ID: 1011128104

View in Genome Browser
Species Human (GRCh38)
Location 6:84028709-84028731
Sequence CTGAATAACAAAGCTGTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011128104_1011128108 0 Left 1011128104 6:84028709-84028731 CCAGCTACAGCTTTGTTATTCAG No data
Right 1011128108 6:84028732-84028754 GCCTAGGCTATTTGGAGTCTTGG No data
1011128104_1011128110 8 Left 1011128104 6:84028709-84028731 CCAGCTACAGCTTTGTTATTCAG No data
Right 1011128110 6:84028740-84028762 TATTTGGAGTCTTGGTTAGAAGG No data
1011128104_1011128107 -8 Left 1011128104 6:84028709-84028731 CCAGCTACAGCTTTGTTATTCAG No data
Right 1011128107 6:84028724-84028746 TTATTCAGGCCTAGGCTATTTGG No data
1011128104_1011128111 19 Left 1011128104 6:84028709-84028731 CCAGCTACAGCTTTGTTATTCAG No data
Right 1011128111 6:84028751-84028773 TTGGTTAGAAGGCCTTCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011128104 Original CRISPR CTGAATAACAAAGCTGTAGC TGG (reversed) Intergenic
No off target data available for this crispr