ID: 1011128110

View in Genome Browser
Species Human (GRCh38)
Location 6:84028740-84028762
Sequence TATTTGGAGTCTTGGTTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011128104_1011128110 8 Left 1011128104 6:84028709-84028731 CCAGCTACAGCTTTGTTATTCAG No data
Right 1011128110 6:84028740-84028762 TATTTGGAGTCTTGGTTAGAAGG No data
1011128103_1011128110 22 Left 1011128103 6:84028695-84028717 CCACAGGAAAAGCTCCAGCTACA No data
Right 1011128110 6:84028740-84028762 TATTTGGAGTCTTGGTTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011128110 Original CRISPR TATTTGGAGTCTTGGTTAGA AGG Intergenic
No off target data available for this crispr