ID: 1011128108

View in Genome Browser
Species Human (GRCh38)
Location 6:84028732-84028754
Sequence GCCTAGGCTATTTGGAGTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011128104_1011128108 0 Left 1011128104 6:84028709-84028731 CCAGCTACAGCTTTGTTATTCAG No data
Right 1011128108 6:84028732-84028754 GCCTAGGCTATTTGGAGTCTTGG No data
1011128103_1011128108 14 Left 1011128103 6:84028695-84028717 CCACAGGAAAAGCTCCAGCTACA No data
Right 1011128108 6:84028732-84028754 GCCTAGGCTATTTGGAGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011128108 Original CRISPR GCCTAGGCTATTTGGAGTCT TGG Intergenic
No off target data available for this crispr