTTGAAGTAAGTGTGATGTGG + Intergenic
979880827 4:125957409-125957431 ATGTGGAAATTACTGTGAACTGG - Intergenic
981104748 4:140867536-140867558 AAGTGGAAGCAAGTGTGATGTGG + Exonic
981630734 4:146815537-146815559 ATCTGGAAGTCACTGGCATATGG + Intronic
981880486 4:149605360-149605382 ATGTGGGTGGGACTGTGATGTGG + Intergenic
982504943 4:156205615-156205637 ATGTGGAAGCCACTAAGGTGTGG + Intergenic
984505256 4:180609630-180609652 AGGTGGGAGTCTCTGTGAAGTGG - Intergenic
988232093 5:28492345-28492367 ATGTGGAACACACAGTGAGGAGG + Intergenic
988662501 5:33287308-33287330 ATGTGCAAGGCACTGTGGGGAGG + Intergenic
989526775 5:42462174-42462196 AAGTGGAAGTTACTCTGTTGAGG + Intronic
990086049 5:51979119-51979141 ATGTGTCAGGCACTATGATGAGG - Intergenic
990852033 5:60216185-60216207 ACTTGGAAGTCACTTTCATGGGG - Intronic
990903736 5:60780485-60780507 ATGTGGAAGTGACTTTGAAACGG - Intronic
991460020 5:66848049-66848071 TTGTTTAAGTCACTGTGATTTGG + Intronic
991639517 5:68738943-68738965 ATGTGTCTGGCACTGTGATGGGG - Intergenic
992074274 5:73176487-73176509 ATGTGGGAGGCAGTGTTATGAGG + Intergenic
992631030 5:78680844-78680866 TTGTGAAAGTGACTGTCATGAGG + Intronic
993383395 5:87233812-87233834 ATGTGCACATCACTGGGATGTGG - Intergenic
993822342 5:92634004-92634026 ATGTTTCAGTCACTGTGTTGTGG - Intergenic
994599279 5:101881677-101881699 ATGTGGAAGGCCATGTGCTGTGG + Intergenic
995870266 5:116737375-116737397 TTCTGGAAGTCACCGTGTTGAGG - Intergenic
996210572 5:120804108-120804130 ATTTGGAAGTCAGAGAGATGAGG + Intergenic
996960201 5:129237641-129237663 TTGTGGAAGACAGTGTGGTGGGG + Intergenic
997857862 5:137389607-137389629 ATGAGGATGTCACTGTGCTGAGG - Intronic
999083225 5:148863860-148863882 ATGTGGCAGTTCCTGGGATGTGG - Intergenic
999889921 5:155966216-155966238 ATGCTGAAGTCAAGGTGATGTGG - Intronic
1002516358 5:179761864-179761886 ATCTGGAAATCAATGGGATGTGG - Intronic
1003332971 6:5144959-5144981 AAGTGAGAGTCAGTGTGATGGGG + Intronic
1003357531 6:5387680-5387702 ATGTTCAGGACACTGTGATGGGG + Intronic
1003851064 6:10223226-10223248 ATTTCTAAGTCACTGTGATTTGG + Intergenic
1004533662 6:16478236-16478258 ATGTGGTAGTGACTGAGAAGGGG + Intronic
1004703739 6:18103586-18103608 ATGCTCAAGTCACTGTGAAGGGG - Intergenic
1005219418 6:23569954-23569976 ATGTGGCAGACATTGTGCTGGGG + Intergenic
1005560898 6:27039687-27039709 AAGTAGAAGGCACTGTAATGAGG + Intergenic
1005576273 6:27192393-27192415 TTGTGGAAGTCACATTGTTGAGG - Intergenic
1006303512 6:33206435-33206457 CAGTGGAAGTCACTGGTATGAGG + Exonic
1007122732 6:39396735-39396757 ATGTGCCAGGCACTGTGCTGGGG - Intronic
1007675850 6:43594392-43594414 ATGCGCAAGCCACTGTGCTGAGG + Intronic
1008051448 6:46903854-46903876 CTGTGCTAGTCACTGTGCTGTGG + Intronic
1008580013 6:52898178-52898200 GTGTGGATGCCACAGTGATGTGG - Intronic
1008691665 6:53986144-53986166 AGGAGGAAGGCAGTGTGATGTGG - Intronic
1008706666 6:54168997-54169019 ATTTGGAAGTCCCAATGATGTGG + Intronic
1008987120 6:57558010-57558032 TTTTGGAAGGCACTGTGGTGTGG + Intronic
1009175078 6:60450578-60450600 TTTTGGAAGGCACTGTGGTGTGG + Intergenic
1010909645 6:81537399-81537421 ATGTGGAAGTGACTTGGAAGTGG - Intronic
1011125891 6:84007223-84007245 ATGTGGAAGTCACTGTGATGTGG + Intergenic
1011558968 6:88596144-88596166 ATGTGGAAGTCAGGGTGGAGAGG + Intergenic
1012864874 6:104606845-104606867 ATGTGCAAGGCACTGTCCTGTGG - Intergenic
1012986852 6:105884786-105884808 ATGTGGCAGGCACTTTGAGGAGG - Intergenic
1014510292 6:122312527-122312549 ATGTGCCAGTCACTGTGTTTAGG - Intergenic
1016651244 6:146463464-146463486 ATGTGCCAGACACTGTGCTGAGG - Intergenic
1016701506 6:147059306-147059328 AAGTGGAATTCACAGAGATGTGG - Intergenic
1019121250 6:169806292-169806314 ATATGGAAGTCTCTGTGGTGTGG - Intergenic
1019121300 6:169806893-169806915 ATGTGGAGAGCTCTGTGATGTGG - Intergenic
1019125802 6:169839493-169839515 ATTTCTAAGTCACTGAGATGAGG - Intergenic
1019811196 7:3166285-3166307 ACGTGGAGATCACAGTGATGTGG + Intronic
1021379329 7:19948514-19948536 ATGTGGAAGTGACTGAAATTAGG + Intergenic
1021527628 7:21606499-21606521 ATGCGGAAGTCACTCTTATAAGG + Exonic
1021941251 7:25680846-25680868 ATGTGCAAATCACTGTGGTGTGG - Intergenic
1022656748 7:32326305-32326327 ATGTGGGAGTCACTGGCATATGG + Intergenic
1022959491 7:35413001-35413023 ATGAGGTAAGCACTGTGATGAGG + Intergenic
1024724044 7:52171871-52171893 ATGTGAATGTGAATGTGATGTGG + Intergenic
1025721836 7:64023692-64023714 ATGTGGCAAACACTGTGATTTGG - Intergenic
1025749386 7:64280223-64280245 ATGTGGCAAACACTGTGATCTGG - Intergenic
1026047355 7:66915915-66915937 ATGGGGAAGCCACTGTGATAGGG - Intergenic
1026481673 7:70784980-70785002 TTGAGGAAGTTGCTGTGATGAGG - Exonic
1026959126 7:74397437-74397459 ATGTGGCAGTCTGTGTGATACGG + Intronic
1029288538 7:99484001-99484023 ATGGGGAAGTAAATGGGATGTGG - Intronic
1029926382 7:104323415-104323437 ATATGAAAGTCAGTGTGATGGGG - Intergenic
1030890110 7:114989334-114989356 ATGGAGAAGCCACAGTGATGTGG + Intronic
1031023486 7:116653484-116653506 ATGTTTAAGCCACTGTTATGTGG + Intergenic
1031172590 7:118310019-118310041 ATGTGGAAGTGACTTTGAAATGG - Intergenic
1031652057 7:124303417-124303439 ATGTGGAAGCCACTGAGCCGTGG - Intergenic
1033002035 7:137516526-137516548 ATGTGATAATAACTGTGATGGGG - Intronic
1033318070 7:140314980-140315002 GTTTGGAATTCACTGTGATCTGG + Intronic
1033566167 7:142580313-142580335 ATGCAGAAGACACTGTGCTGTGG + Intergenic
1033900264 7:146130019-146130041 GTTTGGAAGTCACTTTGATGAGG + Intronic
1034288866 7:149911434-149911456 ATGTGCCAGTCACTGTGCCGGGG - Intergenic
1035078276 7:156195373-156195395 CTGTGGAATACACTCTGATGAGG - Intergenic
1036434354 8:8719637-8719659 ATGTGGAAGTCACTGAGCCAGGG + Intergenic
1037818607 8:22124942-22124964 ATGAGGAACTCTCTGTGCTGCGG + Intronic
1038358541 8:26854511-26854533 ATGTGGCAGCCAGTGTGGTGGGG + Intronic
1038685777 8:29717097-29717119 CTGTGAAAGACACTGTGAAGAGG + Intergenic
1038711188 8:29947543-29947565 CTGTGGAAGACCCTGTGAGGGGG - Intergenic
1038868035 8:31461049-31461071 ATGTTTAAGTTACTGAGATGTGG + Intergenic
1039575852 8:38623541-38623563 ATGTGCATGACACTGTGACGGGG - Intergenic
1039835562 8:41253722-41253744 ATGTGCAAGGCACTGTACTGAGG + Intergenic
1040488748 8:47900005-47900027 ATGTGGTAACCACTGAGATGTGG - Intronic
1040596626 8:48844435-48844457 ATGTGGAAATATCTGTGATGTGG + Intergenic
1040739647 8:50557575-50557597 AAGCGGAGGTCAGTGTGATGTGG - Intronic
1040764232 8:50887775-50887797 CTGTTTAAGTCAGTGTGATGGGG - Intergenic
1041205644 8:55495544-55495566 CCCTGGAAGCCACTGTGATGGGG - Intronic
1042882930 8:73514298-73514320 ATGCAGAACTGACTGTGATGAGG - Intronic
1043891113 8:85653845-85653867 ATGTGGAAATAAGTGTGATGTGG + Intergenic
1043892189 8:85660682-85660704 ATGTGGAAATAAGTGTGATGTGG + Intergenic
1043893374 8:85716658-85716680 ATGTGGAAATAAGTGTGATGTGG - Intergenic
1043896057 8:85738107-85738129 ATGTGGAAATAAGTGTGATGTGG - Intergenic
1043896622 8:85743701-85743723 ATGTGGAAATAAGTGTGATGTGG + Intergenic
1043898945 8:85762068-85762090 ATGTGGAAATAAGTGTGATGTGG + Intergenic
1043900556 8:85774262-85774284 ATGTGGAAATAAGTGTGATGTGG + Intergenic
1043902520 8:85789537-85789559 ATGTGGAAATAAGTGTGATGTGG + Intergenic
1043904130 8:85801730-85801752 ATGTGGAAATAAGTGTGATGTGG + Intergenic
1043905742 8:85813924-85813946 ATGTGGAAATAAGTGTGATGTGG + Intergenic
1043907350 8:85826111-85826133 ATGTGGAAATAAGTGTGATGTGG + Intergenic
1044591809 8:93919853-93919875 GTATGGAAGCCACTGTCATGTGG + Intronic
1045388677 8:101694008-101694030 ATGTGGAGGTCACAGGCATGGGG - Intronic
1045394755 8:101749857-101749879 ATGTGGAAGTAAAAGGGATGAGG - Intronic
1046525318 8:115375549-115375571 GTGGGGAAGTCAATGTGGTGAGG - Intergenic
1047120848 8:121902843-121902865 AAGTAGAAGGCAGTGTGATGTGG + Intergenic
1047132555 8:122037298-122037320 ATGTAGAAGATACTGTGGTGTGG - Intergenic
1047981213 8:130184638-130184660 ATGTTGAAGCCACTGTTATTTGG + Intronic
1048419232 8:134260866-134260888 ATGTGGAAGTGACTTTGAACTGG + Intergenic
1048726249 8:137388244-137388266 ATGTGGAAGTCACTTTGGAATGG - Intergenic
1049312495 8:141940629-141940651 CTGTGGAAGTCCATGGGATGTGG + Intergenic
1050810863 9:9745796-9745818 ATATGAAAAGCACTGTGATGGGG - Intronic
1051450776 9:17194689-17194711 ATGTGGAAGTGACTTTGAACTGG - Intronic
1052764800 9:32630179-32630201 AAGTGGAAGTGACTCTGATGTGG - Exonic
1053584297 9:39440347-39440369 ATCTGGAAGTCCCTATAATGGGG + Intergenic
1054105877 9:60999093-60999115 ATCTGGAAGTCCCTATAATGGGG + Intergenic
1055000252 9:71441113-71441135 ATTTTTAATTCACTGTGATGAGG + Intronic
1055024380 9:71703748-71703770 ATGATGGAGTCAGTGTGATGGGG - Intronic
1055615168 9:78064494-78064516 AAGTGGAAATCACTGTGAGAAGG - Intergenic
1057133277 9:92669613-92669635 ATGTGGAACTGACTCTGACGGGG + Intronic
1059137447 9:111820790-111820812 TTGTGGAAGTCACTGTTGTCTGG - Intergenic
1061402368 9:130375552-130375574 TGGTGGGAGCCACTGTGATGGGG - Intronic
1061541269 9:131278827-131278849 CTGTGGAAGTCAGAGTCATGGGG - Intergenic
1186756592 X:12678216-12678238 ATGTGAAAGGCCCAGTGATGGGG - Intronic
1186873723 X:13797181-13797203 ATGTGCAAGCCACTGTGGTGGGG + Intronic
1186944774 X:14553613-14553635 ATGTAGAAGTCAGGTTGATGTGG - Intronic
1187643630 X:21321856-21321878 CTGTGAAAGACAATGTGATGAGG - Intergenic
1189237730 X:39501086-39501108 TTGGGGAAGTCACGGTGAGGAGG - Intergenic
1189818368 X:44846385-44846407 ATTTGGACGTCACTGGGCTGTGG - Intergenic
1192478043 X:71460642-71460664 AAGTGGAAGTGACTCTGATGTGG + Exonic
1193273024 X:79550616-79550638 ATGTGGAAGCTACTGTCATGAGG + Intergenic
1194605039 X:95967905-95967927 ATGTGAAAGTAACAGTGAGGAGG - Intergenic
1195731130 X:107968502-107968524 TTGTGGAAGTCAGTGTCATTGGG + Intergenic
1196606668 X:117664870-117664892 ATGAGTAAATCATTGTGATGGGG - Intergenic
1197484509 X:127031707-127031729 ATATAGAAGCCACTGTGTTGGGG + Intergenic
1199435541 X:147808625-147808647 CTCAGGAAGTCAGTGTGATGGGG - Intergenic
1200037234 X:153339813-153339835 GTCTGGATGTCACTGCGATGTGG + Intronic